Sign In

A subscription to JoVE is required to view this content. Sign in or start your free trial.

In This Article

  • Summary
  • Abstract
  • Introduction
  • Protocol
  • Representative Results
  • Discussion
  • Acknowledgements
  • Materials
  • References
  • Reprints and Permissions

Summary

In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

Abstract

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3′UTR-U30 (5'-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3').

Introduction

The Zika virus (ZIKV) is an emerging arthropod-borne virus member of the genus Flavivirus, which includes the closely related Dengue virus (DENV), Japanese encephalitis virus (JEV) and Yellow Fever virus (YFV), that pose constant threats to public health1. The 2015-16 ZIKV outbreak in the Americas received global attention following its emergence in Brazil due to the association with severe neurological disorders, such as congenital ZIKV-associated microcephaly in newborns2,3 and Guillain-Barré syndrome in adults4. Although the number of infect....

Protocol

1. Luciferase activity assay

NOTE: Ensure that all procedures involving cell culture are conducted in certified biosafety hoods (see Table of Materials).

  1. Prepare growth media consisting in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% FBS and 500 µg/mL G418.
  2. Prepare a 10 mM stock solution of tested compounds in 100% DMSO, and then dilute them to 1 mM in 100% DMSO.
  3. Culture ZIKV Rluc r.......

Representative Results

All the protocols described herein were stablished in 96-well plates and allows the evaluation of 80 compounds per plate in a primary screening of a single concentration, including the negative and positive controls placed at the first and last column of the plates, respectively. The replicon-based screenings are represented in Figure 1, which includes the RNA construct developed to obtain the BHK-21-RepZIKV_IRES-Neo cell line (Figure 1A), the assays schematic r.......

Discussion

The protocols described herein could be readily adapted for screenings in a 384 or 1536-well formats. For biochemical and/or cell-based screenings performed in HTS format, the Z' factor value, a statistical parameter, is calculate for each plate to ensure the sensitivity, reproducibility and accuracy of those assays12. A Z' factor value of 0.5 or above is expected for replicon-based screenings while a value of 0.7 or above is expected for the NS3 and NS5 activity assays. For the replicon-b.......

Acknowledgements

This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP), CEPID grant 2013/07600-3 to GO, grant 2018/05130-3 to RSF and 2016/19712-9 to ASG, and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (grant 88887.516153/2020-00) to ASG. We would like to gratefully thank the Medicine for Malaria Ventures (MMV, www.mmv.org) and the Drugs for Neglected Diseases initiative (DNDi, www.dndi.org) for their support, design of the Pandemic Response Box and supplying the compounds.

....

Materials

NameCompanyCatalog NumberComments
5'-biotin-U30- ACUGGAGAUCGAUCUCCAGU -3'Dharmacon-100 ng
96-well cell culture platesKASVIK12-096
96-well PCR MicroplateKASVIK4-9610
96-well White Flat Bottom Polystyrene High Bind MicroplateCorning3922
AMC (7-amine-4-methylcoumarine)SIGMA-Aldrich257370100 mg
Aprotinin from bovine lungSIGMA-AldrichA115310 mg
ATPJenaBioscienceNU-1010-1G1 g
Bz-nKRR-AMCInternational Peptides-5 mg
Class II Biohazard Safety CabinetESCO
Diethyl pyrocarbonateSIGMA-AldrichD575825 mL
DMSO (Dimethyl sulfoxide)SIGMA-Aldrich4723011 L
Dulbecco’s Modified Eagle MediumGIBCO3760091
Fetal Bovine SerumGIBCO12657-029500 mL
G418SIGMA-AldrichA1720Disulfate salt
GlycerolSIGMA-AldrichG55161 L
HERACELL VIOS 160i CO2 incubatorThermo Scientific
MnCl2 tetrahydrateSIGMA-Aldrich20373425 g
MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide)InvitrogenM6494
NITD008 ≥98% (HPLC)Sigma-AldrichSML24095 mg
qPCR system Mx3000PAgilent
Renilla luciferase Assay SystemPROMEGAE2810
SpectraMax Gemini EM Fluorescence ReaderMolecular Devices
SpectraMax i3 Multi-Mode Detection PlatformMolecular Devices
SpectraMax Plus 384 Absorbance Microplate ReaderMolecular Devices
SYBR Green IInvitrogenS7563500 µl
Triton X-100SIGMA-AldrichX100500 mL
Trizma baseSIGMA-AldrichT15031 kg
Trypsin-EDTA Solution 1XSIGMA-Aldrich59417-C100 mL

References

  1. Zou, J., Shi, P. Y. Strategies for Zika drug discovery. Current Opinion in Virology. 35, 19-26 (2019).
  2. Cugola, F. R., et al. The Brazilian Zika virus strain causes birth defects in experimental models. Natur....

Explore More Articles

Zika VirusAntiviral AssayHigh throughput ScreeningRepliconViral EnzymeRenilla LuciferaseNS3 ProteaseNS5 RNA dependent RNA PolymeraseRdRpBHK 21 Cell LineCell CultureTrypsinizationCompound ScreeningDMEMDMSOPositive ControlNegative ControlRenilla Luciferase Lysis Buffer

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved