Bu video-makale yapılan deneyler uluslararası Genetik Makinesi rekabete 9 için geliştirilmiştir. Yazarlar için iGEM ekip üyeleri Luke Bergwerff, Pieter van TM Boheemen, Jelmer Cnossen, Hugo F. Cueto Rojas ve Ramon van der Valk teşekkür etmek istiyorum araştırma yardımı. Biz yararlı tartışmalar ve bu araştırma barındırma için Han de Winde, Stefan de Kok ve Esengül Yıldırım ederim. Bu çalışma Biyoteknoloji TU Delft Üniversitesi, Delft Biyoinformatik laboratuar, Bionanoscience TU Delft Bölümü, Oil Sands Liderlik İnisiyatifi (OSLI), damızlık studentenuitzendbureau, Hollanda Genomik Girişimi, Kluyver Merkezi, Nederlandse Biotechnologische Vereniging (Stichting Biyoteknoloji Nederland) tarafından desteklenmiştir DSM, Geneart, Greiner Bio-one ve Genencor.

1. BioBrick Meclisi <ol><li> Standart Biyolojik parçaları Sicilinden BioBricks iGEM merkez tarafından sağlanmaktadır. Mevcut BioBricks yeni bir BioBrick oluşturmak için, alıcı kısmın verici parça aşağı konumlandırılması için enzimler EcoRI ve SpeI ile verici BioBrick (en fazla 1.0 ug) sindirimi. Alıcı kısmının yukan verici parça konumlandırılması için Xbal ve PstI ile Digest. Donör omurgasında kesen bir üçüncü uygun restriksiyon enzimi ekleyin. Satıcı (nihai konsantrasyon 1 x) &#39;ye göre, uygun bir tampon ile 20-25 ml&#39;lik bir toplam hacim içinde sindirimler gerçekleştirin. Restriksiyon enzimleri için 5 adet / mg DNA kullanın. </li><li> EcoRI ve Xbal ya da SpeI ve PstI ile ya da alıcı BioBrick özet. </li><li> 37. az bir saat (en az) için sindirimler inkübe ° C. Kısıtlama ısı endonükleazları Inactivate, 80 inkübasyon süre 10 dakika ve santrifüj ° C. </li><li> Sindirilmiş BioBrick Arterbirlikte parçaları (verici ve alıcı). Xbal ve SpeI uyumlu DNA uçları oluşturur yana, bir karma site 4 standart kısıtlama siteleri ile çevrili yeni bir &#39;birleşik&#39; BioBrick sonuçlanan herhangi bir restriksiyon enzimi ile kesilmiş olamaz oluşturulur. Ligasyon karışımı, bir son DNA konsantrasyonu, tercihen ~ 100 ng / ml &#39;den. T4 ligasyon tampon (nihai konsantrasyon 1 x) ve T4 ligaz (1 ünite / ug DNA) birlikte 10-15 ml&#39;lik toplam hacim içinde ligasyon reaksiyonu gerçekleştirin. </li><li> En azından 3 saat için 16 ° C &#39;de ligasyon karışımı inkübe edin. </li><li> Ligasyon karışımı yaklaşık yarısı dönüşüm reaksiyonu gerçekleştirin. </li><li> Sıralama ile doğru olmak BioBrick onaylayın. </li><li> Sentezlenen DNA &#39;sından yeni BioBrick inşa etmek için, E. optimum ifade için sentez genleri için değiştirmek JCat web sitesi aracının (vasıtasıyla coli <a href="http://www.jcat.de/" target="_blank">http://www.jcat.de/</a> ). B gereklerine uygun olarak daha fazla değişiklik yapın<html> ioBrick standart. Bu standardizasyon her BioBrick bir önek öncesinde ve sonek ardından ilgi DNA dizisi oluşur anlamına gelir. Önek ve sonek kalan plazmid sırayla bulunmadığına önceden tanımlanmış kısıtlama siteleri içeren dizileri vardır. Bunlar standart kısıtlama siteleri değiştokuşu ve 9 esnek BioBrick ekler uzatmak mümkün kılar. Önek ve sonek aşağıdaki dizileri var: </li></ol><table border="1"><tbody><tr><td> Isim </td><td> Sıra </td><td> Yorumlamak </td></tr><tr><td> Önek </td><td> 5 &#39;GAATTCGCGGCCGCTTCTAG3&#39; </td><td></td></tr><tr><td></td><td> 5 &#39;GAATTCGCGGCCGCTTCTAGAG 3&#39; </td><td> Aşağıdaki parçası kodlama sırası veya &quot;ATG&quot; ile başlayan herhangi bir bölümü ise </td></tr><tr><td> Sonek </td><td> 5 &#39;TACTAGTAGCGGCCGCTGCAG 3&#39; </td><td></td></tr></tbody></table>In Vivo ove_title &quot;&gt; 2. Alkan Dönüşüm Dinlenme Hücre Deneyi, Bu tahlil, Fujii ve diğ. (2004) tarafından tarif edilen yönteme göre yapıldı. <ol><li> Kültür E. Alkan Hidroksilaz sistemi (eksprese coli hücreleri <a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_K398014</a> bir boş vektör (taşıma) ve hücreler <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> gece boyunca uygun antibiyotikler ile 5 ml LB ortam içinde). </li><li> Taze LB 50 ml (antibiyotik) ile gece boyunca kültür içine 500 ul aktarın ve hücre bulanıklık 600 nm&#39;de 0.3 bir OD (optik yoğunluk) ulaşana kadar inkübe edilir. </li><li> 4,000 rpm&#39;de 10 dakika boyunca santrifüje ve 5 ml 0.1 M fosfat tampon maddesi (pH 7.4) içinde tekrar süspansiyon pelet. </li><li> 4,000 rpm&#39;de 10 dakika boyunca tekrar santrifüje ve artık E2 edilebilir tuzları ve% 0.66 hacim / hacim gliserol (nitrojen-ihtiva eden yetersizliklerin 5 ml 0.1 M fosfat tampon içinde tekrar süspansiyon pelett orta). </li><li> Hücre bulanıklık (OD 600) ölçün. </li><li> 25 ml kapalı bir kap cam şişeler ve herhangi bir hücre kontrol (E2 tuzları +% 0.66 hacim / hacim gliserol) içinde 6 ml hücre-alikotları karışım hazırlayın. </li><li> Her şişeye alkan 100 nmol ekleyin. </li><li> 24 saat (daha yüksek oranlar elde edildiği takdirde kısaltmak) için 37 ° C &#39;de karışımlarını. </li><li> Inkübasyondan sonra OD 600 ölçün. </li><li> Etil asetat ile kültür ortamı içinde hidrokarbon ayıklamak ve gaz kromatografisi (protokol 3&#39;e bakınız) ile, hücre kültürü içinde hidrokarbon konsantrasyonu belirlenir. </li><li> Her balona toplam biyokütle bugünkü (kuru ağırlık OD 600 dönüştürmek) tarafından dönüştürülmüş alkan toplam miktarı bölerek biyokütle birim bozulması hesaplayın. Deney süresi sonucu bölerek birim zamanda birim biyokütle başına degradasyon aktivitesinin verir. Ortalama üç ayrı çalışır alınır. </li></ol> 3. Alkan Dönüşüm Enzim Testi, Inİn Vitro Bu tahlil, Li ve diğ. (2008) tarafından tarif edilen metoda göre esasen yapıldı. <ol><li> Kültür E. Lada gen (eksprese coli hücreleri <a href="http://partsregistry.org/Part:BBa_K398017" target="_blank">BBa_K398017</a> ) ve boş vektör (taşıyan hücreler <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> gece boyunca uygun antibiyotikler ile 50 mL LB ortam içinde). </li><li> Taze LB 50 ml (antibiyotik) ile gece boyunca kültür içine 500 ul aktarın ve hücre bulanıklık 600 nm&#39;de 0.6 bir optik yoğunluğa ulaşıncaya kadar inkübe edilir. </li><li> 4000 rpm (4 ° C) de 10 dakika santrifüjlenir ve 50 mM Tris tamponu, 5 ml içinde pelet tekrar süspansiyon. </li><li> 4 bir çıkış kontrolü ile% 40 görev devresi sonikasyon (Hücre bölücü, LA Biyosistem) hücreler, süresi boyunca buz üzerinde çözüm tutmak. </li><li> 4 ve d az 4000 rpm&#39;de 5 dakika için elde edilen karışım santrifüjlenirörneğin, C hücre enkaz kaldırmak için. Taze bir flakon süpernatant aktarın. </li><li> Bradford tahlili ile hücre özlerinin toplam protein konsantrasyonu belirlenir. Not: Arka plan artış ve / veya protein kaybını önlemek için cam şişe kullanın. </li><li> % 0.1 v / v alkan ve 50 mM Tris-HCl tampon içeren 100 ml&#39;lik bir karışım hazırlayın. </li><li> 5 dakika boyunca 100 ° C&#39;de karışım ısıtılır. Not: Sadece yüksek kaynama noktasına sahip orta-uzun zincirli alkanlar için bu adımı gerçekleştirin. (Örneğin C 16: 287 ° C). </li><li> Alkan optimal bir çözünürlük elde etmek için, 1 dak hala sıcak iken homojen, viskoz karışım elde edilinceye kadar için sonikasyon. </li><li> 1 mM NADH, 1 mM FMN, 1 mM MgSO4 ve 0.01 h / h Triton X-100 ilave edin. </li><li> 25 ml kapalı kap şişeleri içinde 6 ml alikotları hazırlayın. </li><li> Hücre ekstresi yeterli miktarda (Bradford deneyleri, 5 mg protein / l son konsantrasyon bağlıdır) ekleyin. No-proteini kontrol hazırlayın. </li><li> Optimal e 60 ° C (inkübe24 saat süre ile) aktivitesi nzymatic. </li><li> Etil asetat ile kültür ortamı içinde hidrokarbon ayıklamak ve gaz kromatografisi (protokol 3&#39;e bakınız) ile, hücre kültürü içinde hidrokarbon konsantrasyonu belirlenir. </li><li> Toplam protein tarafından dönüştürülmüş alkan toplam miktarı bölerek biyokütle birim bozulması hesaplayın Her balona (Bradford kalibrasyon eğrisi ile) eklendi. Ayrıca deneme süresi bölünerek birim zamanda hücresel protein birim degradasyon aktivitesinin verir. Ortalama üç ayrı çalışır alınır. </li></ol> 4. Etil Asetat Hidrokarbon Ekstraksiyon ve Konsantrasyon Ölçümleri <ol><li> Alkanların 6 ml deney için 2.5 ml çözelti, etil asetat (apolar çözücü) ilave edilerek sulu bir çözelti elde edilir. Dahili bir standart% 0.1 &#39;lik bir konsantrasyonda (v / v) de çözücü ilave edilir. Standart (örn. siklo-dekan) ilgi doruklarına beklenen aralığına bağlı olarak değişmektedir. </li><li> Opsiyonel: Add TritonSulu karışım, X-100 ve uygun bir iki faz sistemi elde etmek için 4000 rpm&#39;de 10 dakika için numune santrifüjlenir. </li><li> Girdap iki faz ayrı kadar 5 saniye (1,500 rpm) ile, oda sıcaklığında inkübe edin karışımı. </li><li> Organik katman (üst) arasında bir maksimum miktarda kaldırma ve susuz magnezyum sülfat ile çözücü kurutun. </li><li> Filtrasyon (0.2 mikron) tarafından MgSO4 çıkarın ve -20 ° C&#39;de ölçümleri için gaz kromatografisi şişeleri içine süzülen veya mağaza aktarmak </li><li> CP-SIL 5CB kolon (uzunluk = 5 kg) kullanılarak gaz kromatografisi ile konsantrasyonunun belirlenmesi. (1:10, 230 ° C) bölünmüş modda numune 10 ml enjekte edilir. 1 ml / dk (helyum) ile kolon gaz akış ayarlayın. Aşağıdaki fırın sıcaklık programı kullanılmıştır: <table border="1"><tbody><tr><td> Oran </td><td> Sıcaklık [° C] </td><td> Zaman [dk] </td></tr><tr><td> 0 </td><td> 50 </td><td> 7.5 </td></tr><tr><td> 50 </td><td> 90 </td><td> 1.0 </td></tr><tr><td> 50 </td><td> 110 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 130 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 145 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 160 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 170 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 185 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 210 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 250 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 320 </td><td> 2.0 </td></tr></tbody></table></li><li> Zirveleri entegre ve iç standart ile ilgili olarak konsantrasyonları düzeltin. </li></ol> 5. Alkol / Aldehit Dehidrogenaz Aktivitesi Testi Bu tahlil, Kato ve diğerleri tarafından tarif edilen metoda göre esasen yapıldı.(2010). <ol><li> Kültür E. ADH (eksprese coli hücreleri <a href="http://partsregistry.org/Part:BBa_K398018" target="_blank">BBa_K398018</a> ) ya da ALDH ( <a href="http://partsregistry.org/Part:BBa_K398030" target="_blank">BBa_K398030</a> ) geni ve bir boş vektör (taşıyan hücreler <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> gece boyunca uygun antibiyotikler ile 50 mL LB ortam içinde). </li><li> Taze LB 50 ml (antibiyotik) ile gece boyunca kültür içine 500 ul aktarın ve hücre bulanıklık 600 nm&#39;de 0.6 bir optik yoğunluğa ulaşıncaya kadar inkübe edilir. </li><li> 4 ° C&#39;de 4,000 rpm&#39;de 10 dakika santrifüjlenir ve 50 mM Tris tamponu, 5 ml içinde pelet tekrar süspansiyon. </li><li> 4 bir çıkış kontrolü (sonication sırasında buz üzerinde çözüm tutmak) ile% 40 görev devresi hücre çözümü sonikasyon. </li><li> ° C hücre tortularını çıkarmak üzere 4 az 4000 rpm&#39;de 5 dakika için elde edilen karışım santrifüjleyin. </li><li> Göre belirlenir(: Protein bağlama önlemek için bir cam şişe kullanın Not) Bradford yöntemi ile hücre ekstreleri tal protein konsantrasyonu. </li><li> 180 ul 57 mM glisin tampon her bir kuyu içinde NAD (nihai konsantrasyon 1 mM, pH 9.5) ihtiva eden 96 oyuklu bir plaka yerleştirin. </li><li> Kuyular için test edilecek olan alkol (aldehit) 5 ul ekle. Not: bir sıvı olması testin başlamasından önce ısı uzun zincirli alkoller. Her bir alkol (aldehit) alt tabaka olmadan bir kontrol (negatif kontrol) ilave edilmelidir. Buna ek olarak, hücre özütü olmaksızın substrat tampon ve bir karışımını içeren bir boş hazırlanır. </li><li> Ön ısıtma 37 &#39;de 15 dakika için plaka okuyucu (Tecan Macellan v7.0) ve plaka ° C sisteminin denge sağlamak için. </li><li> Hücre ekstresi yeterli miktarda (Bradford deneyleri, 5 mg protein / l son konsantrasyon bağlıdır) ekleyin. No-proteini kontrol hazırlayın. </li><li> 340 nm dalga boyunda 37 1 saat için her 2-3 dakikada ° C &lt;bir spektrofotometre kullanılarak NADH üretimi ölçün/ Li&gt; <li> OD (340 nm) eğiminden NADH üretim hızını hesaplayın. Dikkate ışık yolu uzunluğu ve 6220 M -1 cm -1 NADH sönüm katsayısı atın. Protein toplam miktarına göre NADH üretim hızı bölme hücre özütü olarak dehidrogenaz reaksiyonu (U / mg tam hücre protein) aktivitesinin eklendi. Ortalama ve üç bağımsız çalışır gelen standart sapmayı hesaplayın. </li></ol> 6. pCaiF Karakterizasyonu <ol><li> Kültür E. pCaiF-GFP construct (ifade coli hücreleri <a href="http://partsregistry.org/Part:BBa_K398331" target="_blank">BBa_K398331</a> ) ve yalnız organizatörü (taşıyan hücreler <a href="http://partsregistry.org/Part:BBa_K398326" target="_blank">BBa_K398326</a> uygun antibiyotik gecede 5 ml LB orta gecede). </li><li> 5 ml M9 gece boyunca kültürün 50 ul ile 10 g / l glukoz ve antibiyotik içeren inoküle ve gece boyunca büyümeye. </li&gt; <li> Gecede akıbet alt kültürünün 50 ul taze M9 with10 g / l ve inkübe 5 ml içine hücre bulanıklık 600 nm&#39;de 0.2 optik yoğunluk ulaşana kadar. </li><li> Her bir kuyudaki test için karbon kaynağı, istenen miktarda içeren taze M9 ortam 100 ul ile bir 96 kuyulu plakanın yerleştirin. İstatistiksel değerlendirme için üç nüsha deneyler gerçekleştirin ve ilgili negatif kontroller (yabani tip E. coli K12) ekleyin. </li><li> Sıvısı içeren kuyucuklara gece boyunca kültür 5 ul ekle. </li><li> Büyüme eğrisi (OD 600) ve bir plaka okuyucu kullanarak GFP floresan (485 nm eksitasyon ve emisyon 520) 37 18 saat süreyle her 10 dakikada ° C sabit sallama ile ölçün. </li><li> Büyüme hızı ve ilgili ölçümlerden özel GFP miktarı hesaplanır ve kontrol karşılaştırın. Ortalama, en az üç bağımsız deneyin standart sapma hesaplanır. </li></ol> 7. Tolerans Testi <ol><li> KültürE. coli PhPFDα ve β gen (eksprese <a href="http://partsregistry.org/Part:BBa_K398406" target="_blank">BBa_K398406</a> 5 ml LB ortamı ve uygun antibiyotikler de ertesi sabaha kadar). E. Lada geni (eksprese coli <a href="http://partsregistry.org/Part:BBa_K398017" target="_blank">BBa_K398017</a> ) negatif kontrol olarak kullanılmıştır. </li><li> Taze 5 LB ml (antibiyotik) ve inkübe içine gecede akıbet alt kültürünün 10 ul hücre bulanıklık 600 nm az 0,4 ile 0,3 arasındaki bir optik yoğunluk ulaşana kadar. </li><li> Bir 0,1 OD 600 ulaşılıncaya kadar taze besiyeri ile kültürleri seyreltin. </li><li> Uygun antibiyotik ve üç kopya halinde toksik bileşik (örneğin, 0, 4, 8, n-heksan ve% 10) uygun bir şekilde nihai konsantrasyon ihtiva eden 180 ul M9 ortam ile bir 96 oyuklu plaka yerleştirin. Alkan-su karışımları iki fazlı sistemlerde yol açabilecek Çünkü (örneğin d plaka üzerinde uygun kontrollerin olması esastırifferent suşları ile ilgili boş deneyler). </li><li> Kuyulara kültürün 20 ul (kontrol) ilave edilir. </li><li> Sabit sallama bir plaka okuyucu 37 24 saat boyunca her 10 dakikada ° C kullanarak biyokütle konsantrasyonu (OD 600) ölçün. </li><li> Farklı bir ajan konsantrasyonları için ilgili ölçümlerden büyüme oranları hesaplayın ve negatif kontrol ile karşılaştırıldığında. Ortalama ve en az üç bağımsız ishal standart sapmayı hesaplayın. </li></ol> 8. Homolog Etkileşim Haritalama <ol><li> Uygulama HIM STRING veritabanı (akademik kullanım için ücretsiz) 20 çalıştıran bir PostgreSQL sunucu üzerinde protein sorguları gerçekleştirmek için geliştirilmiştir. Homolog etkileşimi haritalama uygulaması STRING veritabanı kullanarak orijinal konak organizma etkileşen proteinleri tanımlar. Söz konusu etkileşim gen dizileri hedef organizma içinde homolog genlerin bulmak için bir patlama arama kullanılır. Cytoscape 4 </skadar&gt; haritalama sonucu görselleştirmek için kullanılır. : HIM yazılım aracı indirilebilir <a href="https://github.com/jcnossen/InteractionHomologMapping" target="_blank">https://github.com/jcnossen/InteractionHomologMapping.</a> </li><li> Bir eşleme gerçekleştirmek için, (1) BioBrick kimliği girin ve uygulama otomatik olarak Standart Biyolojik parçaları 9, veya uygulama (2) enter (macun) dizisi verilerin kayıt defterinden parçası dizisi veri indirecektir. </li><li> Girilen amino asit dizisi için STRING proteinin kimliğini bulmak için STRING Veritabanı web sitesini kullanın. </li><li> Yüksek bir homolojiye sahip bir protein BLAST kullanılarak tespit edilir. Daha sonra uygulama konak organizma içinde homologları (örn. E. coli) için kaynak organizma ve arama içinde bilinen her etkileşimli protein listeler. </li><li> Metin veya Cytoscape için oluşabilecek olası etkileşimi listesini verin. </li></ol>

<ol>
	<li>Allen, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Process+water+treatment+in+Canada's+oil+sands+industry:+I:+Target+pollutants+and+treatment+objectives.">Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives.</a> J. Environ. Eng. Sci. 7, 123-138 (2008).</li><li>Alon, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> An Introduction to Systems Biology: Design Principles of Biological Circuits. , (2007).</li><li>Center, O. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Understanding Oil Spills and Oil Spill Response. , (1999).</li><li>Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+the+caiF+gene+encoding+a+potential+transcriptional+activator+of+carnitine+metabolism+in+Escherichia+coli.">Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli.</a> J. Bacteriol. 178, 1248-1257 (1995).</li><li>Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+and+proteome+of+long-chain+alkane+degrading+Geobacillus+thermodenitrificans+NG80-2+isolated+from+a+deep-subsurface+oil+reservoir.">Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir.</a> Proc. Natl. Acad. Sci. U.S.A. 104 (13), 5602-5607 (2007).</li><li>Fujii, T., Narikawa, T., Takeda, K., Kato, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotransformation+of+various+alkanes+using+the+Escherichia+coli+expressing+an+alkane+hydroxylase+system+from+Gordonia+sp.+TF6.">Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6.</a> Biosci. Biotechnol. Biochem. 68 (10), 2171-2177 (2004).</li><li>Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cloning+of+an+alcohol+dehydrogenase+from+thermophilic+alkane-degrading+Bacillus+thermoleovorans+B23.">cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23.</a> J. Biosci. Bioeng. 91 (1), 100-102 (2001).</li><li>Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+cloning+and+characterization+of+an+aldehyde+dehydrogenase+from+long-chain+alkane-degrading+Geobacillus+thermoleovorans+B23.">Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23.</a> Extremophiles. 14, 33-39 (2010).</li><li>Kieboom, J., De Bont, J. a. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Bacterial Stress Responses. , (2000).</li><li>Kotte, O., Zaugg, J. B., Heinemann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+adaptation+through+distributed+sensing+of+metabolic+fluxes.">Bacterial adaptation through distributed sensing of metabolic fluxes.</a> Mol Syst Biol. 6, 355 (2010).</li><li>Kremling, A., Bettenbrock, K., Gilles, E. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+global+control+of+Escherichia+coli+carbohydrate+uptake.">Analysis of global control of Escherichia coli carbohydrate uptake.</a> BMC Syst. Biol. 1, (2007).</li><li>Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+long-chain+alkane+monooxygenase+(LadA)+in+complex+with+coenzyme+FMN:+unveiling+the+long-chain+alkane+hydroxylase.">Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase.</a> J. Mol. Biol. 376 (2), 453-465 (2008).</li><li>Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+the+maximum+specific+uptake+capacities+for+glucose+and+oxygen+in+glucose-limited+fed-batch+cultivations+of+Escherichia+coli.">Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli.</a> Biotechnol. Bioeng. 73 (5), 347-357 (2001).</li><li>Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overexpression+of+prefoldin+from+the+hyperthermophilic+archaeum+Pyrococcus+horikoshii+OT3+endowed+Escherichia+coli+with+organic+solvent+tolerance.">Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance.</a> Appl. Microbiol. Biotechnol. 79 (3), 443-449 (2008).</li><li>Rehm, H. J., Reiff, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+and+occurrence+of+microbial+oxidation+of+long-chain+alkanes.">Mechanisms and occurrence of microbial oxidation of long-chain alkanes.</a> Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).</li><li>Rojo, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Degradation+of+alkanes+by+bacteria.">Degradation of alkanes by bacteria.</a> Environ. Microbiol. 11 (10), 2477-2490 (2009).</li><li>Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Pseudomonas+putida+alkane-degradation+gene+clusters+and+flanking+insertion+sequences:+evolution+and+regulation+of+the+alk+genes.">Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes.</a> Microbiology. 147, 1621-1630 (2001).</li><li>Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+a+novel+thermophilic+Bacillus+strain+degrading+long-chain+n-alkanes.">Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes.</a> Extremophiles. 10 (4), 347-356 (2006).</li></ol>

Çıkar çatışması ilan etti.

BioBrick prensibi alkan bozulması için bir şase oluşturmak için kullanılan ve araç setinin tek bileşenleri için ilkesinin bir kanıtı elde edildi. Bazı deneyler, in vivo ve alkan alçaltıcı enzimler yolu in vitro aktivite ölçmek için önerilmiştir. Sunulan çalışmalar başarılı bir konak organizma içinde E. enzim aktiviteleri ile ifade belirlemek için kullanılabilecek bir dizi yöntem göstermektedir Uygun BioBricks uygulanmasından sonra coli. Üstelik, BioBri...

Oil pollution is among the most serious causes of environmental contamination, and greatly affects ecosystems, businesses and communities 3. Solutions are for example required to battle the continuous oil pollution originating from the oil sands tailing waters in Alberta, Canada. During the process of oil extraction from oil sands, bitumen, a semi-solid oxidized form of oil, is removed using thermal recovery techniques that consume about 3.1 barrels of water per single barrel of oil 1. Oil contaminated process water, mainly originating from a local river, is stored in tailing ponds after bitumen extraction. A more effective recycling of process water in order to reduce the need for freshwater uptake is needed. To facilitate the bitumen extraction and to ensure that downstream sites meet water quality guidelines for the protection of aquatic ecosystems, process water treatments are rapidly evolving 3.
To treat pollution of organic compounds, bioremediation technologies employing microorganisms are presently encouraged 1. Alkanes are the most abundant family of hydrocarbons in crude oil, containing 5 to 40 carbon atoms per molecule 7, 21. Many bacteria are known to degrade alkanes of various lengths via sequential oxidation of the terminal methyl group forming first alcohols, then aldehydes and finally fatty acids 8. Within this iGEM project several enzymes from different organisms were expressed and characterized, and made available via the BioBrick standard and Registry of Standard Biological Parts.
The well-studied alkane hydroxylase system of Gordonia sp. TF6 facilitates the initial oxidation step of C5-C13 alkanes along with that of C5-C8 cycloalkanes using a minimum of four components: alkB2 (alkane 1-monooxygenase), rubA3, rubA4 (two rubredoxins) and RubB (rubredoxin reductase) 8, 21. Oxidation of long-chain alkanes (ranging from C15 up to C36) is reported to be performed by ladA, a flavoprotein alkane monooxygenase from Geobacillus thermodinitrificans NG-80-2 7, 15, 18, 22. LadA forms a catalytic complex with flavin mononucleotide (FMN) that utilizes atomic oxygen for oxidation. This results in the conversion of alkanes into the corresponding primary alkanol. The alcohols are further oxidized by alcohol and aldehyde dehydrogenases to fatty acids, which readily enter the &beta;-oxidation pathway 7, 21. A zinc-independent alcohol dehydrogenase from the thermophillic bacterium Geobacillus thermoleovorans B23 oxidizes medium-chain alkanols into their respective alkanals, using NAD+ as a cofactor 10. Aldehyde dehydrogenase from the same bacterium is able to catalyze the NAD+-dependent final step in the medium-chain oxidation 11.
In order to reduce induction costs and to maintain optimal proliferation of the bacterial system, the promoter pCaiF from E.coli was characterized. This promoter can regulate expression of the hydrocarbon degradation pathway components, and is regulated by cAMP-Crp levels, which in turn depend on glucose levels 6. At high extracellular glucose concentrations in the environment the cellular cAMP (cyclic Adenosine Mononucleotide Phosphate) level was low through the inhibition of adenylyl cyclase as a side effect of PTS mediated glucose transport. Conversely, during limitation (low glucose concentrations) the cAMP level increased and Crp bound to cAMP forming the complex, cAMP-Crp, which bound pCaiF and activated transcription of the downstream components 6, 14.
Wildtype E. coli can only tolerate moderate concentrations of hydrocarbons. To complete the toolkit, tolerance to hydrocarbons had to be addressed. Several organic solvent-tolerant bacteria are known to survive in water-solvent two-phase systems 12. Molecular components known to increase tolerance are chaperones that facilitate the correct folding of proteins. The prefoldin system from Pyrococcus horikoshii OT3, consisting of the proteins phPFD&alpha; and phPFD&beta;, was shown to increase hydrocarbon-tolerance 17.
The alkane conversion toolkit was constructed following the BioBrick principle, which is documented at the Registry of Standard Biological Parts 9. BioBricks are plasmids containing a specific functional insert that is flanked by 4 predefined restriction sites. The BioBrick inserts can be extended flexibly, allowing the construction of biological systems with new functions.

<table border="1">
	<tbody>
		<tr>
			<td>Name of the reagent</td>
			<td>Company</td>
			<td>Catalogue number</td>
			<td>Comments (optional)</td>
		</tr>
		<tr>
			<td>E. coli K12</td>
			<td>New England Biolabs</td>
			<td>C2523H</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Octane</td>
			<td>Fluka</td>
			<td>74822</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Hexadecane</td>
			<td>Fluka</td>
			<td>52209</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>octanol-1</td>
			<td>Fluka</td>
			<td>95446</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>dodecanol-1</td>
			<td>Sigma-Aldrich</td>
			<td>126799</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Hexane</td>
			<td>Sigma-Aldrich</td>
			<td>296090</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>NADH</td>
			<td>Sigma</td>
			<td>N4505</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>FMN</td>
			<td>Sigma</td>
			<td>F2253</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>J.T. Baker Casno</td>
			<td>7487 889</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T8787</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>T4 ligase</td>
			<td>New England Biolabs</td>
			<td>M0202L</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Gas chromatograph</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Cell disrupter</td>
			<td>LA Biosystems</td>
			<td>CD-019</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Amersham pharmacia</td>
			<td>spec 2000</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Plate reader</td>
			<td>Tecan</td>
			<td>Magellan v7.0</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>Innova, 44</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>BioBrick K398014: 
			BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_K398014</a></td>
			<td>Alkane Hydroxylase System 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398027: BBa_R0040-BBa_B0034-ladA</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398027" target="_blank">BBa_K398027</a></td>
			<td>ladA Protein Generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398018: BBa_J23100-BBa_J61101-ADH</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398018" target="_blank">BBa_K398018</a></td>
			<td>ADH generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398030: BBa_R0040-BBa_B0034-ALDH</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398030" target="_blank">BBa_K398030</a></td>
			<td>ALDH generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398326: pCaiF</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398326" target="_blank">BBa_K398326</a></td>
			<td>pCaiF promoter 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398331: pCaiF-BBa_B0032-BBa_I13401</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398331" target="_blank">BBa_K398331</a></td>
			<td>pCaiF measurement device 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398406: BBa_J23002-BBa_J61107-phPFD&alpha;-BBa_J61107-</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398406" target="_blank">BBa_K398406</a></td>
			<td>Solvent tolerance cluster 
			Resistance: Chloramphenicol</td>
		</tr>
	</tbody>
</table>

a toolkit to enable hydrocarbon conversion in aqueous environments

Bu çalışma ileriye Escherichia coli alkan dönüşüm sağlayan ve uygulanabilirlik ilkesinin bir kanıtı sunan bir araç koyar. Toolkit çoklu standart değiştirilebilir parçalar (BioBricks) 9 alkan dönüşüm, toksik hidrokarbon zengini ortamlarda gen ekspresyonu ve sağkalım düzenlenmesi ele oluşur. Alkan bozulması için üç aşamalı yolun E. uygulanmıştır kendi alkanoller, alkanals ve sonuçta alkanoik asitler, orta ve uzun zincirli alkanlar dönüşümü sağlamak için coli. Ikincisi doğal β-oksidasyon yol üzerinden metabolize edildi. Orta-zincirli alkanlar (C5-C13) sikloalkanlar ve (C5-C8), Gordonia sp alkan hidroksilaz sistemi dört gen (alkB2, rubA3, rubA4 ve kolla) &#39;nin oksidasyonu kolaylaştırmak için. TF6 8,21 E. dönüştü coli. Ve dönüşüm içinUzun zincirli alkanlar (C15-C36), Geobacillus thermodenitrificans dan Lada gen uygulanmıştır. Bozulması sürecinin gerekli ileri adımlar için, ADH ve ALDH (G. thermodenitrificans menşeli) 10,11 tanıtıldı. Istirahat etkinlik hücrelerin analizi ile ölçülmüştür. Her oksidatif adım için, enzim aktivitesi gözlendi. Süreci etkinliği optimize etmek için, ifade sadece düşük glikoz koşullar altında uyarılmıştır: bir alt-tabaka ile düzenlenen promotör, pCaiF kullanılmıştır. pCaiF E. mevcut coli K12 ve non-glikoz karbon kaynaklarının bozulma içerdiği genlerin ekspresyonunu düzenlemektedir. Setinin son bölümü - yaşama hedefleme - PhPFDα ve β çözücü dayanıklılık genlerinin, Pyrococcus horikoshii OT3 hem kullanılarak uygulanmıştır. Organik solventler olumsuz affectin tarafından hücrenin stres neden ve beka azalmış olabilirg protein katlanması. Şaperonlar olarak, PhPFDα ve β alkan varlığı altında protein katlama işlemi örneğin arttırır. Kültür ortamı içinde% 10 n-heksan suretin artan bir büyüme oranı (% 50&#39;ye kadar) ile gösterilen bir hidrokarbon iyileştirilmiş tolerans yol açmıştır, bu genlerin ekspresyonu görülmüştür. Özetleme, sonuç seti E. sağlar belirtmek Sulu ortamlarda hidrokarbon dönüştürmek ve tolere coli. Bu nedenle, bir sentetik biyoloji yaklaşım kullanarak petrol iyileştirme için sürdürülebilir bir çözüm bulunması yönünde bir ilk adımdır.

Alkane conversion
The activity of the three oxidation steps from the alkane to the respective fatty acid was evaluated using resting cell assays and enzyme activity measurements. The results are presented following the pathway reactions (1) alkane hydroxylase, (2) alcohol dehydrogenase and (3) aldehyde dehydrogenase. 
For the first step, different plasmids were constructed for medium and long-chain alkanes. The plasmid <a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_...

Watch this Scientific Journal Video about A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments at JoVE.com

Sulu Ortamlarda Hidrokarbon Dönüşümünü Etkinleştirecek Bir Araç Takımı | Biyomühendislik | Video

A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

Petrol kirliliğinin iyileştirilmesi için bakteriyel sistemini düzenleyen sürdürülebilir bir otomatik standart değiştirilebilir DNA parçalarının (BioBricks) kullanılarak tasarlanmıştır. Bir mühendislik<em&gt; E. coli</em&gt; Gerilme toksik sulu ortamlarda β-oksidasyon yoluyla alkanlar indirgemek için kullanıldı. Farklı türlerden ilgili enzimler alkan bozulması aktivite göstermiştir. Için Ayrıca, artan bir tolerans<em&gt; N</em&gt;-Hekzan alkan dayanıklı bakterilerden gen değişimleri elde edilmiştir.

Sulu Ortamlarda Hidrokarbon Dönüşüm Enable A Toolkit

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The ...

a-toolkit-to-enable-hydrocarbon-conversion-in-aqueous-environments

Education

Research

JoVE Core

JoVE Journal

Organic Chemistry

Biology

Bioengineering

Ecology

Unit 1

Ecosystems

Alkanes and Cycloalkanes

SCIENTISTS IN ACTION

14.0K Görüntüleme.  Delft University of Technology. Petrol kirliliğinin iyileştirilmesi için bakteriyel sistemini düzenleyen sürdürülebilir bir otomatik standart değiştirilebilir DNA parçalarının (BioBricks) kullanılarak tasarlanmıştır. Bir mühendislik E. coli Gerilme toksik sulu ortamlarda β-oksidasyon yoluyla alkanlar indirgemek için kullanıldı. Farklı türlerden ilgili enzimler alkan bozulması aktivite göstermiştir. Için Ayrıca, artan bir tolerans N-Hekzan alkan d...

Video: A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

Creating Two-Dimensional Patterned Substrates for Protein and Cell Confinement

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1 While microcontact printing can be employed to directly print a large number of molecules, including proteins,2 DNA,3 and silanes,4 the formation of self-assembled monolayers (SAMs) from long chain alkane thiols on gold provides a simple way to confine proteins and cells to specific patterns containing adhesive and resistant regions. This confinement can be used to control cell morphology and is useful for examining a variety of questions in protein and cell biology. Here, we describe a general method for the creation of well-defined protein patterns for cellular studies.5 This process involves three steps: the production of a patterned master using photolithography, the creation of a PDMS stamp, and microcontact printing of a gold-coated substrate. Once patterned, these cell culture substrates are capable of confining proteins and/or cells (primary cells or cell lines) to the pattern.
The use of self-assembled monolayer chemistry allows for precise control over the patterned protein/cell adhesive regions and non-adhesive regions; this cannot be achieved using direct protein stamping. Hexadecanethiol, the long chain alkane thiol used in the microcontact printing step, produces a hydrophobic surface that readily adsorbs protein from solution. The glycol-terminated thiol, used for backfilling the non-printed regions of the substrate, creates a monolayer that is resistant to protein adsorption and therefore cell growth.6 These thiol monomers produce highly structured monolayers that precisely define regions of the substrate that can support protein adsorption and cell growth. As a result, these substrates are useful for a wide variety of applications from the study of intercellular behavior7 to the creation of microelectronics.8
While other types of monolayer chemistry have been used for cell culture studies, including work from our group using trichlorosilanes to create patterns directly on glass substrates,9 patterned monolayers formed from alkane thiols on gold are straight-forward to prepare. Moreover, the monomers used for monolayer preparation are commercially available, stable, and do not require storage or handling under inert atmosphere. Patterned substrates prepared from alkane thiols can also be recycled and reused several times, maintaining cell confinement.10

Self-assembled monolayers (SAMs) formed from long chain alkane thiols on gold provide well-defined substrates for the formation of protein patterns and cell confinement. Microcontact printing of hexadecanethiol using a polydimethylsiloxane (PDMS) stamp followed by backfilling with a glycol-terminated alkane thiol monomer produces a pattern where protein and cells adsorb only to the stamped hexadecanethiol region.

Protein ve hücre Etrafının İki Boyutlu Desenli Yüzeyler Oluşturma

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1  While microcontact printing ...

Biyomühendislik

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic valve leaflets are composed of interstitial cells suspended within an extracellular matrix (ECM) and are lined with an endothelial cell monolayer. The valve withstands a harsh, dynamic environment and is constantly exposed to shear, flexion, tension, and compression. Research has shown calcific lesions in diseased valves occur in areas of high mechanical stress as a result of endothelial disruption or interstitial matrix damage1-3. Hence, it is not surprising that epidemiological studies have shown high blood pressure to be a leading risk factor in the onset of aortic valve disease4. 
The only treatment option currently available for valve disease is surgical replacement of the diseased valve with a bioprosthetic or mechanical valve5. Improved understanding of valve biology in response to physical stresses would help elucidate the mechanisms of valve pathogenesis. In turn, this could help in the development of non-invasive therapies such as pharmaceutical intervention or prevention. Several bioreactors have been previously developed to study the mechanobiology of native or engineered heart valves6-9. Pulsatile bioreactors have also been developed to study a range of tissues including cartilage10, bone11 and bladder12. The aim of this work was to develop a cyclic pressure system that could be used to elucidate the biological response of aortic valve leaflets to increased pressure loads. 
The system consisted of an acrylic chamber in which to place samples and produce cyclic pressure, viton diaphragm solenoid valves to control the timing of the pressure cycle, and a computer to control electrical devices. The pressure was monitored using a pressure transducer, and the signal was conditioned using a load cell conditioner. A LabVIEW program regulated the pressure using an analog device to pump compressed air into the system at the appropriate rate. The system mimicked the dynamic transvalvular pressure levels associated with the aortic valve; a saw tooth wave produced a gradual increase in pressure, typical of the transvalvular pressure gradient that is present across the valve during diastole, followed by a sharp pressure drop depicting valve opening in systole. The LabVIEW program allowed users to control the magnitude and frequency of cyclic pressure. The system was able to subject tissue samples to physiological and pathological pressure conditions. This device can be used to increase our understanding of how heart valves respond to changes in the local mechanical environment.

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

A cyclic pressure bioreactor capable of subjecting heart valve tissue to physiological and pathological pressure conditions has been designed. A LabVIEW program allows users to control pressure magnitude, amplitude and frequency. This device can be used to study the mechanobiology of heart valve tissue or isolated cells.

Devirli Basınç Biyoreaktör Tasarım Ex vivo</emAort Kalp Vanalar> Eğitim

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic ...

Electric Field-controlled Directed Migration of Neural Progenitor Cells in 2D and 3D Environments

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the central nervous system1,2. These endogenous EFs are generated by cellular regulation of ionic transport combined with the electrical resistance of cells and tissues. It has been reported that applied EF treatment can promote functional repair of spinal cord injuries in animals and humans3,4. In particular, EF-directed cell migration has been demonstrated in a wide variety of cell types5,6, including neural progenitor cells (NPCs)7,8. Application of direct current (DC) EFs is not a commonly available technique in most laboratories. We have described detailed protocols for the application of DC EFs to cell and tissue cultures previously5,11. Here we present a video demonstration of standard methods based on a calculated field strength to set up 2D and 3D environments for NPCs, and to investigate cellular responses to EF stimulation in both single cell growth conditions in 2D, and the organotypic spinal cord slice in 3D. The spinal cordslice is an ideal recipient tissue for studying NPC ex vivo behaviours, post-transplantation, because the cytoarchitectonic tissue organization is well preserved within these cultures9,10. Additionally, this ex vivo model also allows procedures that are not technically feasible to track cells in vivo using time-lapse recording at the single cell level. It is critically essential to evaluate cell behaviours in not only a 2D environment, but also in a 3D organotypic condition which mimicks the in vivo environment. This system will allow high-resolution imaging using cover glass-based dishes in tissue or organ culture with 3D tracking of single cell migration in vitro and ex vivo and can be an intermediate step before moving onto in vivo paradigms.

This protocol demonstrates methods used to establish 2D and 3D environments in custom-designed electrotactic chambers, which can track cells in vivo/ex vivo using time-lapse recording at the single cell level, in order to investigate galvanotaxis/electrotaxis and other cellular responses to direct current (DC) electric fields (EFs).

2D ve 3D Ortamlarda Sinir Progenitör Hücreleri Elektrik Alanı kontrollü Yönetmen Göç

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the ...

Cell Co-culture Patterning Using Aqueous Two-phase Systems

Cell patterning technologies that are fast, easy to use and affordable will be required for the future development of high throughput cell assays, platforms for studying cell-cell interactions and tissue engineered systems. This detailed protocol describes a method for generating co-cultures of cells using biocompatible solutions of dextran (DEX) and polyethylene glycol (PEG) that phase-separate when combined above threshold concentrations. Cells can be patterned in a variety of configurations using this method. Cell exclusion patterning can be performed by printing droplets of DEX on a substrate and covering them with a solution of PEG containing cells. The interfacial tension formed between the two polymer solutions causes cells to fall around the outside of the DEX droplet and form a circular clearing that can be used for migration assays. Cell islands can be patterned by dispensing a cell-rich DEX phase into a PEG solution or by covering the DEX droplet with a solution of PEG. Co-cultures can be formed directly by combining cell exclusion with DEX island patterning. These methods are compatible with a variety of liquid handling approaches, including manual micropipetting, and can be used with virtually any adherent cell type.

Aqueous two-phase systems were used to simultaneously pattern multiple populations of cells. This fast and easy method for cell patterning takes advantage of the phase separation of aqueous solutions of dextran and polyethylene glycol and the interfacial tension that exists between the two polymer solutions.

Sulu İki fazlı sistemler kullanma Hücre Co-kültür desenlendirme

Cell patterning  technologies that are fast, easy to use and affordable will be required for the  future development of high throughput cell assays, ...

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to intrinsic parameters within the process allow a high degree of control over scaffold characteristics including fiber diameter, alignment and porosity. By developing scaffolds with similar dimensions and topographies to organ- or tissue-specific extracellular matrices (ECM), micro-environments representative to those that cells are exposed to in situ can be created. 
The airway bronchiole wall, comprised of three main micro-environments, was selected as a model tissue. Using decellularized airway ECM as a guide, we electrospun the non-degradable polymer, polyethylene terephthalate (PET), by three different protocols to produce three individual electrospun scaffolds optimized for epithelial, fibroblast or smooth muscle cell-culture. Using a commercially available bioreactor system, we stably co-cultured the three cell-types to provide an in vitro model of the airway wall over an extended time period.
This model highlights the potential for such methods being employed in in vitro diagnostic studies investigating important inter-cellular cross-talk mechanisms or assessing novel pharmaceutical targets, by providing a relevant platform to allow the culture of fully differentiated adult cells within 3D, tissue-specific environments.

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Advancements in biomaterial technologies enable the development of three-dimensional multi-cell-type constructs. We have developed electrospinning protocols to produce three individual scaffolds to culture the main structural cells of the airway to provide a 3D in vitro model of the airway bronchiole wall.

Elektrospinning Süreci Uyarlama bir Tri-katmanlı için üç Benzersiz ortamlar sağlamak için<em&gt; In Vitro</em&gt; Havayolu Wall Modeli

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to ...

Photopatterning Proteins and Cells in Aqueous Environment Using TiO2 Photocatalysis

Organic contaminants adsorbed on the surface of titanium dioxide (TiO2) can be decomposed by photocatalysis under ultraviolet (UV) light. Here we describe a novel protocol employing the TiO2 photocatalysis to locally alter cell affinity of the substrate surface. For this experiment, a thin TiO2 film was sputter-coated on a glass coverslip, and the TiO2 surface was subsequently modified with an organosilane monolayer derived from octadecyltrichlorosilane (OTS), which inhibits cell adhesion. The sample was immersed in a cell culture medium, and focused UV light was irradiated to an octagonal region. When a neuronal cell line PC12 cells were plated on the sample, cells adhered only on the UV-irradiated area. We further show that this surface modification can also be performed in situ, i.e., even when cells are growing on the substrate. Proper modification of the surface required an extracellular matrix protein collagen to be present in the medium at the time of UV irradiation. The technique presented here can potentially be employed in patterning multiple cell types for constructing coculture systems or to arbitrarily manipulate cells under culture.

Photopatterning Proteins and Cells in Aqueous Environment Using TiO2 Photocatalysis

We describe a protocol for modifying cell affinity of a scaffold surface in aqueous environment. The method takes advantage of titanium dioxide photocatalysis to decompose organic film in the photo-irradiated region. We show that it can be used to create microdomains of scaffolding proteins, both ex situ and in situ.

TiO kullanarak sulu bir ortamda Proteinler ve Hücreler photopatterning<sub&gt; 2</sub&gt; Photocatalysis

Organic contaminants adsorbed on the surface of titanium dioxide (TiO2) can be decomposed by photocatalysis under ultraviolet (UV) light. Here we describe ...

Aqueous Droplets Used as Enzymatic Microreactors and Their Electromagnetic Actuation

For the successful implementation of microfluidic reaction systems, such as PCR and electrophoresis, the movement of small liquid volumes is essential. In conventional lab-on-a-chip-platforms, solvents and samples are passed through defined microfluidic channels with complex flow control installations. The droplet actuation platform presented here is a promising alternative. With it, it is possible to move a liquid drop (microreactor) on a planar surface of a reaction platform (lab-in-a-drop). The actuation of microreactors on the hydrophobic surface of the platform is based on the use of magnetic forces acting on the outer shell of the liquid drops which is made of a thin layer of superhydrophobic magnetite particles. The hydrophobic surface of the platform is needed to avoid any contact between the liquid core and the surface to allow a smooth movement of the microreactor. On the platform, one or more microreactors with volumes of 10 &#181;L can be positioned and moved simultaneously. The platform itself consists of a 3 x 3 matrix of electrical double coils which accommodate either neodymium or iron cores. The magnetic field gradients are automatically controlled. By variation of the magnetic field gradients, the microreactors' magnetic hydrophobic shell can be manipulated automatically to move the microreactor or open the shell reversibly. Reactions of substrates and corresponding enzymes can be initiated by merging the microreactors or bringing them into contact with surface immobilized catalysts.

Lab-in-a-drop reaction systems allow the versatile implementation of complex reactions in a microfluidic scale. An automated actuation platform consisting of a 3 x 3 matrix of electromagnetic coils was developed and successfully used to merge two 10 &#181;L microreactors and thereby initiate an enzymatic reaction in the resulting liquid marbles.

Sulu damlacıkları enzimatik Microreactors ve onların elektromanyetik çalıştırma kullanılan

For the successful implementation of microfluidic reaction systems, such as PCR and electrophoresis, the movement of small liquid volumes is essential. In ...

Characterizing Cell Migration Within Three-dimensional In Vitro Wound Environments

Currently, most in vitro models of wound healing, such as well-established scratch assays, involve studying cell migration and wound closure on two-dimensional surfaces. However, the physiological environment in which in vivo wound healing takes place is three-dimensional rather than two-dimensional. It is becoming increasingly clear that cell behavior differs greatly in two-dimensional vs. three-dimensional environments; therefore, there is a need for more physiologically relevant in vitro models for studying cell migration behaviors in wound closure. The method described herein allows for the study of cell migration in a three-dimensional model that better reflects physiological conditions than previously established two-dimensional scratch assays. The purpose of this model is to evaluate cell outgrowth via the examination of cell migration away from a spheroid body embedded within a fibrin matrix in the presence of pro- or anti-migratory factors. Using this method, cell outgrowth from the spheroid body in a three-dimensional matrix can be observed and is easily quantifiable over time via brightfield microscopy and analysis of spheroid body area. The effect of pro-migratory and/or inhibitory factors on cell migration can also be evaluated in this system. This method provides researchers with a simple method of analyzing cell migration in three-dimensional wound associated matrices in vitro, thus increasing the relevance of in vitro cell studies prior to the use of in vivo animal models.

Characterizing Cell Migration Within Three-dimensional In Vitro Wound Environments

The goal of this protocol is to evaluate the effect of pro- and anti-migratory factors on cell migration within a three-dimensional fibrin matrix.

İçinde üç boyutlu Vitro hücre göç karakterize ortamlar yara

Currently, most in vitro models of wound healing, such as well-established scratch assays, involve studying cell migration and wound closure on ...

Protocol for MicroRNA Transfer into Adult Bone Marrow-derived Hematopoietic Stem Cells to Enable Cell Engineering Combined with Magnetic Targeting

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates after injection into injured tissues as well as the observed massive cell death rates lead to very restricted therapeutic effects. To overcome these limitations, we sought to establish a non-viral based protocol for suitable cell engineering prior to their administration. The modification of human CD133+ expressing SCs using microRNA (miR) loaded magnetic polyplexes was addressed with respect to uptake efficiency and safety as well as the targeting potential of the cells. Relying on our protocol, we can achieve high miR uptake rates of 80&#8211;90% while the CD133+ stem cell properties remain unaffected. Moreover, these modified cells offer the option of magnetic targeting. We describe here a safe and highly efficient procedure for the modification of CD133+ SCs. We expect this approach to provide a standard technology for optimization of therapeutic stem cell effects and for monitoring of the administered cell product via magnetic resonance imaging (MRI).

This protocol illustrates a safe and efficient procedure to modify CD133+ hematopoietic stem cells. The presented non-viral, magnetic polyplex-based approach may provide a basis for the optimization of therapeutic stem cell effects as well as for monitoring the administered cell product via magnetic resonance imaging.

Yetişkin kemik iliği türevi hematopoetik kök hücre mühendislik manyetik hedefleme ile kombine etkinleştirmek için hücre içine mikroRNA Transfer için iletişim kuralı

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates ...

Material Formation of Recombinant Spider Silks through Aqueous Solvation using Heat and Pressure

Many spiders produce seven types of silks. Six of the silks are fiber in form when produced by the spiders. These fibers are not water soluble. In order to reproduce the remarkable mechanical properties of spider silks, they must be produced in heterologous hosts as spiders are both territorial and cannibalistic. The synthetic analogs of spider silk also tend to be insoluble in aqueous solutions. Thus, a large percentage of research in recombinant spider silks rely upon organic solvents that are detrimental to large scale production of materials. Our group&#8217;s method forces the solvation of these recombinant spider silks into water. Remarkably, when these proteins are prepared using this method of heat and pressure, a wide range of material forms can be prepared from the same solution of recombinant spider silk proteins (rSSp) including: films, fibers, sponge, hydrogel, lyogel, and adhesives. This article demonstrates the production of the solvated rSSp and material forms in a manner that is more easily understood than from written materials and methods alone.

Here, we present a protocol to produce water soluble recombinant spider silk protein solutions and the material forms that can be formed from those solutions.

Isı ve basınç kullanarak sulu solvasyon yoluyla rekombinant örümcek Silks malzeme oluşumu

Many spiders produce seven types of silks. Six of the silks are fiber in form when produced by the spiders. These fibers are not water soluble. In order ...