High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

Summary

In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

Abstract

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3′UTR-U30 (5'-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3').

Introduction

The Zika virus (ZIKV) is an emerging arthropod-borne virus member of the genus Flavivirus, which includes the closely related Dengue virus (DENV), Japanese encephalitis virus (JEV) and Yellow Fever virus (YFV), that pose constant threats to public health¹. The 2015-16 ZIKV outbreak in the Americas received global attention following its emergence in Brazil due to the association with severe neurological disorders, such as congenital ZIKV-associated microcephaly in newborns^2,3 and Guillain-Barré syndrome in adults⁴. Although the number of infect....

Protocol

1. Luciferase activity assay

NOTE: Ensure that all procedures involving cell culture are conducted in certified biosafety hoods (see Table of Materials).

1. Prepare growth media consisting in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% FBS and 500 µg/mL G418.
2. Prepare a 10 mM stock solution of tested compounds in 100% DMSO, and then dilute them to 1 mM in 100% DMSO.
3. Culture ZIKV Rluc r.......

Discussion

The protocols described herein could be readily adapted for screenings in a 384 or 1536-well formats. For biochemical and/or cell-based screenings performed in HTS format, the Z' factor value, a statistical parameter, is calculate for each plate to ensure the sensitivity, reproducibility and accuracy of those assays¹². A Z' factor value of 0.5 or above is expected for replicon-based screenings while a value of 0.7 or above is expected for the NS3 and NS5 activity assays. For the replicon-b.......

Materials

Name	Company	Catalog Number	Comments
5'-biotin-U30- ACUGGAGAUCGAUCUCCAGU -3'	Dharmacon	-	100 ng
96-well cell culture plates	KASVI	K12-096
96-well PCR Microplate	KASVI	K4-9610
96-well White Flat Bottom Polystyrene High Bind Microplate	Corning	3922
AMC (7-amine-4-methylcoumarine)	SIGMA-Aldrich	257370	100 mg
Aprotinin from bovine lung	SIGMA-Aldrich	A1153	10 mg
ATP	JenaBioscience	NU-1010-1G	1 g
Bz-nKRR-AMC	International Peptides	-	5 mg
Class II Biohazard Safety Cabinet	ESCO
Diethyl pyrocarbonate	SIGMA-Aldrich	D5758	25 mL
DMSO (Dimethyl sulfoxide)	SIGMA-Aldrich	472301	1 L
Dulbecco’s Modified Eagle Medium	GIBCO	3760091
Fetal Bovine Serum	GIBCO	12657-029	500 mL
G418	SIGMA-Aldrich	A1720	Disulfate salt
Glycerol	SIGMA-Aldrich	G5516	1 L
HERACELL VIOS 160i CO2 incubator	Thermo Scientific
MnCl2 tetrahydrate	SIGMA-Aldrich	203734	25 g
MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide)	Invitrogen	M6494
NITD008 ≥98% (HPLC)	Sigma-Aldrich	SML2409	5 mg
qPCR system Mx3000P	Agilent
Renilla luciferase Assay System	PROMEGA	E2810
SpectraMax Gemini EM Fluorescence Reader	Molecular Devices
SpectraMax i3 Multi-Mode Detection Platform	Molecular Devices
SpectraMax Plus 384 Absorbance Microplate Reader	Molecular Devices
SYBR Green I	Invitrogen	S7563	500 µl
Triton X-100	SIGMA-Aldrich	X100	500 mL
Trizma base	SIGMA-Aldrich	T1503	1 kg
Trypsin-EDTA Solution 1X	SIGMA-Aldrich	59417-C	100 mL