We thank Anuja Kibe and Jun. Prof. Redmond Smyth for critically reviewing the manuscript. We thank Tatyana Koch for expert technical assistance. We thank Kristyna Pekarkova for the help with recording experimental videos. The work in our laboratory is supported by the Helmholtz Association and funding from the European Research Council (ERC) Grant Nr. 948636 (to NC).

1. Sample preparation
<ol>
	<li>Clone the sequence of interest into the vector containing the Lambda DNA fragments, which serve&#160;as the handle sequences (Figure 2)43,50.</li>
	<li>First generate a DNA template for subsequent in vitro transcription via PCR (Figure 2B; reaction 1). At this PCR step, the T7 promoter is added in the 5&#39; end of the sense DNA molecule<sup cla...

Here, we demonstrate the use of fluorescence-coupled optical tweezers to study interactions and dynamic behavior of RNA molecules with various ligands. Below, critical steps and limitations of the present technique are discussed.
Critical steps in the protocol 
As for many other methods, the quality of the sample is pivotal to obtain reliable data. Therefore, to obtain the highest possible quality samples, it is worth it to spend time to optimize the procedure for sample ...

Transfer of genetic information from DNA to proteins through mRNAs is a complex biochemical process, which is precisely regulated on all levels through macromolecular interactions inside cells. For translational regulation, RNA-protein interactions confer a critical role to rapidly react to various stimuli and signals1,2. Some RNA-protein interactions affect mRNA stability and thereby alter the time an RNA is translationally active. Other RNA-protein interactions are associated with recoding mechanisms such as stop-codon readthrough, bypassing, or programmed ribosomal frameshifting (PRF)3,4,5,6,7. Recently, a number of RNA-binding proteins (RBPs) have been demonstrated to interact with stimulatory mRNA elements and the translation machinery to dictate when and how much recoding will occur in the cell7,8,9,10,11. Thus, to dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is pivotal to study the interaction principles and mechanical properties of these RNA-protein complexes in detail.
Decades of work have laid the foundation to study the multi-step and multi-component process of translation, which relies on intricate communication between the RNA and protein components of the translation machinery to achieve speed and accuracy12,13,14. A crucial next step in understanding complex regulatory events is determining the forces, timescales, and structural determinants during translation at high precision12,15,16,17. The study of RNA conformational dynamics and especially how trans-acting auxiliary factors act on the RNA structure during translation have been further illuminated by the emergence of single-molecule tools, including optical tweezers or zero-mode waveguides16,17,18,19,20,21,22,23,24,25,26.
Optical tweezers (OT) represent a highly precise single-molecule technique, which has been applied to study many sorts of RNA-dependent dynamic processes including transcription, and translation26,27,28,29,30,31,32. The use of optical tweezers has allowed probing of molecular interactions, nucleic acid structures, and thermodynamic properties, kinetics, and energetics of these processes in detail16,17,22,33,34,35,36,37,38,39. Optical tweezers assay is based on the entrapment of microscopic objects with a focused laser beam. In a typical OT experiment, the molecule of interest is tethered between two transparent (usually polystyrene) beads (Figure 1A)27. These beads are then caught by optical traps, which behave like springs. Thus, the force applied on the molecule can be calculated based on the bead&#39;s displacement from the center of the focused laser beam (trap center). Recently, optical tweezers have been combined with confocal microscopy (Figure 1B), enabling fluorescence or F&#246;rster resonance energy transfer (FRET) measurements40,41,42. This opens a whole new field of possible experiments allowing simultaneous measurement and, therefore, precise correlation of force spectroscopy and fluorescence data.
Here, we demonstrate experiments using the optical tweezers combined with confocal microscopy to study protein-RNA interactions regulating translational frameshifting. Between the objective and the condenser, a flow cell with five channels enables continuous sample application with laminar flow. Through the microfluidic channels, various components can be injected directly, which decreases the hands-on time as well as allowing very little sample consumption throughout the experiment.
First, a basic guideline to assist the design of OT experiments is proposed and advantages as well as pitfalls of various setups are discussed. Next, the preparation of samples and experimental workflows are described, and a protocol for the data analysis is provided. To represent an example, we outline the results obtained from RNA stretching experiments to study the SARS-CoV-2 frameshifting RNA element (Figure 2A) with the trans-acting factor the short isoform of zinc-finger antiviral protein (ZAP), which alters the translation of the viral RNA from an alternative reading frame43. Additionally, it is demonstrated that fluorescence-labeled ribosomes can be employed in this OT confocal assay, which would be useful to monitor the processivity and speed of the translation machinery. The method presented here can be used to rapidly test the effect of different buffers, ligands, or other cellular components to study various aspects of translation. Finally, common experimental pitfalls and how to troubleshoot them are discussed. Below, some crucial points in experimental design are outlined.
Construct design 
In principle, there are two common approaches to create an OT-compatible RNA construct. The first approach employs a long RNA molecule that is hybridized with complementary DNA handles, thus yielding a construct consisting of two RNA/DNA hybrid regions flanking a single-stranded RNA sequence in the middle (Figure 2B). This approach is employed in most OT RNA experiments33,44,45.
The second approach takes advantage of dsDNA handles with short (around 20 nt) overhangs15,17. These overhangs are then hybridized with the RNA molecule. Although more complicated in design, the use of dsDNA handles overcomes some of limitations of the DNA/RNA-hybrid system. In principle, even very long handles (&#62;10kb) can be implemented, which is more convenient for confocal measurements. In addition, the RNA molecule can be ligated to DNA handles to increase tether stability.
End-labeling strategy 
The construct must be tethered to beads via a strong molecular interaction. While there are approaches available for covalent bonding of handles to beads46, strong but non-covalent interactions such as streptavidin-biotin and digoxigenin-antibody are commonly used in OT experiments15,33,35,45. In the described protocol, the construct is labeled with biotin or digoxigenin, and the beads are coated with streptavidin or antibodies against digoxigenin, respectively (Figure 1A). This approach would be suitable for applying forces up to approximately 60 pN (per tether)47. Furthermore, the use of different 5&#39; and 3&#39; labeling strategies allow determining the orientation of the tether formed between the beads17.
Protein labeling for fluorescence measurements 
For the confocal imaging, there are several commonly used approaches for fluorescence labeling. For instance, fluorophores can be covalently attached to amino acid residues that are found natively in proteins or introduced by site-directed mutagenesis through a reactive organic group. Thiol or amine-reactive dyes can be used for labeling of cysteine and lysine residues, respectively. There are several reversible protection methods to increase the specificity of labeling48,49, however native proteins would typically be labeled at multiple residues. Although the small size of the fluorophore may confer an advantage, non-specific labeling might interfere with the protein activity and thus signal intensity may vary49. Also, depending on the labeling efficiency signal intensity may differ between different experiments. Therefore, an activity check should be performed prior to the experiment.
In case the protein of interest contains an N- or C-terminal tag, such as a His-tag or strep-tag, specific labeling of these tags represents another popular approach. Moreover, tag-targeted labeling reduces the chance of the fluorophore interfering with protein activity and can enhance solubility49. However, tag-specific labeling usually yields mono-fluorophore labeled proteins, which might be challenging to detect. Another way of specific labeling can be accomplished by employing antibodies.
Microfluidics setup 
The combination of OT with a microfluidics system allows a rapid transition between different experimental conditions. Moreover, current systems take advantage of maintaining the laminar flow inside the flow cell, which precludes the mixing of liquids from other channels in the perpendicular direction relative to the flow direction. Therefore, laminar flow is particularly advantageous for the experimental design. Currently, flow cells with up to 5 channels are commonly employed (Figure 3).

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Bacterial Strains</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli HB101</td>
			<td>lab collection</td>
			<td>N/A</td>
			<td>cloning of the vectors</td>
		</tr>
		<tr>
			<td>Chemicals and enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Sigma-Aldrich</td>
			<td>31424</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Biotin-16-dUTP</td>
			<td>Roche</td>
			<td>11093070910</td>
			<td>Biotinylation</td>
		</tr>
		<tr>
			<td>BSA</td>
			<td>Sigma-Aldrich</td>
			<td>A4737</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Catalase</td>
			<td>Lumicks</td>
			<td>N/A</td>
			<td>Oxygen scavanger system</td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT)</td>
			<td>Melford Labs</td>
			<td>D11000</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>DNAse I from bovine pancreas</td>
			<td>Sigma-Aldrich</td>
			<td>D4527</td>
			<td>in vitro transcription</td>
		</tr>
		<tr>
			<td>dNTPs</td>
			<td>Th.Geyer</td>
			<td>11786181</td>
			<td>PCR</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Sigma-Aldrich</td>
			<td>E9884</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Sigma-Aldrich</td>
			<td>11814320001</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>Sigma-Aldrich</td>
			<td>G8270-1KG</td>
			<td>Oxygen scavanger system</td>
		</tr>
		<tr>
			<td>Glucose-oxidase</td>
			<td>Lumicks</td>
			<td>N/A</td>
			<td>Oxygen scavanger system</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Carl Roth</td>
			<td>HN78.3</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Magnesium chloride</td>
			<td>Carl Roth</td>
			<td>2189.1</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Phusion DNA polymerase</td>
			<td>NEB</td>
			<td>M0530L</td>
			<td>Gibson assembly, cloning</td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Merck</td>
			<td>529552-1KG</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>PrimeSTAR GXL DNA Polymerase</td>
			<td>Takara Bio Clontech</td>
			<td>R050A</td>
			<td>PCR</td>
		</tr>
		<tr>
			<td>Pyrophosphotase, thermostabile, inorganic</td>
			<td>NEB</td>
			<td>M0296L</td>
			<td>in vitro transcription</td>
		</tr>
		<tr>
			<td>RNase Inhibitor</td>
			<td>Molox</td>
			<td>1000379515</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>rNTPS</td>
			<td>life technologies</td>
			<td>R0481</td>
			<td>in vitro transcription</td>
		</tr>
		<tr>
			<td>Sodium thiosulophate</td>
			<td>Sigma-Aldrich</td>
			<td>S6672-500G</td>
			<td>Bleach deactivation</td>
		</tr>
		<tr>
			<td>Sytox Green</td>
			<td>Lumicks</td>
			<td>N/A</td>
			<td>confocal measurements</td>
		</tr>
		<tr>
			<td>T4 DNA Polymerase</td>
			<td>NEB</td>
			<td>M0203S</td>
			<td>Biotinylation</td>
		</tr>
		<tr>
			<td>T5 exonuclease</td>
			<td>NEB</td>
			<td>M0363S</td>
			<td>Gibson assembly, cloning</td>
		</tr>
		<tr>
			<td>T7 RNA polymerase</td>
			<td>Produced in-house</td>
			<td>N/A</td>
			<td>in vitro transcription</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>NEB</td>
			<td>M0267S</td>
			<td>PCR</td>
		</tr>
		<tr>
			<td>Taq ligase</td>
			<td>Biozym</td>
			<td>L6060L</td>
			<td>Gibson assembly, cloning</td>
		</tr>
		<tr>
			<td>TWEEN 20 BioXtra</td>
			<td>Sigma-Aldrich</td>
			<td>P7949</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Kits</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Monolith Protein Labeling Kit RED-NHS 2nd Generation (Amine Reactive)</td>
			<td>Nanotemper</td>
			<td>MO-L011</td>
			<td>Used for ribosome labeling</td>
		</tr>
		<tr>
			<td>Purefrex 2.0</td>
			<td>GeneFrontier</td>
			<td>PF201-0.25-EX</td>
			<td>Ribosomes used for the labeling</td>
		</tr>
		<tr>
			<td>Oligonucleotides</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>5&#39; handle T7 forward</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#8217; - CTTAATACGACTCACTATAGGTC 
			CTTTCTGTGGACGCC - 3&#8217;, used to generate OT in vitro transcription template in PCR 1</td>
		</tr>
		<tr>
			<td>3&#8217; handle reverse</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#39; -&#160; GTCAAAGTGCGCCCCGTTATCC - 3&#39;, used to generate OT in vitro transcription template in PCR 1</td>
		</tr>
		<tr>
			<td>5&#39; handle forward</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#39; - TCCTTTCTGTGGACGCCGC - 3&#39; , used to generate 5&#39; handle in PCR 2</td>
		</tr>
		<tr>
			<td>5&#8217; handle reverse</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#8217; - CATAAATACCTCTTTACTAATATA 
			TATACCTTCGTAAGCTAGCGT - 3&#8217;, used to generate 5&#39; handle in PCR 2</td>
		</tr>
		<tr>
			<td>3&#8217; handle forward</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#39; - ATCCTGCAACCTGCTCTTCGCC 
			AG - 3&#39;, used to generate 3&#39; handle in PCR 3</td>
		</tr>
		<tr>
			<td>3&#8217; handle reverse 5&#8217;labeled with digoxigenin</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#39; -[Dig]-GTCAAAGTGCGCCCCGTTATCC - 3&#39;, used to generate 3&#39; handle in PCR 3</td>
		</tr>
		<tr>
			<td>DNA vectors</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pMZ_OT</td>
			<td>produced in-house</td>
			<td>N/A</td>
			<td>further description in &#34;Structural studies of Cardiovirus 2A protein reveal the molecular basis for RNA recognition and translational control&#34; 
			Chris H. Hill, Sawsan Napthine, Lukas Pekarek, Anuja Kibe, Andrew E. Firth, Stephen C. Graham, Neva Caliskan, Ian Brierley 
			bioRxiv 2020.08.11.245035; doi: https://doi.org/10.1101/2020.08.11.245035</td>
		</tr>
		<tr>
			<td>Software and Algorithms</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Atom</td>
			<td>https://atom.io/packages/ide-python</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Bluelake</td>
			<td>Lumicks</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Graphpad</td>
			<td>https://www.graphpad.com/</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>InkScape 0.92.3</td>
			<td>https://inkscape.org/</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Matlab</td>
			<td>https://www.mathworks.com/products/matlab.html</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>POTATO</td>
			<td>https://github.com/lpekarek/POTATO.git</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAstructure</td>
			<td>https://rna.urmc.rochester.edu/RNAstructure.html</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Spyder</td>
			<td>https://www.spyder-ide.org/</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Other</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin Coated Polystyrene Particles, 1.5-1.9 &#181;m, 5 ml, 1.0% w/v</td>
			<td>Spherotech</td>
			<td>SVP-15-5</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-digoxigenin Coated Polystyrene Particles, 2.0-2.4 &#181;m, 2 ml, 0.1% w/v</td>
			<td>Spherotech</td>
			<td>DIGP-20-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Syringes</td>
			<td>VWR</td>
			<td>TERUMO SS+03L1</td>
			<td></td>
		</tr>
		<tr>
			<td>Devices</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>C-trap</td>
			<td>Lumicks</td>
			<td>N/A</td>
			<td>&#160;optical tweezers coupled with confocal microscopy</td>
		</tr>
	</tbody>
</table>

optical tweezers to study rna-protein interactions in translation regulation

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously.&#160;This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.

In this section, focus is mainly given on measurements of RNA-protein/ligand interactions by the fluorescence optical tweezers. For a description of general RNA optical tweezers experiments and corresponding representative results, see32. For more detailed discussion of the RNA/DNA-protein interactions, also see1,2,26,59,60.
<p clas...

Watch this Scientific Journal Video about Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation at JoVE.com

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the ...

The overall goal of the following method article is to demonstrate a protocol useful to study RNA interactions with proteins or other factors using optical tweezers coupled with confocal microscopy. Over the past decade, several sophisticated techniques have been developed to investigate the properties of single macromolecules. One of these techniques is single molecule optical tweezers.With the new fluorescence assisted optical tweezers, not only forces required for unfolding of RNA molecules, as well as binding events during translation can be monitored in detail. Here we focus on measurements in which RNA molecules are stretched with and without transacting factors that regulate translation. We also illustrate how the technique can be applied to monitor translation using labeled ribosomes.The protocol will be demonstrated by two graduate students in my group, Lukas Pekarek and Stefan Park. In this video, we are going to guide you through the setup and execution of an optical tweezers experiment. We also outline the simple data analysis workflow.The advantage of this technique is that it is straightforward and robust. A molecule is tethered between two beads, strapped in the focus of laser beams, and change and force upon displacement can be precisely measured in so-called force-ramp experiments. Secondary structures inside a tether unfold at a certain force depending on the internal energy of the molecule.This dynamic transition between multiple structures can be further investigated with constant force measurements. Furthermore, the parallel use of fluorescent imaging can be used to visualize binding events in real time. A distinct force-distance profile of a tether might vary after binding of potential transacting factors that influence its stability.First, the RNA of interest has to be cloned into a DNA vector. Upstream and downstream of this sequence, additional parts, the handles are needed to tether the final DNA-RNA construct between the beads. After successful cloning and amplification of the plasmid, three different PCR reactions are performed.For each PCR reaction, mix the reagents according to table one in the protocol. Run the PCR in 50 microliter aliquots in an appropriate thermal cycler. The first one results in a double stranded DNA of the whole construct with the T7 promoter for subsequent in-vitro transcription.The second PCR produces the five prime handles. Whereas the last reaction results in the three prime handles. Both 5 prime and 3 prime handles need to be labeled according to the used beads.The three prime handles are labeled during the PCR by using a digoxigenin labeled reverse primer, and the five prime handles have to be labeled in an extra step through biotinylation. The three prime biotinylation of the five prime handles is performed using T 40 and a polymerase. The reaction is performed for one to two hours at room temperature.Next, carry out the in-vitro transcription using T7 polymerase. Incubate the reaction at 37 degree for two to four hours, depending on the length of the RNA. In one last step, the handles are annealed with the RNA from the in-vitro transcription to obtain the final DNA-RNA construct with the single stranded region of interest between the double stranded handles.To anneal the desired RNA-DNA hybrid, mix the handles and the RNA in annealing buffer. Heat, the annealing mixture up to 85 degree for 10 minutes, and then slowly cool down the sample to four degree. Mix the annealed sample with 1/10th of volume of three molar sodium acetate, and three volumes of ice cold ethanol and incubate minus 80 degree for at least an hour.Centrifuge the samples at 15, 000 xg for 30 minute at four degree. Discard the supernatant and dry the pellet under vacuum. Small aliquots of the resuspended pellet are frozen in liquid nitrogen and kept at minus 80 degree until they are used.First remove the bleach out of the syringes and fill in one mL of RNase free water. Add 50 microliter of 0.5 molar sodium thiosulfate and wash the system with one bar. Be careful that the microfluidic system never runs dry to avoid air bubbles in the system.Next, discard the remaining sodium thiosulfate solution and replace the syringes with new ones. Then wash again with at least 0.5 mL of RNase free water. To set up the optical system of the machine, put two drops of immersion oil onto the objective.Put the flow cell in place and rise the objective until the liquid touches the flow cell. Then put two drops of immersion oil on top of the flow cell. Now turn on the trap steering unit and the trapping laser.The objective is adjusted using the Z finder tool of the diagnostic cameras of the machine. By turning the micro screw, the Z axis is adjusted to the middle of the chamber between the second and the third reflection. Where the refraction rings are the biggest.Switch the diagnostic cameras to moon mode and reduce the trapping laser to around 50%Then lower the condenser and adjust its position so you see approximately 10 light bands. The measuring chamber has five channels, and before the experiment, different setup possibilities should be considered. For a simple force-ramp experiment, beads-buffer-beads is a convenient channel arrangement.For measurements with the fourth compound, like fluorescent ribosomes or transacting factors, beads-beads-buffer factor is a better arrangement, but it makes it harder to catch beads. An aliquot of the annealed construct is incubated with three microliter AD bead suspension, one microliter RNase inhibitors, and eight microliter of the assay buffer at room temperature for 10 to 20 minutes. Then the sample is diluted in 500 microliter assay buffer and put into the respective channel.For the second kind of beads, 0.8 microliter of assay beads are mixed with one mL of assay buffer and administered into the corresponding channel. The channels are opened and washed with low pressure. Now turn on the trapping laser.To catch beads, the lasers are moved apart from each other and an AD bead is caught in trap one. Next the stage is moved to the SA bead channel and a bead is caught in trap two. To avoid losing the beads, or to catch a second one in the same trap, the stage is moved to the buffer channel and all channels are closed.In the buffer, a trap calibration is performed. The caught beads should be set as visual templates for subsequent measurements. And the similarity score should be kept above 90%between measurements to guarantee comparability.Finally, the beads are moved closer together and one can start to catch a single tether. This is done moving the beads close for a few seconds and then slowly depart the beads again. A tether formation results in an increase of measured force upon pulling the two beads away from each other.The number and quality of tethers can be checked by finding the overstretching plateau and compare the trajectory with the freely jointed chain or worm-like chain model. The overstretching plateau should be between 50 to 60 piconewton for a single tether. To perform the fluorescence measurements, turn on the confocal lasers and photon count on unit and optical tweezers machine.Afterwards, turn on the excitation laser of desired wavelength and the software interface and set the power of the laser to 5%or higher, depending on the fluorophore. Now imaging can be started by using the image or kymograph functions of the software. In order to get well focused images, make sure that focal plane of the confocal microscope and the optical traps are aligned.For this purpose, autofluorescence of the polystyrene beads in the blue laser channel can be employed. Move up and down with the focal plane of the optical traps until the autofluorescence of the beads reaches its highest diameter. At this position, the fluorescence signals taking place at the tethered molecule can be detected.For both functions it is important to select the appropriate regions of interest. Throughout the measurement buffer composition can be easily changed by either moving the beads to different channels, or by changing the buffer supplied in the microfluidic system. To avoid photobleaching, always turn off the excitation laser when not measuring.The raw data output from the device often contains a lot of noise. Therefore, in order to further analyze scattered data, one has first to pre-process them. The first step is to down sample and filter the data with the low pass Butterworth filter, good results were obtained.For force-ramp experiments, the unfolding events have to be marked at the corresponding folded and unfolded regions of the first distance curve can be fitted using worm-like chain or freely jointed chain models. For the constant force data, the distance over time can be plotted and it is useful to generate a histogram to quantify the predominant conformation at a given force. Here it is shown that the filter parameters are crucial to distinguish different folding states.For better understanding what can be achieved with this technique, some representative results are shown. This is how a standard force-distance curve from a force-ramp experiment looks like. In this case, we studied the SARS-coronavirus-2 frame shifting element.We observed unfolding in multiple steps around 15 piconewton. When the direction is reversed and the beads are getting closer again, the tether refolds back at slightly lower force. When we measured the same RNA in presence of the zinc finger antiviral protein ZAP, a similar pattern of unfolding was observed.But the secondary structure of the RNA did not refold. This is a good example to show what big influence protein binding can have on RNA kinetics. Looking at constant force data the unfolding kinetics can be further investigated.The distance over time is plotted for different forces and the histogram of the different observed states is added on the right. At 10 piconewton, the RNA is completely in the folded state. At 11.5 piconewton it switches between states, and at 13 piconewton the RNA is permanently in an unfolded state.However, when the SARS-coronavirus-2 frame shifting element was measured together with ZAP, the RNA was completely in an unfolded state at 11 piconewton, and even showed very little transition towards a folded state at 10 piconewton. This indicates that ZAP binds to the single stranded frame shifting element and prevents the formation of a secondary structure. Finally, we will look at some optical tweezers data coupled with confocal microscopy.In this experiment, a fluorescent dye was used that labels double stranded nucleic acids, non specifically with increasing force. The kymograph shows that as the beads are moved apart from each other, the fluorescence intensity increases and it completely disappears once the tether is stretched too much and breaks. In the last figure fluorescently labeled ribosomes were added through channel four.In this experiment specific ribosome binding to the RNA tether was observed. We hope this video gave you an insight into optical tweezers and what can be performed this incredible technique.

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

Abstract