JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Biochemistry

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

Published: February 12th, 2022

DOI:

10.3791/62589

1Helmholtz Institute for RNA-based Infection Research (HIRI), Helmholtz Zentrum für Infektionsforschung (Helmholtz Centre for Infection Research), 2Medical Faculty, Julius-Maximilians University Würzburg

This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously. This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.

Transfer of genetic information from DNA to proteins through mRNAs is a complex biochemical process, which is precisely regulated on all levels through macromolecular interactions inside cells. For translational regulation, RNA-protein interactions confer a critical role to rapidly react to various stimuli and signals1,2. Some RNA-protein interactions affect mRNA stability and thereby alter the time an RNA is translationally active. Other RNA-protein interactions are associated with recoding mechanisms such as stop-codon readthrough, bypassing, or programmed ribosomal frameshifting (PRF)3

Log in or to access full content. Learn more about your institution’s access to JoVE content here

1. Sample preparation

  1. Clone the sequence of interest into the vector containing the Lambda DNA fragments, which serve as the handle sequences (Figure 2)43,50.
  2. First generate a DNA template for subsequent in vitro transcription via PCR (Figure 2B; reaction 1). At this PCR step, the T7 promoter is added in the 5' end of the sense DNA molecule

    Log in or to access full content. Learn more about your institution’s access to JoVE content here

In this section, focus is mainly given on measurements of RNA-protein/ligand interactions by the fluorescence optical tweezers. For a description of general RNA optical tweezers experiments and corresponding representative results, see32. For more detailed discussion of the RNA/DNA-protein interactions, also see1,2,26,59,60.

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Here, we demonstrate the use of fluorescence-coupled optical tweezers to study interactions and dynamic behavior of RNA molecules with various ligands. Below, critical steps and limitations of the present technique are discussed.

Critical steps in the protocol
As for many other methods, the quality of the sample is pivotal to obtain reliable data. Therefore, to obtain the highest possible quality samples, it is worth it to spend time to optimize the procedure for sample .......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

We thank Anuja Kibe and Jun. Prof. Redmond Smyth for critically reviewing the manuscript. We thank Tatyana Koch for expert technical assistance. We thank Kristyna Pekarkova for the help with recording experimental videos. The work in our laboratory is supported by the Helmholtz Association and funding from the European Research Council (ERC) Grant Nr. 948636 (to NC).

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
Bacterial Strains
E. coli HB101 lab collection N/A cloning of the vectors
Chemicals and enzymes
Sodium chloride Sigma-Aldrich 31424 Buffers
Biotin-16-dUTP Roche 11093070910 Biotinylation
BSA Sigma-Aldrich A4737 Buffers
Catalase Lumicks N/A Oxygen scavanger system
Dithiothreitol (DTT) Melford Labs D11000 Buffers
DNAse I from bovine pancreas Sigma-Aldrich D4527 in vitro transcription
dNTPs Th.Geyer 11786181 PCR
EDTA Sigma-Aldrich E9884 Buffers
Formamide Sigma-Aldrich 11814320001 Buffers
Glucose Sigma-Aldrich G8270-1KG Oxygen scavanger system
Glucose-oxidase Lumicks N/A Oxygen scavanger system
HEPES Carl Roth HN78.3 Buffers
Magnesium chloride Carl Roth 2189.1 Buffers
Phusion DNA polymerase NEB M0530L Gibson assembly, cloning
Potassium chloride Merck 529552-1KG Buffers
PrimeSTAR GXL DNA Polymerase Takara Bio Clontech R050A PCR
Pyrophosphotase, thermostabile, inorganic NEB M0296L in vitro transcription
RNase Inhibitor Molox 1000379515 Buffers
rNTPS life technologies R0481 in vitro transcription
Sodium thiosulophate Sigma-Aldrich S6672-500G Bleach deactivation
Sytox Green Lumicks N/A confocal measurements
T4 DNA Polymerase NEB M0203S Biotinylation
T5 exonuclease NEB M0363S Gibson assembly, cloning
T7 RNA polymerase Produced in-house N/A in vitro transcription
Taq DNA polymerase NEB M0267S PCR
Taq ligase Biozym L6060L Gibson assembly, cloning
TWEEN 20 BioXtra Sigma-Aldrich P7949 Buffers
Kits
Monolith Protein Labeling Kit RED-NHS 2nd Generation (Amine Reactive) Nanotemper MO-L011 Used for ribosome labeling
Purefrex 2.0 GeneFrontier PF201-0.25-EX Ribosomes used for the labeling
Oligonucleotides
5' handle T7 forward Microsynth custom order 5’ - CTTAATACGACTCACTATAGGTC
CTTTCTGTGGACGCC - 3’, used to generate OT in vitro transcription template in PCR 1
3’ handle reverse Microsynth custom order 5' -  GTCAAAGTGCGCCCCGTTATCC - 3', used to generate OT in vitro transcription template in PCR 1
5' handle forward Microsynth custom order 5' - TCCTTTCTGTGGACGCCGC - 3' , used to generate 5' handle in PCR 2
5’ handle reverse Microsynth custom order 5’ - CATAAATACCTCTTTACTAATATA
TATACCTTCGTAAGCTAGCGT - 3’, used to generate 5' handle in PCR 2
3’ handle forward Microsynth custom order 5' - ATCCTGCAACCTGCTCTTCGCC
AG - 3', used to generate 3' handle in PCR 3
3’ handle reverse 5’labeled with digoxigenin Microsynth custom order 5' -[Dig]-GTCAAAGTGCGCCCCGTTATCC - 3', used to generate 3' handle in PCR 3
DNA vectors
pMZ_OT produced in-house N/A further description in "Structural studies of Cardiovirus 2A protein reveal the molecular basis for RNA recognition and translational control"
Chris H. Hill, Sawsan Napthine, Lukas Pekarek, Anuja Kibe, Andrew E. Firth, Stephen C. Graham, Neva Caliskan, Ian Brierley
bioRxiv 2020.08.11.245035; doi: https://doi.org/10.1101/2020.08.11.245035
Software and Algorithms
Atom https://atom.io/packages/ide-python N/A
Bluelake Lumicks N/A
Graphpad https://www.graphpad.com/ N/A
InkScape 0.92.3 https://inkscape.org/ N/A
Matlab https://www.mathworks.com/products/matlab.html N/A
POTATO https://github.com/lpekarek/POTATO.git N/A
RNAstructure https://rna.urmc.rochester.edu/RNAstructure.html N/A
Spyder https://www.spyder-ide.org/ N/A
Other
Streptavidin Coated Polystyrene Particles, 1.5-1.9 µm, 5 ml, 1.0% w/v Spherotech SVP-15-5
Anti-digoxigenin Coated Polystyrene Particles, 2.0-2.4 µm, 2 ml, 0.1% w/v Spherotech DIGP-20-2
Syringes VWR TERUMO SS+03L1
Devices
C-trap Lumicks N/A  optical tweezers coupled with confocal microscopy

