JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Immunology and Infection

High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

Published: October 30th, 2021

DOI:

10.3791/62422

1São Carlos Institute of Physics, University of Sao Paulo

In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3′UTR-U30 (5'-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3').

The Zika virus (ZIKV) is an emerging arthropod-borne virus member of the genus Flavivirus, which includes the closely related Dengue virus (DENV), Japanese encephalitis virus (JEV) and Yellow Fever virus (YFV), that pose constant threats to public health1. The 2015-16 ZIKV outbreak in the Americas received global attention following its emergence in Brazil due to the association with severe neurological disorders, such as congenital ZIKV-associated microcephaly in newborns2,3 and Guillain-Barré syndrome in adults4. Although the number of infect....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

1. Luciferase activity assay

NOTE: Ensure that all procedures involving cell culture are conducted in certified biosafety hoods (see Table of Materials).

  1. Prepare growth media consisting in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% FBS and 500 µg/mL G418.
  2. Prepare a 10 mM stock solution of tested compounds in 100% DMSO, and then dilute them to 1 mM in 100% DMSO.
  3. Culture ZIKV Rluc r.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

All the protocols described herein were stablished in 96-well plates and allows the evaluation of 80 compounds per plate in a primary screening of a single concentration, including the negative and positive controls placed at the first and last column of the plates, respectively. The replicon-based screenings are represented in Figure 1, which includes the RNA construct developed to obtain the BHK-21-RepZIKV_IRES-Neo cell line (Figure 1A), the assays schematic r.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

The protocols described herein could be readily adapted for screenings in a 384 or 1536-well formats. For biochemical and/or cell-based screenings performed in HTS format, the Z' factor value, a statistical parameter, is calculate for each plate to ensure the sensitivity, reproducibility and accuracy of those assays12. A Z' factor value of 0.5 or above is expected for replicon-based screenings while a value of 0.7 or above is expected for the NS3 and NS5 activity assays. For the replicon-b.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP), CEPID grant 2013/07600-3 to GO, grant 2018/05130-3 to RSF and 2016/19712-9 to ASG, and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (grant 88887.516153/2020-00) to ASG. We would like to gratefully thank the Medicine for Malaria Ventures (MMV, www.mmv.org) and the Drugs for Neglected Diseases initiative (DNDi, www.dndi.org) for their support, design of the Pandemic Response Box and supplying the compounds.

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
5'-biotin-U30- ACUGGAGAUCGAUCUCCAGU -3' Dharmacon - 100 ng
96-well cell culture plates KASVI K12-096
96-well PCR Microplate KASVI K4-9610
96-well White Flat Bottom Polystyrene High Bind Microplate Corning 3922
AMC (7-amine-4-methylcoumarine) SIGMA-Aldrich 257370 100 mg
Aprotinin from bovine lung SIGMA-Aldrich A1153 10 mg
ATP JenaBioscience NU-1010-1G 1 g
Bz-nKRR-AMC International Peptides - 5 mg
Class II Biohazard Safety Cabinet ESCO
Diethyl pyrocarbonate SIGMA-Aldrich D5758 25 mL
DMSO (Dimethyl sulfoxide) SIGMA-Aldrich 472301 1 L
Dulbecco’s Modified Eagle Medium GIBCO 3760091
Fetal Bovine Serum GIBCO 12657-029 500 mL
G418 SIGMA-Aldrich A1720 Disulfate salt
Glycerol SIGMA-Aldrich G5516 1 L
HERACELL VIOS 160i CO2 incubator Thermo Scientific
MnCl2 tetrahydrate SIGMA-Aldrich 203734 25 g
MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) Invitrogen M6494
NITD008 ≥98% (HPLC) Sigma-Aldrich SML2409 5 mg
qPCR system Mx3000P Agilent
Renilla luciferase Assay System PROMEGA E2810
SpectraMax Gemini EM Fluorescence Reader Molecular Devices
SpectraMax i3 Multi-Mode Detection Platform Molecular Devices
SpectraMax Plus 384 Absorbance Microplate Reader Molecular Devices
SYBR Green I Invitrogen S7563 500 µl
Triton X-100 SIGMA-Aldrich X100 500 mL
Trizma base SIGMA-Aldrich T1503 1 kg
Trypsin-EDTA Solution 1X SIGMA-Aldrich 59417-C 100 mL

  1. Zou, J., Shi, P. Y. Strategies for Zika drug discovery. Current Opinion in Virology. 35, 19-26 (2019).
  2. Cugola, F. R., et al. The Brazilian Zika virus strain causes birth defects in experimental models. Nature. 534 (7606), 267-271 (2016).
  3. de Araújo, T. V. B., et al. Association between microcephaly, Zika virus infection, and other risk factors in Brazil: Final report of a case-control study. The Lancet Infectious Diseases. 18 (3), 328-336 (2018).
  4. Cao-Lormeau, V. -. M., et al. Guillain-Barré Syndrome outbreak associated with Zika virus infection in French Polynesia: a case-control study. The Lancet. 387 (10027), 1531-1539 (2016).
  5. Pielnaa, P., et al. Zika virus-spread, epidemiology, genome, transmission cycle, clinical manifestation, associated challenges, vaccine and antiviral drug development. Virology. 543, 34-42 (2020).
  6. Bollati, M., et al. Structure and functionality in flavivirus NS-proteins: Perspectives for drug design Flaviviral NS3 protein Flaviviral NS5 protein Protease Helicase Polymerase Methyltransferase Flavivirus protein structure Antivirals VIZIER Consortium. Antiviral Research. 87, 125-148 (2010).
  7. Fernandes, R. S., et al. Reporter replicons for antiviral drug discovery against positive single-stranded RNA viruses. Viruses. 12 (6), (2020).
  8. Fernandes, R. S., et al. Discovery of an imidazonaphthyridine and a riminophenazine as potent anti-Zika virus agents through a replicon-based high-throughput screening. Virus Research. 299, 198388 (2021).
  9. Noske, G. D., et al. Structural characterization and polymorphism analysis of the NS2B-NS3 protease from the 2017 Brazilian circulating strain of Yellow Fever virus. Biochimica et Biophysica Acta - General Subjects. 1864 (4), 129521 (2020).
  10. Godoy, A. S., et al. Crystal structure of Zika virus NS5 RNA-dependent RNA polymerase. Nature Communications. 8, 14764 (2017).
  11. Yin, Z., et al. An adenosine nucleoside inhibitor of dengue virus. Proceedings of the National Academy of Sciences. 106 (48), 20435-20439 (2009).
  12. Zhang, J. H., Chung, T. D. Y., Oldenburg, K. R. A simple statistical parameter for use in evaluation and validation of high throughput screening assays. Journal of Biomolecular Screening. 4 (2), 67-73 (1999).
  13. Brecher, M., Zhang, J., Li, H. The flavivirus protease as a target for drug discovery. Virologica Sinica. 28 (6), 326-336 (2013).
  14. Noble, C. G., Seh, C. C., Chao, A. T., Shi, P. Y. Ligand-bound structures of the dengue virus protease reveal the active conformation. Journal of Virology. 86 (1), 438-446 (2012).
  15. Chen, X., et al. Mechanisms of activation and inhibition of Zika virus NS2B-NS3 protease. Cell Research. 26 (11), 1260-1263 (2016).
  16. Eyer, L., Nencka, R., de Clercq, E., Seley-Radtke, K., Růžek, D. Nucleoside analogs as a rich source of antiviral agents active against arthropod-borne flaviviruses. Antiviral Chemistry and Chemotherapy. 26, (2018).
  17. Xie, X., et al. Zika Virus Replicons for Drug Discovery. EBioMedicine. 12, 156-160 (2016).
  18. Pan, K. L., Lee, J. C., Sung, H. W., Chang, T. Y., Hsu, J. T. A. Development of NS3/4A protease-based reporter assay suitable for efficiently assessing hepatitis C virus infection. Antimicrobial Agents and Chemotherapy. 53 (11), 4825-4834 (2009).
  19. Khumthong, R., Angsuthanasombat, C., Panyim, S., Katzenmeier, G. In Vitro Determination of Dengue Virus Type 2 NS2B-NS3 Protease Activity with Fluorescent Peptide Substrates. Journal of Biochemistry and Molecular Biology. 35 (2), (2002).
  20. Ulanday, G. E. L., Okamoto, K., Morita, K. Development and utility of an in vitro, fluorescence-based assay for the discovery of novel compounds against dengue 2 viral protease. Tropical Medicine and Health. 44 (1), 1-10 (2016).
  21. Ong, I. L. H., Yang, K. L. Recent developments in protease activity assays and sensors. Analyst. 142 (11), 1867-1881 (2017).
  22. Eltahla, A. A., Lackovic, K., Marquis, C., Eden, J. S., White, P. A. A fluorescence-based high-throughput screen to identify small compound inhibitors of the genotype 3a hepatitis c virus RNA polymerase. Journal of Biomolecular Screening. 18 (9), 1027-1034 (2013).
  23. Eydoux, C., et al. A fluorescence-based high throughput-screening assay for the SARS-CoV RNA synthesis complex. Journal of Virological Methods. 288, 114013 (2021).
  24. Shimizu, H., et al. Discovery of a small molecule inhibitor targeting dengue virus NS5 RNA-dependent RNA polymerase. PLoS Neglected Tropical Diseases. 13 (11), 1-21 (2019).
  25. Sáez-Álvarez, Y., Arias, A., del Águila, C., Agudo, R. Development of a fluorescence-based method for the rapid determination of Zika virus polymerase activity and the screening of antiviral drugs. Scientific Reports. 9 (1), 1-11 (2019).
  26. Kocabas, F., Turan, R. D., Aslan, G. S. Fluorometric RdRp assay with self-priming RNA. Virus Genes. 50 (3), 498-504 (2015).
  27. Niyomrattanakit, P., et al. A fluorescence-based alkaline phosphatase-coupled polymerase assay for identification of inhibitors of dengue virus RNA-Dependent RNA polymerase. Journal of Biomolecular Screening. 16 (2), 201-210 (2011).
  28. Simeonov, A., Davis, M. I. . Interference with Fluorescence and Absorbance Flow Chart Fluorescence Interferences. (Md). , 1-8 (2016).
  29. Genick, C. C., et al. Applications of biophysics in high- Throughput screening hit validation. Journal of Biomolecular Screening. 19 (5), 707-714 (2014).
  30. Smith, T. M., et al. Identifying initiation and elongation inhibitors of dengue virus RNA polymerase in a high-throughput lead-finding campaign. Journal of Biomolecular Screening. 20 (1), 153-163 (2015).
  31. Porecha, R., Herschlag, D. RNA radiolabeling. Methods in enzymology. 530, 255-279 (2013).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved