A subscription to JoVE is required to view this content. Sign in or start your free trial.
In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.
Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3′UTR-U30 (5'-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3').
The Zika virus (ZIKV) is an emerging arthropod-borne virus member of the genus Flavivirus, which includes the closely related Dengue virus (DENV), Japanese encephalitis virus (JEV) and Yellow Fever virus (YFV), that pose constant threats to public health1. The 2015-16 ZIKV outbreak in the Americas received global attention following its emergence in Brazil due to the association with severe neurological disorders, such as congenital ZIKV-associated microcephaly in newborns2,3 and Guillain-Barré syndrome in adults4. Although the number of infect....
1. Luciferase activity assay
NOTE: Ensure that all procedures involving cell culture are conducted in certified biosafety hoods (see Table of Materials).
All the protocols described herein were stablished in 96-well plates and allows the evaluation of 80 compounds per plate in a primary screening of a single concentration, including the negative and positive controls placed at the first and last column of the plates, respectively. The replicon-based screenings are represented in Figure 1, which includes the RNA construct developed to obtain the BHK-21-RepZIKV_IRES-Neo cell line (Figure 1A), the assays schematic r.......
The protocols described herein could be readily adapted for screenings in a 384 or 1536-well formats. For biochemical and/or cell-based screenings performed in HTS format, the Z' factor value, a statistical parameter, is calculate for each plate to ensure the sensitivity, reproducibility and accuracy of those assays12. A Z' factor value of 0.5 or above is expected for replicon-based screenings while a value of 0.7 or above is expected for the NS3 and NS5 activity assays. For the replicon-b.......
This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP), CEPID grant 2013/07600-3 to GO, grant 2018/05130-3 to RSF and 2016/19712-9 to ASG, and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (grant 88887.516153/2020-00) to ASG. We would like to gratefully thank the Medicine for Malaria Ventures (MMV, www.mmv.org) and the Drugs for Neglected Diseases initiative (DNDi, www.dndi.org) for their support, design of the Pandemic Response Box and supplying the compounds.
....Name | Company | Catalog Number | Comments |
5'-biotin-U30- ACUGGAGAUCGAUCUCCAGU -3' | Dharmacon | - | 100 ng |
96-well cell culture plates | KASVI | K12-096 | |
96-well PCR Microplate | KASVI | K4-9610 | |
96-well White Flat Bottom Polystyrene High Bind Microplate | Corning | 3922 | |
AMC (7-amine-4-methylcoumarine) | SIGMA-Aldrich | 257370 | 100 mg |
Aprotinin from bovine lung | SIGMA-Aldrich | A1153 | 10 mg |
ATP | JenaBioscience | NU-1010-1G | 1 g |
Bz-nKRR-AMC | International Peptides | - | 5 mg |
Class II Biohazard Safety Cabinet | ESCO | ||
Diethyl pyrocarbonate | SIGMA-Aldrich | D5758 | 25 mL |
DMSO (Dimethyl sulfoxide) | SIGMA-Aldrich | 472301 | 1 L |
Dulbecco’s Modified Eagle Medium | GIBCO | 3760091 | |
Fetal Bovine Serum | GIBCO | 12657-029 | 500 mL |
G418 | SIGMA-Aldrich | A1720 | Disulfate salt |
Glycerol | SIGMA-Aldrich | G5516 | 1 L |
HERACELL VIOS 160i CO2 incubator | Thermo Scientific | ||
MnCl2 tetrahydrate | SIGMA-Aldrich | 203734 | 25 g |
MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) | Invitrogen | M6494 | |
NITD008 ≥98% (HPLC) | Sigma-Aldrich | SML2409 | 5 mg |
qPCR system Mx3000P | Agilent | ||
Renilla luciferase Assay System | PROMEGA | E2810 | |
SpectraMax Gemini EM Fluorescence Reader | Molecular Devices | ||
SpectraMax i3 Multi-Mode Detection Platform | Molecular Devices | ||
SpectraMax Plus 384 Absorbance Microplate Reader | Molecular Devices | ||
SYBR Green I | Invitrogen | S7563 | 500 µl |
Triton X-100 | SIGMA-Aldrich | X100 | 500 mL |
Trizma base | SIGMA-Aldrich | T1503 | 1 kg |
Trypsin-EDTA Solution 1X | SIGMA-Aldrich | 59417-C | 100 mL |
This article has been published
Video Coming Soon
ABOUT JoVE
Copyright © 2024 MyJoVE Corporation. All rights reserved