  1. Balcerak, A., Trebinska-Stryjewska, A., Konopinski, R., Wakula, M., Grzybowska, E. A. RNA-protein interactions: disorder, moonlighting and junk contribute to eukaryotic complexity. Open Biology. 9 (6), 190096 (2019).
  2. Armaos, A., Zacco, E., Sanchez de Groot, N., Tartaglia, G. G. RNA-protein interactions: Central players in coordination of regulatory networks. BioEssays. 43 (2), 2000118 (2021).
  3. Firth, A. E., Brierley, I. Non-canonical translation in RNA viruses. Journal of General Virology. 93, 1385-1409 (2012).
  4. Caliskan, N., Peske, F., Rodnina, M. V. Changed in translation: mRNA recoding by −1 programmed ribosomal frameshifting. Trends in Biochemical Sciences. 40 (5), 265-274 (2015).
  5. Jaafar, Z. A., Kieft, J. S. Viral RNA structure-based strategies to manipulate translation. Nature Reviews Microbiology. 17 (2), 110-123 (2019).
  6. Eswarappa, S. M., et al. Programmed translational readthrough generates antiangiogenic VEGF-Ax. Cell. 157 (7), 1605-1618 (2014).
  7. Rodnina, M. V., et al. Translational recoding: canonical translation mechanisms reinterpreted. Nucleic Acids Research. 48 (3), 1056-1067 (2020).
  8. Li, Y., et al. Transactivation of programmed ribosomal frameshifting by a viral protein. Proceedings of the National Academy of Sciences. 111 (21), 2172 (2014).
  9. Napthine, S., et al. Protein-directed ribosomal frameshifting temporally regulates gene expression. Nature Communications. 8 (1), 15582 (2017).
  10. Patel, A., et al. Molecular characterization of the RNA-protein complex directing -2/-1 programmed ribosomal frameshifting during arterivirus replicase expression. Journal of Biological Chemistry. 295 (52), 17904-17921 (2020).
  11. Napthine, S., Bell, S., Hill, C. H., Brierley, I., Firth, A. E. Characterization of the stimulators of protein-directed ribosomal frameshifting in Theiler's murine encephalomyelitis virus. Nucleic Acids Research. 47 (15), 8207-8223 (2019).
  12. Marshall, R. A., Aitken, C. E., Dorywalska, M., Puglisi, J. D. Translation at the Single-Molecule Level. Annual Review of Biochemistry. 77 (1), 177-203 (2008).
  13. Rodnina, M. V. The ribosome in action: Tuning of translational efficiency and protein folding. Protein science : A publication of the Protein Society. 25 (8), 1390-1406 (2016).
  14. Rodnina, M. V., Fischer, N., Maracci, C., Stark, H. Ribosome dynamics during decoding. Philosophical Transactions of Royal Society of London B Biological Sciences. 372 (1716), (2017).
  15. Yan, S., Wen, J. D., Bustamante, C., Tinoco, I. Ribosome excursions during mRNA translocation mediate broad branching of frameshift pathways. Cell. 160 (5), 870-881 (2015).
  16. Liu, T., et al. Direct measurement of the mechanical work during translocation by the ribosome. eLife. 3, 03406 (2014).
  17. Desai, V. P., et al. Co-temporal force and fluorescence measurements reveal a ribosomal gear shift mechanism of translation regulation by structured mRNAs. Molecular Cell. 75 (5), 1007-1019 (2019).
  18. Choi, J., O'Loughlin, S., Atkins, J. F., Puglisi, J. D. The energy landscape of -1 ribosomal frameshifting. Science Advances. 6 (1), (2020).
  19. Prabhakar, A., Puglisi, E. V., Puglisi, J. D. Single-molecule fluorescence applied to translation. Cold Spring Harbor Perspectives in Biology. 11 (1), 032714 (2019).
  20. Bao, C., et al. mRNA stem-loops can pause the ribosome by hindering A-site tRNA binding. Elife. 9, 55799 (2020).
  21. Chen, J., Tsai, A., O'Leary, S. E., Petrov, A., Puglisi, J. D. Unraveling the dynamics of ribosome translocation. Current Opinion in Structural Biology. 22 (6), 804-814 (2012).
  22. Qu, X., et al. The ribosome uses two active mechanisms to unwind messenger RNA during translation. Nature. 475 (7354), 118-121 (2011).
  23. Zheng, Q., et al. Ultra-stable organic fluorophores for single-molecule research. Chemical Society Reviews. 43 (4), 1044-1056 (2014).
  24. Blanchard, S. C. Single-molecule observations of ribosome function. Current Opinion in Structural Biology. 19 (1), 103-109 (2009).
  25. Juette, M. F., et al. The bright future of single-molecule fluorescence imaging. Current Opinion in Chemical Biology. 20, 103-111 (2014).
  26. McCauley, M. J., Williams, M. C. Mechanisms of DNA binding determined in optical tweezers experiments. Biopolymers. 85 (2), 154-168 (2007).
  27. Ashkin, A., Dziedzic, J. M., Bjorkholm, J. E., Chu, S. Observation of a single-beam gradient force optical trap for dielectric particles. Optics Letters. 11 (5), 288-290 (1986).
  28. Bustamante, C., Smith, S. B., Liphardt, J., Smith, D. Single-molecule studies of DNA mechanics. Current Opinion in Structural Biology. 10 (3), 279-285 (2000).
  29. Choudhary, D., Mossa, A., Jadhav, M., Cecconi, C. Bio-molecular applications of recent developments in optical tweezers. Biomolecules. 9 (1), 23 (2019).
  30. Moffitt, J. R., Chemla, Y. R., Smith, S. B., Bustamante, C. Recent advances in optical tweezers. Annual Reviews of Biochemistry. 77, 205-228 (2008).
  31. Li, P. T. X., Vieregg, J., Tinoco, I. How RNA Unfolds and Refolds. Annual Review of Biochemistry. 77 (1), 77-100 (2008).
  32. Stephenson, W., Wan, G., Tenenbaum, S. A., Li, P. T. Nanomanipulation of single RNA molecules by optical tweezers. Journal of Visualized Experiments. (90), e51542 (2014).
  33. Halma, M. T. J., Ritchie, D. B., Cappellano, T. R., Neupane, K., Woodside, M. T. Complex dynamics under tension in a high-efficiency frameshift stimulatory structure. Proceedings of the National Academy of Sciences. 116 (39), 19500 (2019).
  34. Hansen, T. M., Reihani, S. N. S., Oddershede, L. B., Sørensen, M. A. Correlation between mechanical strength of messenger RNA pseudoknots and ribosomal frameshifting. Proceedings of the National Academy of Sciences of the United States of America. 104 (14), 5830-5835 (2007).
  35. Zhong, Z., et al. Mechanical unfolding kinetics of the SRV-1 gag-pro mRNA pseudoknot: possible implications for -1 ribosomal frameshifting stimulation. Science Reports. 6, 39549 (2016).
  36. McCauley, M. J., Rouzina, I., Li, J., Núñez, M. E., Williams, M. C. Significant differences in RNA structure destabilization by HIV-1 GagDp6 and NCp7 proteins. Viruses. 12 (5), 484 (2020).
  37. de Messieres, M., et al. Single-molecule measurements of the CCR5 mRNA unfolding pathways. Biophysics Journal. 106 (1), 244-252 (2014).
  38. Yang, L., et al. Single-molecule mechanical folding and unfolding of RNA hairpins: Effects of single A-U to A·C pair substitutions and single proton binding and implications for mRNA structure-induced -1 ribosomal frameshifting. Journal of American Chemical Society. 140 (26), 8172-8184 (2018).
  39. McCauley, M. J., et al. Targeted binding of nucleocapsid protein transforms the folding landscape of HIV-1 TAR RNA. Proceedings of the National Academy of Sciences of the United States of America. 112 (44), 13555-13560 (2015).
  40. Whitley, K. D., Comstock, M. J., Chemla, Y. R. High-resolution "Fleezers": Dual-trap optical tweezers combined with single-molecule fluorescence detection. Methods in Molecular Biology. 1486, 183-256 (2017).
  41. Yerramilli, V. S., Kim, K. H. Labeling RNAs in live cells using malachite green aptamer scaffolds as fluorescent probes. ACS Synthetic Biology. 7 (3), 758-766 (2018).
  42. Gross, P., Farge, G., Peterman, E. J., Wuite, G. J. Combining optical tweezers, single-molecule fluorescence microscopy, and microfluidics for studies of DNA-protein interactions. Methods in Enzymology. 475, 427-453 (2010).
  43. Zimmer, M. M., et al. The short isoform of the host antiviral protein ZAP acts as an inhibitor of SARS-CoV-2 programmed ribosomal frameshifting. Nature Communications. 12 (1), 7193 (2021).
  44. Neupane, K., Yu, H., Foster, D. A. N., Wang, F., Woodside, M. T. Single-molecule force spectroscopy of the add adenine riboswitch relates folding to regulatory mechanism. Nucleic acids research. 39 (17), 7677-7687 (2011).
  45. Ritchie, D. B., Soong, J., Sikkema, W. K., Woodside, M. T. Anti-frameshifting ligand reduces the conformational plasticity of the SARS virus pseudoknot. Journal of the American Chemical Society. 136 (6), 2196-2199 (2014).
  46. Janissen, R., et al. Invincible DNA tethers: covalent DNA anchoring for enhanced temporal and force stability in magnetic tweezers experiments. Nucleic Acids Research. 42 (18), 137 (2014).
  47. Smith, S. B., Cui, Y., Bustamante, C. Overstretching B-DNA: The elastic response of individual double-stranded and single-stranded DNA molecules. Science. 271 (5250), 795 (1996).
  48. Puljung, M. C., Zagotta, W. N. Labeling of specific cysteines in proteins using reversible metal protection. Biophysical Journal. 100 (10), 2513-2521 (2011).
  49. Toseland, C. P. Fluorescent labeling and modification of proteins. Journal of Chemical Biology. 6 (3), 85-95 (2013).
  50. Hill, C. H., et al. Structural and molecular basis for Cardiovirus 2A protein as a viral gene expression switch. Nature Communications. 12 (1), 7166 (2021).
  51. Butterworth, S. On the theory of filter amplifiers. Experimental Wireless and the Wireless Engineer. 7, 536-541 (1930).
  52. Wang, M. D., Yin, H., Landick, R., Gelles, J., Block, S. M. Stretching DNA with optical tweezers. Biophysics Journal. 72 (3), 1335-1346 (1997).
  53. Mukhortava, A., et al. Structural heterogeneity of attC integron recombination sites revealed by optical tweezers. Nucleic Acids Research. 47 (4), 1861-1870 (2019).
  54. Buck, S., Pekarek, L., Caliskan, N. POTATO: An automated pipeline for batch analysis of optical tweezers data. bioRxiv. , (2021).
  55. Zhang, Y., Jiao, J., Rebane, A. A. Hidden Markov modeling with detailed balance and its application to single protein folding. Biophysical Journal. 111 (10), 2110-2124 (2016).
  56. Sgouralis, I., Pressé, S. An introduction to infinite HMMs for single-molecule data analysis. Biophysics Journal. 112 (10), 2021-2029 (2017).
  57. Müllner, F. E., Syed, S., Selvin, P. R., Sigworth, F. J. Improved hidden Markov models for molecular motors, part 1: basic theory. Biophysical Journal. 99 (11), 3684-3695 (2010).
  58. Elms, P. J., Chodera, J. D., Bustamante, C. J., Marqusee, S. Limitations of constant-force-feedback experiments. Biophysical Journal. 103 (7), 1490-1499 (2012).
  59. Re, A., Joshi, T., Kulberkyte, E., Morris, Q., Workman, C. T. RNA-protein interactions: an overview. Methods Molecular Biology. 1097, 491-521 (2014).
  60. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nature reviews. Molecular Cell Biology. 16 (9), 533-544 (2015).
  61. Lim, F., Peabody, D. S. RNA recognition site of PP7 coat protein. Nucleic Acids Research. 30 (19), 4138-4144 (2002).
  62. Sunbul, M., Jäschke, A. SRB-2: a promiscuous rainbow aptamer for live-cell RNA imaging. Nucleic Acids Research. 46 (18), 110 (2018).
  63. Sanchez de Groot, N., et al. RNA structure drives interaction with proteins. Nature Communications. 10 (1), 3246 (2019).
  64. Zeffman, A., Hassard, S., Varani, G., Lever, A. The major HIV-1 packaging signal is an extended bulged stem loop whose structure is altered on interaction with the Gag polyprotein. Journal of Molecular Biology. 297 (4), 877-893 (2000).
  65. Mangeol, P., et al. Probing ribosomal protein-RNA interactions with an external force. Proceedings of the National Academy of Sciences. 108 (45), 18272 (2011).
  66. Luo, X., et al. Molecular mechanism of RNA recognition by Zinc-Finger antiviral protein. Cell Reports. 30 (1), 46-52 (2020).
  67. Qu, X., Lancaster, L., Noller, H. F., Bustamante, C., Tinoco, I. Ribosomal protein S1 unwinds double-stranded RNA in multiple steps. Proceedings of the National Academy of Science U. S. A. 109 (36), 14458-14463 (2012).
  68. Chandra, V., Hannan, Z., Xu, H., Mandal, M. Single-molecule analysis reveals multi-state folding of a guanine riboswitch. Nature Chemical Biology. 13 (2), 194-201 (2017).
  69. Savinov, A., Perez, C. F., Block, S. M. Single-molecule studies of riboswitch folding. Biochimica et Biophysica Acta. 1839 (10), 1030-1045 (2014).
  70. Kelly, J. A., et al. Structural and functional conservation of the programmed ribosomal frameshift signal of SARS coronavirus 2 (SARS-CoV-2). Journal of Biological Chemistry. 295 (31), 10741-10748 (2020).
  71. Neupane, K., et al. Structural dynamics of single SARS-CoV-2 pseudoknot molecules reveal topologically distinct conformers. Nature Communications. 12 (1), 4749 (2021).
  72. Schindelin, J., et al. Fiji: an open-source platform for biological-image analysis. Nature Methods. 9 (7), 676-682 (2012).
  73. Zheng, Q., Jockusch, S., Zhou, Z., Blanchard, S. C. The contribution of reactive oxygen species to the photobleaching of organic fluorophores. Photochemistry and Photobiology. 90 (2), 448-454 (2014).
  74. Deerinck, T. J. The application of fluorescent quantum dots to confocal, multiphoton, and electron microscopic imaging. Toxicologic Pathology. 36 (1), 112-116 (2008).
  75. Rill, N., Mukhortava, A., Lorenz, S., Tessmer, I. Alkyltransferase-like protein clusters scan DNA rapidly over long distances and recruit NER to alkyl-DNA lesions. Proceedings of the National Academy of Science U. S. A. 117 (17), 9318-9328 (2020).
  76. Swoboda, M., et al. Enzymatic oxygen scavenging for photostability without pH drop in single-molecule experiments. ACS Nano. 6 (7), 6364-6369 (2012).
  77. Aitken, C. E., Marshall, R. A., Puglisi, J. D. An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments. Biophysical Journal. 94 (5), 1826-1835 (2008).
  78. Wen, J. -. D., et al. Force unfolding kinetics of RNA using optical tweezers. I. Effects of experimental variables on measured results. Biophysical journal. 92 (9), 2996-3009 (2007).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved