Visualization of Neutrophil Extracellular Traps in Mesenteric Venules After Mesenteric Ischemia-Reperfusion Injury via Intravital Microscopy

Summary

This protocol presents a method for inducing mesenteric ischemia-reperfusion injury and visualizing neutrophil extracellular traps (NETs) in mesenteric venules using intravital microscopy. Blood flow in the superior mesenteric artery was restricted for 1 h, followed by reperfusion, allowing direct quantification of leukocyte adhesion and NETosis.

Abstract

Intestinal ischemia-reperfusion (I/R) injury is an acute condition characterized by tissue damage resulting from restricted blood flow to the mesenteric vessels, leading to both local and systemic pathologies with a poor prognosis. Both ischemia and reperfusion trigger a series of cellular and molecular responses, with inflammatory cells serving as key regulators of the pathology. These interactions with the ischemic endothelium are mediated by multiple adhesion receptors. Several animal models have been established to mimic this pathology and investigate the involved molecular pathways. In this study, a microsurgical model of I/R injury is combined with intravital microscopy to visualize leukocyte rolling, adhesion, and neutrophil extracellular trap (NET) formation. This model is applied to transgenic mice deficient in endothelial PAR1 (F2r) to assess the impact of PAR1 on leukocyte rolling and NET formation 1 h after ischemia and immediately following reperfusion. In vivo, Acridine Orange leukocyte staining was employed, and NETs were visualized using a nucleic acid stain. Interestingly, reduced leukocyte adhesion and NET formation were observed in mice lacking the endothelial PAR1 receptor. This model enables the in vivo analysis of key regulators involved in I/R injury.

Introduction

Acute mesenteric ischemia (AMI) is a rare pathology¹ with a high mortality risk², characterized by reduced blood flow in the mesentery due to thrombi in the celiac axis, or the superior or inferior mesenteric artery. In 60%-70% of the cases, acute occlusions of the superior mesenteric artery due to thrombosis or embolization are responsible for acute bowel ischemia³. In contrast, in 5-15% of cases, mesenteric venous thrombosis accounts for mesenteric ischemia involving the superior mesenteric vein and, more rarely, the inferior mesenteric vein⁴. The hypoxia and malnutrition arising from ischemia lead to energy metabolism disorders at the cellular level⁵. For instance, impaired mitochondrial function activates multiple signaling pathways, initiating cellular death mechanisms⁶. Although rapid reperfusion enables the restoration of aerobic metabolism, the restoration of blood flow to an ischemic region often causes extensive tissue injury due to reactive oxygen species (ROS) production⁷, calcium overload⁸, endothelial dysfunction⁹, and inflammatory responses¹⁰.

Many experimental animal models employing temporary vascular occlusion of the superior mesenteric artery have been established to elucidate the molecular mechanisms during ischemia-reperfusion (I/R) injury¹¹. The use of such models in combination with intravital microscopy (IVM) is fundamental for gaining insights into the underlying cellular interactions and disease progression¹¹. Gut barrier dysfunction is observed shortly after ischemia¹², with the epithelium losing its integrity¹³, resulting in bacterial translocation to extraintestinal sites such as the mesenteric lymph nodes, spleen, liver, and kidney^12,14. Reperfusion further aggravates the mucosal injury¹⁵. An inflammatory response in the arterioles is manifested by the rolling and firm adhesion of leukocytes on the endothelial cell layer, which is dependent on molecules such as L-selectin¹⁶, P-selectin (CD62P)¹⁷, platelet GPIIb/IIIa, and fibrinogen¹⁸. Interestingly, leukocyte adhesion to mesenteric venules is influenced by the presence of gut microbiota¹⁹ and Toll-like receptor 4 signaling¹⁰. I/R injury also triggers neutrophil extracellular trap (NET) formation¹⁰. Therapeutic targeting of the extracellular DNA, originating from activated leukocytes such as neutrophils, improves the outcome of intestinal I/R injury²⁰. In the liver, I/R injury is ignited by resident microphages²¹, and microRNA inhibition notably attenuates apoptosis²². Of note, I/R injury in the mesentery results in gut dysbiosis, which is reversible and resolved after revascularization²³.

The endothelium is also influenced by the damaging effects of I/R injury, with ROS playing a pivotal role in the process²⁴. Leukocyte adhesion to the endothelial cell layer, endothelial damage, and alterations of nitric oxide (NO) metabolism are observed⁹. However, the molecular pathways involved have not yet been fully explored.

Protease-activated receptor 1 (PAR1, F2r), is a membrane receptor expressed by a variety of cells, including endothelial cells, and is activated during inflammatory conditions²⁵. Its activation occurs when serine proteases cleave the receptor at the N-terminus, exposing the tethered ligand that, in turn, activates the receptor by binding to the second extracellular loop of the molecule²⁶. The endothelial protein C receptor (EPCR)-PAR1 signaling pathway impacts endothelial NO homeostasis and facilitates the restoration of blood flow in peripheral ischemia²⁷.

In this study, I/R injury was applied to a genetic mouse model characterized by endothelial cell-specific PAR1 deficiency to visualize leukocyte rolling, adhesion, and NET formation. The combination of a genetic mouse model and intravital microscopy after I/R microsurgery provides valuable insights by highlighting the specific cell types involved in the disease progression. Applying I/R injury to genetic mouse models is instrumental in identifying potential therapeutic targets that can be used to improve the course of the disease. Moreover, the significance of endothelial PAR1 in NETosis was shown.

Protocol

All procedures involving mice were approved by the local committee on the legislation of animals (Landesuntersuchungsamt Rheinland-Pfalz, Koblenz, Germany; G21-1-041). 6-8 week-old male and female B6.FVB-F2rtm1a(EUCOMM) Tg/Cdh5-cre)7Mlia/Tarc mice were used for the study. The endothelial cell-specific regulation of F2r (PAR1) occurs via the VE-Cadherin Cre promoter²⁸. In this study, flox-F2r x VE-Cadherin Cre⁺ (F2R^ΔEC) exhibited reduced F2r (PAR1) expression on endothelial cells, and flox-F2r x VE-Cadherin Cre^- (WT) express normal endothelial F2r (PAR1) levels. The details of the reagents and the equipment used in this study are listed in the Table of Materials.

1. Preparation for the surgery

1. Sterilize the necessary surgical instruments (extra narrow scissors straight, forceps, vascular clamp, etc.).
2. Prepare the oxygen and isoflurane-based anesthesia system with a nose cone and a heating plate.

2. Animal preparation

1. Weigh the animal.
2. Perform anesthesia: Anesthetize mice via intraperitoneal (i.p.) injection of a solution containing midazolam (5 mg/kg), medetomidine (0.5 mg/mL), and fentanyl (0.5 mg/kg) (following institutionally approved protocols).
3. Remove hair from the neck and abdomen operation area with an electric shaver for small animals.
4. Position the mouse in dorsal recumbency on the heating pad and connect it to the oxygen system via a nose cone. Secure limbs of the mouse to a heated pad with surgical tape. Ensure that the latex nose cone membrane fits firmly over the head of the mouse. Monitor the animal's body temperature rectally using a rodent-specific thermometer.
5. Apply hair removal cream to remove any remaining hair from the neck surgical area and wipe the skin of the operation area with 70% ethanol.
6. Perform a toe pinch test (pedal reflex) to ensure that the animal is fully anesthetized.

3. Surgical procedure

1. Catheter implantation in the jugular vein
   1. Make a transverse incision (~0.5 cm) over the trachea, remove the skin covering the neck, and isolate the right jugular vein.
   2. Use a silk thread of about 5 cm, close the distal end of the vein, and fix it with surgical forceps. Place three silk threads about 2 cm below the vein: one close to the distal end and two close to the proximal end of the jugular vein. Tie a surgical knot, but do not close the vessel.
   3. Prepare a polyethylene catheter (0.28 mm ID, 0.61 mm OD) filled with 0.9% NaCl and plugged with a 1 mL syringe. Use scissors to cut a hole between the second and third knots and implant the catheter into the jugular vein. Aspirate the syringe to ensure that blood is present in the catheter.
   4. Fix the catheter in the vein by tying the silk thread, ensuring it is securely fastened. Use medical tape to secure the syringe.
   5. Prepare Acridine orange: dilute 1:4 a 2 mg/mL stock solution with sterile saline (0.5 mg/mL final concentration) in a 1 mL syringe. Keep the syringe in the dark and inject 50 µL in the mouse.
   6. Prepare nucleic acid dye: dilute 1:1000 a 5 mM stock solution with sterile saline (5 µM final concentration) in a 1 mL syringe. Keep the syringe in the dark and inject 50 µL in the mouse.
   7. Inject in vivo Acridine orange (50 µg/µL, 50 µL per mouse) via the jugular vein catheter to visualize stained leukocytes and an extracellular DNA fluorescent dye similarly to stain neutrophil extracellular traps (NETs) (5 µM, 50 µL per mouse). NETs and leukocytes are imaged simultaneously.
2. Mesenteric I/R injury model
   1. Disinfect the abdominal skin with 70% ethanol.
   2. Perform a 3-5 cm laparotomy along the linea alba using surgical scissors.
   3. Using two saline-moistened cotton tips, gently remove the intestine and identify a location with minimal fat coverage. Position small intestinal branches on a black dough to reduce the background signal.
   4. Acquire the videos before I/R (pre ischemia).
   5. Make a compress moisture with NaCl and place the intestine in it. Ensure that the intestine is surrounded by the compress and maintained moisture during step 5.6.
   6. Occlude the superior mesenteric artery with a small vascular clamp.
   7. Gently push the intestine back into the abdominal cavity using saline-moistened cotton swabs, and use a 7-0 suture to close the abdominal wall to prevent loss of moisture and temperature. Maintain ischemia for 60 min, checking anesthesia at least every 20 min.
   8. After 1 h, initiate reperfusion by removing the clamp.
      NOTE: Proper execution of the ischemia procedure results in a visible change. Initially, the affected area will appear pale or white due to the lack of blood flow. Upon removal of the clamp, blood flow will gradually return to the ischemic region, which will regain its normal color, signifying successful occlusion. It is imperative to closely observe the mouse continuously throughout the ischemia stage.
   9. Following the ischemic period, apply a few drops of saline to the clipped area, then gently remove the microvascular clips using a clip applier.
   10. Using saline-moistened cotton tips, gently remove the intestine again, position the small branches of the vein on a black dough, inject 50 µL of Acridine orange again, and capture the videos of the same vein in the same location (post-ischemia).

4. Intravital high-speed video epifluorescence microscopy

1. Visualize leukocytes and NETs with a high-speed wide-field fluorescence microscope equipped with a long-distance condenser, a monochromator, a 10x water immersion objective, and a charge-coupled device camera. The image acquisition was performed with a 30 ms exposure time and Alexa Fluor 488(495/519) and Rhodamine Red (570/590) filters.
2. Use imaging software for image acquisition and analysis.
3. Quantify cell recruitment within a 0.06 mm² region of interest.
4. Quantify adherent leukocytes as cells remaining stationary or attached to the endothelial lining for a 20 s observation period.
5. Identify NETs as extracellular structures labeled with both leukocyte and extracellular nucleic acid fluorescent dyes.
6. Euthanize animals by cervical dislocation at the end of the experiment (following institutionally approved protocols).

5. Liver endothelial cell (LEC) isolation and quantitative RT-PCR

1. Isolate LECs via magnetic cell sorting (MACS)²⁹.
2. Isolate total RNA.
3. Perform complementary DNA (cDNA) synthesis²⁷ by mixing 2 µg of total RNA with 2 µL of RT Buffer, 0.8 µL of dNTP Mix, 2 µL of RT Random Primers, 1 µL of Reverse Transcriptase, and 4.2 µL sterile distilled H₂O.
4. cDNA transcription was performed applying the following conditions: 25 °C for 10 min, 37 °C for 120 min, 85 °C for 5 min.
5. Use 20 ng of cDNA for qPCR.
6. Use the following primers: F2r (forward): TGAACCCCCGCTCATTCTTTC, F2r (reverse): CCAGCAGGACGCTTTCATTTTT, L32 (forward): CCTCTGGTGAAGCCCAAGATC, L32 (reverse): TCTGGGTTTCCGCCAGTTT. Use the following conditions: 95 °C 30 s, 45 cycles of (95 °C for 10 s, 60 °C for 25 s), 60 °C to 95 °C for 6 s with ΔΤ 1 °C.

Results

To study the endothelial cell-dependent effects on leukocyte rolling and adhesion as well as on NET formation, initially, the efficacy of the VE-Cadherin Cre inducible F2r-deficiency was examined in endothelial cells. Magnetic cell sorting was employed to isolate hepatic endothelial cells. Subsequently, RNA was isolated, followed by quantitative real-time PCR (qRT-PCR). The F2r^ΔEC mice, in which the Cre recombinase expressed under the control of the VE-Cadherin promoter is absent, showed...

Discussion

The mesenteric I/R injury combined with intravital microscopy was applied to a genetic mouse model of F2r (PAR1) deficiency in endothelial cells for the in vivo analysis of leukocytes and NETs after 1 h of ischemia. The mesenteric I/R injury model is frequently used in rodents with both ischemia and reperfusion times varying from minutes to several hours^23,31, influencing the inflammatory outcome³² and mortality

Materials

Name	Company	Catalog Number	Comments
Acridine orange	Sigma-Aldrich	A-6014
96-well plate Multiply PCR-Platten	Sarstedt	721977202.00
Anaesthesia Systems for Rodents	GROPPLER medizintechnik	Uni Vet -Porta T-8
Aqua ad injectabilia IVM	B Braun Melsungen	53402101
black dough	Staedtler		modelling clay
CD146 Microbeads, mouse	Miltenyi Biotec	130-092-007
cellSens	Olympus	Olympus cellSense Dimension Desktop 2.3	software
charge-coupled device camera	Hamamatsu Photonics	ORCA-R2	camera
cotton swabs	Böttger	09-119-9100
Curved Hemostat 125mm/5"	Indigo Instruments	22466
Depilatory cream	Balea	not applicable
Dorbene Vet	zoetis
Dumont Forceps	Fine Science Tools	11251-35
Ethanol p.a. 99,5 %	Roth	5504.20
Extra Narrow Scissors – Straight/Sharp-Sharp/10.5	FST	14088-10
Fentanyl	Janssen-Cilag GmBH
Forceps "Dumont #5" (Inox, tip 0.1mm, length 11 cm)	FST	11251-20
GentleMACS C Tubes	Miltenyi Biotec	130-093-236
Graphpadprism	Graphpad	Prism 10	software
isoflurane	Piramal	4150097146757.00
iTaq UniversalSYBR Green Supermix 10x5ml	BioRad	1725125.00
Leukofix medical tape	BSNMedical	0213600
Liver Dissociation Kit, mouse	Miltenyi Biotec	130-105-807
LS-Separation columns MACS	Miltenyi Biotec	130-042-401
MACS Smart Strainer 100 µm	Miltenyi Biotec	130-098-463
Microseal B Seal Seals	Biorad	MSB1001
Midazolam	hameln	5918501.00
NaCl	Braun	2350748
Needle holder	FST	12001-13
Nonabsorbable Braided Silk Suture, Size: 7/0, 91 Meters	Fine Science Tools	18020-70
Olympus BX51WI fluorescence microscope	Olympus		microscope
PCR for Tube Strips	Sarstedt	72985002.00
PCR Tube Lids	Sarstedt	65989002.00
Plyethylene Catheter	Smith Medical Deutschland GmbH	800/100/100
Prolene (8648G), Polypropylen 6-0, Nahtmaterial	Johnson & Johnson Medical GmbH	8695H
Relia Prep RNA Miniprep Systems	Promega	Z6112
Reverse Tanscription Kit (High Capacity cDNA)	Applied Biosystems	4368813.00
School scale	KERN & SOHN GmbH	EMB 500-1
Spring Scissors - Angled to Side	FST	15006-09
Stereo microscope	Leica	M50
Straight Hemostats 135mm/5.5"	Indigo Instruments	22468
Syringe 1 mL	Braun	9166017V
SYTOX Orange	Thermo Fisher Scientific	S11368
Temperature Controller TC-1000	FMI Föhr Medical Instruments GmbH	not applicable
Tissue Forceps - 1x2 Teeth	FST	18057-14
vascular clamp	Fine Science Tools	18055-02
Vetiva mini	WAHL	1584-0480