이 비디오 문서에 수행 실험은 국제 유전 공학 기계 대회 9 개발되었다. 저자는 대한 iGEM 팀 회원 눅 Bergwerff, 에테르 TM 반 Boheemen, Jelmer Cnossen, 휴고 F. 쿠에 토 로자 스와 라몬 반 데르 Valk을 감사드립니다 연구 지원. 우리는 도움이 토론이 연구를 호스팅 한 데 Winde, 스테판 드 콕과 Esengül Yıldırım 감사드립니다. 이 작품은 생명 공학의 TU 델프트 대학과, 델프트 생물 정보학 연구실, Bionanoscience의 TU 델프트 (Delft)과, 오일 샌드 리더십 이니셔티브 (OSLI), 스터드 studentenuitzendbureau, 네덜란드 유전체학 이니셔티브, Kluyver 센터, Nederlandse Biotechnologische Vereniging (에는 Stichting 생명 공학 네덜란드)에 의해 지원되었다 , DSM, Geneart, Greiner 바이오 하나 Genencor.

1. BioBrick 조립 <ol><li> 표준 생물 부품의 레지스트리에서 BioBricks는 iGEM 본부에 의해 제공됩니다. 기존 BioBricks에서 새로운 BioBrick을 구성하려면 수용체 부분의 기증자 부분의 하류를 위치에 대한 효소 EcoRI과 SpeI으로 기증자 BioBrick (최대 1.0 μg) 소화. 수용체 부분의 상류 기증자 부분을 위치시키기위한 XbaI 및 PstI있는 다이제스트. 기증자의 중추에 끊어 삼분의 일 적절한 제한 효소를 추가합니다. 공급 업체 (최종 농도 1X)에 따라, 해당 버퍼와 20-25 ML의 총 볼륨에 dig​​estions을 수행합니다. 제한 효소에 대해 5 단위 / μg의 DNA를 사용하십시오. </li><li> EcoRI 및 XbaI 또는 SpeI 및 PstI 중과 수용체 BioBrick을 소화. </li><li> 37에 하나의 시간 (최소)의 digestions을 품어 ° C. 제한이 열에 의해 endonucleases 비활성화, 80에서 부화 곧 10 분 및 원심 분리기에 대한 ° C. </li><li> 소화 BioBrick을 Ligate함께 부품 (기증자와 수용체). XbaI 및 SpeI 호환 DNA 종료를 생성하기 때문에, 혼합 사이트는 4 표준 제한 사이트으로 둘러싸인 한 새로운 &#39;통합&#39;BioBrick에서 발생하는 제한 효소로 절단 할 수없는 그 생성됩니다. 결합 혼합물에서 최종 DNA 농도가 바람직 ~ 100 NG / μl. T4 결합 버퍼 (최종 농도 1X) 및 T4 ligase (1 단위 / μg의 DNA)와 10-15 ML의 총 볼륨의 결합 반응을 수행합니다. </li><li> 적어도 3 시간 16 ° C에 결합 혼합물을 품다. </li><li> 결합 믹스의 년경 반으로 변환 반응을 수행합니다. </li><li> 시퀀싱과 올바른 BioBrick을 확인합니다. </li><li> 합성 DNA에서 새 BioBrick을 구성하려면, E.에 최적의 표현을위한 합성에 대한 유전자를 수정 JCat 웹 사이트 도구 (수단을 이용하여 대장균 <a href="http://www.jcat.de/" target="_blank">http://www.jcat.de/</a> ). B의 요구 사항에 따라 추가 수정<html> ioBrick 표준입니다. 이 표준화는 모든 BioBrick이 접두사 앞에와 접미사 다음 관심있는 DNA 순서로 구성되어 있습니다 의미합니다. 접두사와 접미사는 나머지 플라스미드 순서대로 없어졌어 미리 정의 된 제한 사이트를 포함 시퀀스입니다. 이러한 표준 제한 사이트는 교류, 9 유연하게 BioBrick 삽입을 확장하는 것이 가능합니다. 접두사와 접미사는 다음과 같은 순서를 가지고 : </li></ol><table border="1"><tbody><tr><td> 이름 </td><td> 순서 </td><td> 논평 </td></tr><tr><td> 접두사 </td><td> 5 &#39;GAATTCGCGGCCGCTTCTAG3&#39; </td><td></td></tr><tr><td></td><td> 5 &#39;GAATTCGCGGCCGCTTCTAGAG 3&#39; </td><td> 다음 부분은 코딩 순서 또는 &quot;ATG&quot;로 시작하는 일부 경우 </td></tr><tr><td> 접미사 </td><td> 5 &#39;TACTAGTAGCGGCCGCTGCAG 3&#39; </td><td></td></tr></tbody></table>생체 내 ove_title &quot;&gt; 2. Alkane 변환 휴식 세포 분석, 이 분석은 후지 외. (2004)에 의해 기술 된 방법에 따라 수행되었다. <ol><li> 문화 E. Alkane Hydroxylase 시스템 (표현 대장균 세포 <a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_K398014</a> 빈 벡터 (수행)와 세포 <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002을</a> 하루 아침에 적절한 항생제로 5 ML의 LB 매체에를). </li><li> 신선한 LB의 50 ML (항생제 포함)에 밤 문화를 500 μl를 전송하고 세포 탁도가 600 나노 미터에서 0.3의 OD를 (광학 밀도)에 도달 할 때까지 알을 품다. </li><li> 4000 rpm으로 10 분 동안 원심 분리기, 5 ML 0.1 M 인산 버퍼 (산도 7.4)에서 펠렛을 resuspend. </li><li> 4000 rpm에서 10 분 동안 다시 원심 분리기 지금 E2 소금과 0.66 % V / V 글리세롤 (질소 deficien를 포함하는 5 ML 0.1 M 인산 버퍼에있는 펠릿을 resuspendt 중간). </li><li> 셀 탁도 (OD 600) 측정합니다. </li><li> 25 ML 폐쇄 캡 유리 플라스크없이 셀 컨트롤 (E2 소금 + 0.66 % V / V 글리세롤)에서 6 ML의 세포 혼합 aliquots를 준비합니다. </li><li> 각 플라스크에 alkane 100 nmol을 추가합니다. </li><li> 24 시간 (높은 속도를 얻을 때 단축)에 대한 37 ° C에서 혼합물을 품다. </li><li> 부화 후 OD 600 측정합니다. </li><li> 에틸 아세테이트하여 문화 미디어의 탄화수소를 추출하여 가스 크로마토 그래피 (프로토콜 3 참조)에 의해 세포 배양의 탄화수소 농도를 결정한다. </li><li> 각 플라스크에 총 바이오 매스 현재 (건조 중량에 OD 600 변환)에 의해 변환 alkane의 총 금액을 나누어 바이오 매스의 단위 당 저하를 계산합니다. 실험 기간으로 결과를 나누면 시간 단위 당 단위 바이오 매스 당 저하 활동을 산출. 평균은 세 개인 점에서 가져옵니다. </li></ol> 3. Alkane 전환 효소 분석에서는체외 이 분석은 리 외. (2008)에 의해 기술 된 방법에 따라 기본적으로 수행되었다. <ol><li> 문화 E. 라다 유전자 (표현 대장균 세포 <a href="http://partsregistry.org/Part:BBa_K398017" target="_blank">BBa_K398017</a> ) 및 빈 벡터 (들고 세포 <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002을</a> 하루 아침에 적절한 항생제로 50 ML의 LB 매체에를). </li><li> 신선한 LB의 50 ML (항생제 포함)에 밤 문화를 500 μl를 전송하고 세포 탁도가 600 나노 미터에서 0.6의 광학 밀도에 도달 할 때까지 품다. </li><li> 4000 RPM (4 ° C)에서 10 분 원심 분리기 50 MM 트리스 버퍼의 5 ML에 펠렛을 resuspend. </li><li> 4 출력 제어 40 % 듀티 사이클에서 Sonicate (셀 장애, LA Biosystems) 세포는 전체 기간 동안 얼음에 솔루션을 보관. </li><li> 4 &amp; D에 4,000 rpm으로 5 분 동안 발생하는 혼합물을 원심 분리기예를 들어, C 세포 오염 물질을 제거 할 수 있습니다. 새로운 유리 병에 표면에 뜨는을 전송합니다. </li><li> 브래드 포드 분석하여 세포 추출물의 총 단백질 농도를 결정합니다. 참고 : 배경의 증가 및 / 또는 단백질의 손실을 방지하기 위해 유리 병을 사용합니다. </li><li> 0.1 % V / V alkane 50 MM 트리스 - HCL 버퍼를 포함하는 100 ML 혼합물을 준비합니다. </li><li> 5 분에 ° C 100 혼합물을 가열. 참고 : 높은 끓는 점과 중간 길이의 체인 alkanes에 대해이 단계를 수행합니다. (예 : C 16 : 287 ° C). </li><li> alkane의 최적의 용해도를 달성하기 위해, 1 분 아직 따뜻한하는 동안 동질, 점성 혼합물을 취득 할 때까지에 sonicate. </li><li> NADH의 1mM, 1 MM FMN, 1 MM MgSO 4, 0.01 브이 / v 튼 X-100을 추가합니다. </li><li> 25 ML 폐쇄 캡 플라스크에서 6 ML aliquots를 준비합니다. </li><li> 세포 추출물의 충분한 양을 (브래드 포드 assays, 5 MG 단백질 / L​​의 최종 농도에 따라 달라집니다)를 추가합니다. 노 단백질 제어를 준비합니다. </li><li> 최적의 전자에 60 ° C (에 품다24 시간 용) 활동 nzymatic. </li><li> 에틸 아세테이트하여 문화 미디어의 탄화수소를 추출하여 가스 크로마토 그래피 (프로토콜 3 참조)에 의해 세포 배양의 탄화수소 농도를 결정한다. </li><li> 총 단백질에 의해 변환 alkane의 총 금액을 나누어 바이오 매스의 단위 당 저하를 계산은 각 플라스크 (브래드 포드 보정 곡선에 의해)에 추가되었습니다. 또한 실험 기간으로 나누어은 시간 단위 당 세포 단백질의 단위 당 저하 활동을 산출. 평균은 세 개인 점에서 가져옵니다. </li></ol> 4. 에틸 아세테이트 탄화수소 추출 및 농도 측정 <ol><li> Alkanes은 6 ML 실험 용액에 2.5 ML 에틸 아세테이트 (apolar solvant)를 추가하여 수용액에서 추출됩니다. 내부 표준은 0.1 %의 농도 (V / V)에서 용매에 추가됩니다. 표준 (예 : cyclo-decan) 관심 봉우리의 예상 범위에 따라 다양. </li><li> 옵션 : 추가 튼수성 혼합물에 X-100과 적절한 이중 phasic 시스템을 위해 4,000 rpm에서 10 분 동안 샘플을 원심 분리기. </li><li> 소용돌이 두 단계 분리 될 때까지 5 초 (1,500 RPM)와 실온에서 배양을위한 혼합. </li><li> 유기 층 (상단)의 최대 양을 제거하고 무수 마그네슘 황산염을 사용하여 용매를 건조. </li><li> 여과 (0.2 μm)로 MgSO 4를 제거하고 -20 ° C.에있는 측정을위한 가스 크로마토 그래프 용 시험관에 여과, 또는 상점을 전송할 </li><li> CP-SIL 5CB 열 (길이 = 5m)를 사용하여 가스 크로마토 그래피에 의한 농도를 결정합니다. (1시 10분, 230 ° C) 분할 모드에서 샘플의 10 μl를 삽입. 1 ML / 분 (헬륨)에 열 가스의 흐름을 설정합니다. 다음 오븐 온도 프로그램이 사용됩니다 : <table border="1"><tbody><tr><td> 율 </td><td> 온도 [° C] </td><td> 시간 [분] </td></tr><tr><td> 0 </td><td> 50 </td><td> 7.5 </td></tr><tr><td> 50 </td><td> 90 </td><td> 1.0 </td></tr><tr><td> 50 </td><td> 110 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 130 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 145 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 160 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 170 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 185 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 210 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 250 </td><td> 2.0 </td></tr><tr><td> 50 </td><td> 320 </td><td> 2.0 </td></tr></tbody></table></li><li> 봉우리를 통합하고 내부 표준과 관련하여 농도를 수정합니다. </li></ol> 5. 알코올 / 알데히드 탈수소 효소 활동 분석 이 분석은 가토 외에 기술 된 방법에 따라 기본적으로 수행되었다.(2010). <ol><li> 문화 E. ADH (표현 대장균 세포 <a href="http://partsregistry.org/Part:BBa_K398018" target="_blank">BBa_K398018</a> ) 또는 ALDH ( <a href="http://partsregistry.org/Part:BBa_K398030" target="_blank">BBa_K398030</a> ) 유전자와 빈 벡터 (들고 세포 <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002을</a> 하루 아침에 적절한 항생제로 50 ML의 LB 매체에를). </li><li> 신선한 LB의 50 ML (항생제 포함)에 밤 문화를 500 μl를 전송하고 세포 탁도가 600 나노 미터에서 0.6의 광학 밀도에 도달 할 때까지 품다. </li><li> 4 ° C에서 4,000 rpm으로 10 분 원심 분리기 50 MM 트리스 버퍼의 5 ML에 펠렛을 resuspend. </li><li> 4 출력 제어 (sonication 동안 얼음에 솔루션을 유지)와 40 % 듀티 사이클에서 셀 솔루션을 Sonicate. </li><li> ° C는 세포 파편을 제거하기 위해 4에서 4,000 rpm으로 5 분의 결과 혼합물을 원심 분리기. </li><li> 로를 결정(: 단백질 바인딩을 방지하기 위해 유리관을 사용 주) 브래드 퍼드 분석하여 세포 추출물의 할거야, 단백질 농도. </li><li> 180 μl 57 MM 글리신 버퍼는 각 우물에 NAD를 (최종 농도 1 ㎜, 산도 9.5)이 포함 된과 96 잘 접시를로드합니다. </li><li> 우물에 테스트 할 수있는 알코올 (알데히드)의 5 μl를 추가합니다. 참고 : 액체를 가지고 할 수있는 분석의 시작 전에 열 긴 사슬 알코올. 각 주류 (알데히드) 기판없이 제어 (대조군) 추가해야합니다. 또한, 세포 추출물없이 버퍼와 기판의 혼합물을 포함하는 빈을 준비합니다. </li><li> 앞서 열을 가하다 37 번 15 분을위한 플레이트 리더 (Tecan 마젤란 v7.0)의 판 ° C 시스템의 평균을 허용 할 수 있습니다. </li><li> 세포 추출물의 충분한 양을 (브래드 포드 assays, 5 MG 단백질 / L​​의 최종 농도에 따라 달라집니다)를 추가합니다. 노 단백질 제어를 준비합니다. </li><li> 340 nm의 파장 37 번 1 시간마다 2-3 분 ° C. &lt;에서 분광 광도계를 사용하여 NADH 생산을 측정/ 리&gt; <li> OD (340 nm 정도)의 경사면에서 NADH 생산 속도를 계산할 수 있습니다. 계정으로 빛 경로 길이 6,220 M -1 cm -1의 NADH의 흡광 계수보십시오. 단백질의 총 양에 의해 NADH 생산 속도를 나눈다는 세포 추출물에서 탈수소 효소 반응 (U / MG 전체 세포 단백질)의 활동을 표현하는 추가되었습니다. 평균 세 독립 실행에서 표준 편차를 계산합니다. </li></ol> 6. pCaiF 특성 <ol><li> 문화 E. pCaiF-GFP 구조 (표현 대장균 세포 <a href="http://partsregistry.org/Part:BBa_K398331" target="_blank">BBa_K398331</a> )와 단둘이 발기인 (운반 세포 <a href="http://partsregistry.org/Part:BBa_K398326" target="_blank">BBa_K398326를</a> 적절한 항생제 박 5 ML의 LB 매체에 하룻밤 정도). </li><li> 5 ML M9는 밤 문화의 50 μl를 10g / L 포도당과 항생제를 포함하는 예방하고 하루 아침에 성장합니다. </li&gt; <li> 밤새 가지의 하위 문화 50 μl 신선한 M9 with10 g / L 및 배양의 5 ML에는 세포 탁도는 600 nm의에서 0.2의 광학 밀도에 도달 할 때까지. </li><li> 각 우물에 테스트 탄소 소스의 원하는 금액을 포함하는 새로운 M9 매체 100 μl와 96 잘 판을로드합니다. 통계 평가를위한 세중의 실험을 수행하고 각각의 부정적인 컨트롤을 (야생 형 대장균 K12)를 추가합니다. </li><li> 매체가 포함 된 우물에 밤 문화의 5 μl를 추가합니다. </li><li> 성장 곡선 (OD 600)와 플레이트 리더를 사용하여 GFP 형광 (485 나노 미터 여기와 520 방출) 37 18 시간마다 10 분 ° C 일정한 진동과를 측정합니다. </li><li> 성장 속도와 각각의 측정에서 특정 GFP 내용을 계산하고 컨트롤에 비교합니다. 평균 적어도 세 독립적 인 실험의 표준 편차를 계산합니다. </li></ol> 7. 공차 분석 <ol><li> 문화대장균은 PhPFDα와 β 유전자 (표현 <a href="http://partsregistry.org/Part:BBa_K398406" target="_blank">BBa_K398406를</a> 5 ML의 LB 매체와 적절한 항생제에 밤새). E.는 라다 유전자 (표현 대장균 <a href="http://partsregistry.org/Part:BBa_K398017" target="_blank">BBa_K398017가</a> ) 대조군으로 사용됩니다. </li><li> 신선한 5 LB의 ML (항생제) 및 배양에 밤새 가지의 하위 문화 10 μl의 세포 탁도는 600 nm의에서 0.4-0.3의 광학 밀도에 도달 할 때까지. </li><li> 이 0.1의 OD 600에 도달 할 때까지 새로운 매체 문화를 희석. </li><li> 적절한 항생제와 세중의에 독성 화합물 (예 : 0, 4, 8, N-헥산의 10 %)의 적절한 최종 농도를 포함하는 180 μl M9 매체와 96 잘 판을로드합니다. alkane - 물 혼합물은 2 단계 시스템으로 이어질 수 있기 때문에 (예 : D 번호판의 적절한 컨트롤을 가지고 필수적입니다ifferent 긴장하고 각각의 빈 실험). </li><li> 우물에 문화의 20 μl (제어)를 추가합니다. </li><li> 지속적인 진동과 판 독자에게 37에서 24 시간마다 10 분 ° C를 사용하여 바이오 매스 농도 (OD 600) 측정합니다. </li><li> 다른 에이전트 농도에 대한 각각의 측정에서 성장 속도를 계산하고 부정적인 컨트롤에 비교할 수 있습니다. 평균 적어도 세 독립 실행의 표준 편차를 계산합니다. </li></ol> 8. 상 동체 상호 작용 매핑 <ol><li> 이 응용 프로그램 HIM은 STRING 데이터베이스 (학술 사용하기 위해 무료) 20을 실행하는 PostgreSQL 서버에 단백질 쿼리를 수행하기 위해 개발되었습니다. homologue 상호 작용 매핑 응용 프로그램은 STRING 데이터베이스를 사용하여 원래의 호스트 유기체에서 상호 작용하는 단백질을 식별합니다. 각각의 상호 작용 유전자의 시퀀스는 대상 생물의 상동 유전자를 찾기 위해 BLAST 검색에 사용됩니다. Cytoscape 4 </s까지&gt;는 매핑의 결과를 시각화하는 데 사용됩니다. : HIM 소프트웨어 도구에서 다운로드 할 수 있습니다 <a href="https://github.com/jcnossen/InteractionHomologMapping" target="_blank">https://github.com/jcnossen/InteractionHomologMapping.</a> </li><li> 매핑을 수행하려면 (1) BioBrick의 ID를 입력하고 응용 프로그램은 자동으로 표준 생물학 부품 9, 또는 응용 프로그램의 (2)를 입력 (붙여 넣기) 시퀀스 데이터의 레지스트리에서 일부 순서 데이터를 다운로드합니다. </li><li> 입력 된 아미노산 서열에 대한 STRING 단백질 ID를 찾을 수 STRING 데이터베이스 웹 사이트를 사용합니다. </li><li> 높은 호몰 로지와 단백질은 BLAST를 사용하여 결정됩니다. 이후 응용 프로그램은 호스트 유기체의 homologs (예 : 대장균)의 소스 유기체와 검색에 각 알려진 상호 작용하는 단백질을 보여줍니다. </li><li> 텍스트 또는 Cytoscape에 결과 putative 상호 작용 목록을 내 보냅니다. </li></ol>

<ol>
	<li>Allen, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Process+water+treatment+in+Canada's+oil+sands+industry:+I:+Target+pollutants+and+treatment+objectives.">Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives.</a> J. Environ. Eng. Sci. 7, 123-138 (2008).</li><li>Alon, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> An Introduction to Systems Biology: Design Principles of Biological Circuits. , (2007).</li><li>Center, O. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Understanding Oil Spills and Oil Spill Response. , (1999).</li><li>Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+the+caiF+gene+encoding+a+potential+transcriptional+activator+of+carnitine+metabolism+in+Escherichia+coli.">Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli.</a> J. Bacteriol. 178, 1248-1257 (1995).</li><li>Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+and+proteome+of+long-chain+alkane+degrading+Geobacillus+thermodenitrificans+NG80-2+isolated+from+a+deep-subsurface+oil+reservoir.">Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir.</a> Proc. Natl. Acad. Sci. U.S.A. 104 (13), 5602-5607 (2007).</li><li>Fujii, T., Narikawa, T., Takeda, K., Kato, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotransformation+of+various+alkanes+using+the+Escherichia+coli+expressing+an+alkane+hydroxylase+system+from+Gordonia+sp.+TF6.">Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6.</a> Biosci. Biotechnol. Biochem. 68 (10), 2171-2177 (2004).</li><li>Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cloning+of+an+alcohol+dehydrogenase+from+thermophilic+alkane-degrading+Bacillus+thermoleovorans+B23.">cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23.</a> J. Biosci. Bioeng. 91 (1), 100-102 (2001).</li><li>Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+cloning+and+characterization+of+an+aldehyde+dehydrogenase+from+long-chain+alkane-degrading+Geobacillus+thermoleovorans+B23.">Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23.</a> Extremophiles. 14, 33-39 (2010).</li><li>Kieboom, J., De Bont, J. a. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Bacterial Stress Responses. , (2000).</li><li>Kotte, O., Zaugg, J. B., Heinemann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+adaptation+through+distributed+sensing+of+metabolic+fluxes.">Bacterial adaptation through distributed sensing of metabolic fluxes.</a> Mol Syst Biol. 6, 355 (2010).</li><li>Kremling, A., Bettenbrock, K., Gilles, E. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+global+control+of+Escherichia+coli+carbohydrate+uptake.">Analysis of global control of Escherichia coli carbohydrate uptake.</a> BMC Syst. Biol. 1, (2007).</li><li>Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+long-chain+alkane+monooxygenase+(LadA)+in+complex+with+coenzyme+FMN:+unveiling+the+long-chain+alkane+hydroxylase.">Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase.</a> J. Mol. Biol. 376 (2), 453-465 (2008).</li><li>Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+the+maximum+specific+uptake+capacities+for+glucose+and+oxygen+in+glucose-limited+fed-batch+cultivations+of+Escherichia+coli.">Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli.</a> Biotechnol. Bioeng. 73 (5), 347-357 (2001).</li><li>Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overexpression+of+prefoldin+from+the+hyperthermophilic+archaeum+Pyrococcus+horikoshii+OT3+endowed+Escherichia+coli+with+organic+solvent+tolerance.">Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance.</a> Appl. Microbiol. Biotechnol. 79 (3), 443-449 (2008).</li><li>Rehm, H. J., Reiff, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+and+occurrence+of+microbial+oxidation+of+long-chain+alkanes.">Mechanisms and occurrence of microbial oxidation of long-chain alkanes.</a> Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).</li><li>Rojo, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Degradation+of+alkanes+by+bacteria.">Degradation of alkanes by bacteria.</a> Environ. Microbiol. 11 (10), 2477-2490 (2009).</li><li>Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Pseudomonas+putida+alkane-degradation+gene+clusters+and+flanking+insertion+sequences:+evolution+and+regulation+of+the+alk+genes.">Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes.</a> Microbiology. 147, 1621-1630 (2001).</li><li>Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+a+novel+thermophilic+Bacillus+strain+degrading+long-chain+n-alkanes.">Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes.</a> Extremophiles. 10 (4), 347-356 (2006).</li></ol>

관심 없음 충돌이 선언 없습니다.

BioBrick의 원리는 alkanes의 저하에 대한 섀시를 만드는 데 사용되며 툴킷의 단일 구성 요소에 대한 원칙의 증명 얻은 것입니다. 여러 assays는 생체과 alkane 굴욕 경로의 효소의 체외 활동에 측정하기 위해 제안합니다. 제시 작업은 성공적으로 호스트 유기체 E.의 효소 활동과 표현을 결정하는 데 사용할 수있는 방법의 수를 보여줍니다 적절한 BioBricks를 구현 한 후 대장균. 또...

Oil pollution is among the most serious causes of environmental contamination, and greatly affects ecosystems, businesses and communities 3. Solutions are for example required to battle the continuous oil pollution originating from the oil sands tailing waters in Alberta, Canada. During the process of oil extraction from oil sands, bitumen, a semi-solid oxidized form of oil, is removed using thermal recovery techniques that consume about 3.1 barrels of water per single barrel of oil 1. Oil contaminated process water, mainly originating from a local river, is stored in tailing ponds after bitumen extraction. A more effective recycling of process water in order to reduce the need for freshwater uptake is needed. To facilitate the bitumen extraction and to ensure that downstream sites meet water quality guidelines for the protection of aquatic ecosystems, process water treatments are rapidly evolving 3.
To treat pollution of organic compounds, bioremediation technologies employing microorganisms are presently encouraged 1. Alkanes are the most abundant family of hydrocarbons in crude oil, containing 5 to 40 carbon atoms per molecule 7, 21. Many bacteria are known to degrade alkanes of various lengths via sequential oxidation of the terminal methyl group forming first alcohols, then aldehydes and finally fatty acids 8. Within this iGEM project several enzymes from different organisms were expressed and characterized, and made available via the BioBrick standard and Registry of Standard Biological Parts.
The well-studied alkane hydroxylase system of Gordonia sp. TF6 facilitates the initial oxidation step of C5-C13 alkanes along with that of C5-C8 cycloalkanes using a minimum of four components: alkB2 (alkane 1-monooxygenase), rubA3, rubA4 (two rubredoxins) and RubB (rubredoxin reductase) 8, 21. Oxidation of long-chain alkanes (ranging from C15 up to C36) is reported to be performed by ladA, a flavoprotein alkane monooxygenase from Geobacillus thermodinitrificans NG-80-2 7, 15, 18, 22. LadA forms a catalytic complex with flavin mononucleotide (FMN) that utilizes atomic oxygen for oxidation. This results in the conversion of alkanes into the corresponding primary alkanol. The alcohols are further oxidized by alcohol and aldehyde dehydrogenases to fatty acids, which readily enter the &beta;-oxidation pathway 7, 21. A zinc-independent alcohol dehydrogenase from the thermophillic bacterium Geobacillus thermoleovorans B23 oxidizes medium-chain alkanols into their respective alkanals, using NAD+ as a cofactor 10. Aldehyde dehydrogenase from the same bacterium is able to catalyze the NAD+-dependent final step in the medium-chain oxidation 11.
In order to reduce induction costs and to maintain optimal proliferation of the bacterial system, the promoter pCaiF from E.coli was characterized. This promoter can regulate expression of the hydrocarbon degradation pathway components, and is regulated by cAMP-Crp levels, which in turn depend on glucose levels 6. At high extracellular glucose concentrations in the environment the cellular cAMP (cyclic Adenosine Mononucleotide Phosphate) level was low through the inhibition of adenylyl cyclase as a side effect of PTS mediated glucose transport. Conversely, during limitation (low glucose concentrations) the cAMP level increased and Crp bound to cAMP forming the complex, cAMP-Crp, which bound pCaiF and activated transcription of the downstream components 6, 14.
Wildtype E. coli can only tolerate moderate concentrations of hydrocarbons. To complete the toolkit, tolerance to hydrocarbons had to be addressed. Several organic solvent-tolerant bacteria are known to survive in water-solvent two-phase systems 12. Molecular components known to increase tolerance are chaperones that facilitate the correct folding of proteins. The prefoldin system from Pyrococcus horikoshii OT3, consisting of the proteins phPFD&alpha; and phPFD&beta;, was shown to increase hydrocarbon-tolerance 17.
The alkane conversion toolkit was constructed following the BioBrick principle, which is documented at the Registry of Standard Biological Parts 9. BioBricks are plasmids containing a specific functional insert that is flanked by 4 predefined restriction sites. The BioBrick inserts can be extended flexibly, allowing the construction of biological systems with new functions.

<table border="1">
	<tbody>
		<tr>
			<td>Name of the reagent</td>
			<td>Company</td>
			<td>Catalogue number</td>
			<td>Comments (optional)</td>
		</tr>
		<tr>
			<td>E. coli K12</td>
			<td>New England Biolabs</td>
			<td>C2523H</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Octane</td>
			<td>Fluka</td>
			<td>74822</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Hexadecane</td>
			<td>Fluka</td>
			<td>52209</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>octanol-1</td>
			<td>Fluka</td>
			<td>95446</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>dodecanol-1</td>
			<td>Sigma-Aldrich</td>
			<td>126799</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Hexane</td>
			<td>Sigma-Aldrich</td>
			<td>296090</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>NADH</td>
			<td>Sigma</td>
			<td>N4505</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>FMN</td>
			<td>Sigma</td>
			<td>F2253</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>J.T. Baker Casno</td>
			<td>7487 889</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T8787</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>T4 ligase</td>
			<td>New England Biolabs</td>
			<td>M0202L</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Gas chromatograph</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Cell disrupter</td>
			<td>LA Biosystems</td>
			<td>CD-019</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Amersham pharmacia</td>
			<td>spec 2000</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Plate reader</td>
			<td>Tecan</td>
			<td>Magellan v7.0</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>Innova, 44</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>BioBrick K398014: 
			BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_K398014</a></td>
			<td>Alkane Hydroxylase System 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398027: BBa_R0040-BBa_B0034-ladA</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398027" target="_blank">BBa_K398027</a></td>
			<td>ladA Protein Generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398018: BBa_J23100-BBa_J61101-ADH</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398018" target="_blank">BBa_K398018</a></td>
			<td>ADH generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398030: BBa_R0040-BBa_B0034-ALDH</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398030" target="_blank">BBa_K398030</a></td>
			<td>ALDH generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398326: pCaiF</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398326" target="_blank">BBa_K398326</a></td>
			<td>pCaiF promoter 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398331: pCaiF-BBa_B0032-BBa_I13401</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398331" target="_blank">BBa_K398331</a></td>
			<td>pCaiF measurement device 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398406: BBa_J23002-BBa_J61107-phPFD&alpha;-BBa_J61107-</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398406" target="_blank">BBa_K398406</a></td>
			<td>Solvent tolerance cluster 
			Resistance: Chloramphenicol</td>
		</tr>
	</tbody>
</table>

a toolkit to enable hydrocarbon conversion in aqueous environments

이 작품은 앞으로 대장균에 의해 alkanes의 전환을 가능하게하고 적용의 원리의 증명을 제시하는 툴킷를 게재 할 수 있습니다. 툴킷은 여러 표준 교환 부품 (BioBricks) 9 alkanes의 전환, 독성 탄화수소 풍부한 환경에서의 유전자 발현과 생존의 규정을 해결로 구성되어 있습니다. alkane 저하에 대해 3 단계 경로는 E.에 구현 된 각 alkanols, alkanals 궁극적으로 alkanoic - 산에 중간과 긴 체인 alkanes의 전환을 활성화 대장균. 후자는 기본 β-산화 경로를 통해 대사되었다. 중간 체인 alkanes (C5-C13)와 cycloalkanes (C5-C8), Gordonia SP에서 alkane hydroxylase 시스템 네 가지 유전자 (alkB2, rubA3, rubA4 및 rubB)의 산화를 촉진합니다. TF6 8,21는 E.로 변환 된 대장균. 의 전환에 대한장쇄 alkanes (C15-C36)는 Geobacillus thermodenitrificans에서 라다 유전자가 구현되었습니다. 열화 과정에 필요한 자세한 단계를 들어, ADH 및 ALDH은 (G. thermodenitrificans에서 발생) 10,11을 도입했다. 활동은 휴식 세포 assays에 의해 측정되었다. 각 산화 단계에 효소 활동이 관찰되었다. 프로세스 효율을 최적화하려면, 그 표현은 낮은 포도당 조건에서 유도되었습니다 기판 - 규제 발기인, pCaiF가 사용되었습니다. pCaiF는 E.에 존재 대장균 K12 및 비 포도당 탄소 소스의 저하에 관련된 유전자의 표현을 규제하고있다. 툴킷의 마지막 부분 - 생존을 대상으로는 - PhPFDα와 β 용매 내성 유전자, Pyrococcus horikoshii OT3에서 모두를 사용하여 구현되었습니다. 유기 용제에 부정적인 affectin에 의해 세포 스트레스를 유발하고 survivability을 감소 할 수 있습니다g 단백질 폴딩. 보호자로서 PhPFDα와 β는 alkanes의 존재에 따라 단백질 접힘 과정 등을 향상시킵니다. 문화 매체에서 10 % N-헥산의 presences의 증가 성장 속도 (최대 50 %)로 표시 개선 탄화수소 허용으로 이어이 유전자의 표현이 관찰되었다. 요약, 결과는 툴킷은 E. 수있게 된 것을 나타냅니다 수성 환경에서 탄화수소를 변환하고 관대 할 수 대장균. 따라서, 그것은 합성 생물학 접근 방식을 사용하여 오일 개선을위한 지속 가능한 솔루션에 대한 초기 단계를 나타냅니다.

Alkane conversion
The activity of the three oxidation steps from the alkane to the respective fatty acid was evaluated using resting cell assays and enzyme activity measurements. The results are presented following the pathway reactions (1) alkane hydroxylase, (2) alcohol dehydrogenase and (3) aldehyde dehydrogenase. 
For the first step, different plasmids were constructed for medium and long-chain alkanes. The plasmid <a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_...

Watch this Scientific Journal Video about A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments at JoVE.com

A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments | Bioengineering | Video

A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

오일 오염의 개선을 위해 박테리아 시스템을 규제 지속 가능한 자동차는 표준 호환 DNA 부품 (BioBricks)를 사용하여 설계되었습니다. 엔지니어링<em&gt; E. 대장균</em&gt; 변형은 독성 수성 환경에서 β-산화를 통해 alkanes을 저하하는 데 사용되었다. 종에서 각각의 효소는 alkane 저하 활동을 보여 주었다. 에 또한 증가 허용<em&gt; N</em&gt; - 헥산은 alkane에 강한 박테리아 유전자를 도입하여 달성되었다.

수성 환경에서 탄화수소 전환을 사용하는 툴킷

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The ...

a-toolkit-to-enable-hydrocarbon-conversion-in-aqueous-environments

Education

Research

JoVE Core

JoVE Journal

Organic Chemistry

Biology

Bioengineering

Ecology

Unit 1

Ecosystems

Alkanes and Cycloalkanes

SCIENTISTS IN ACTION

14.0K 조회수.  Delft University of Technology. 오일 오염의 개선을 위해 박테리아 시스템을 규제 지속 가능한 자동차는 표준 호환 DNA 부품 (BioBricks)를 사용하여 설계되었습니다. 엔지니어링 E. 대장균 변형은 독성 수성 환경에서 β-산화를 통해 alkanes을 저하하는 데 사용되었다. 종에서 각각의 효소는 alkane 저하 활동을 보여 주었다. 에 또한 증가 허용 N - 헥산은 alkane에 강한 박테리아 ?...

비디오: A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

Creating Two-Dimensional Patterned Substrates for Protein and Cell Confinement

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1 While microcontact printing can be employed to directly print a large number of molecules, including proteins,2 DNA,3 and silanes,4 the formation of self-assembled monolayers (SAMs) from long chain alkane thiols on gold provides a simple way to confine proteins and cells to specific patterns containing adhesive and resistant regions. This confinement can be used to control cell morphology and is useful for examining a variety of questions in protein and cell biology. Here, we describe a general method for the creation of well-defined protein patterns for cellular studies.5 This process involves three steps: the production of a patterned master using photolithography, the creation of a PDMS stamp, and microcontact printing of a gold-coated substrate. Once patterned, these cell culture substrates are capable of confining proteins and/or cells (primary cells or cell lines) to the pattern.
The use of self-assembled monolayer chemistry allows for precise control over the patterned protein/cell adhesive regions and non-adhesive regions; this cannot be achieved using direct protein stamping. Hexadecanethiol, the long chain alkane thiol used in the microcontact printing step, produces a hydrophobic surface that readily adsorbs protein from solution. The glycol-terminated thiol, used for backfilling the non-printed regions of the substrate, creates a monolayer that is resistant to protein adsorption and therefore cell growth.6 These thiol monomers produce highly structured monolayers that precisely define regions of the substrate that can support protein adsorption and cell growth. As a result, these substrates are useful for a wide variety of applications from the study of intercellular behavior7 to the creation of microelectronics.8
While other types of monolayer chemistry have been used for cell culture studies, including work from our group using trichlorosilanes to create patterns directly on glass substrates,9 patterned monolayers formed from alkane thiols on gold are straight-forward to prepare. Moreover, the monomers used for monolayer preparation are commercially available, stable, and do not require storage or handling under inert atmosphere. Patterned substrates prepared from alkane thiols can also be recycled and reused several times, maintaining cell confinement.10

Self-assembled monolayers (SAMs) formed from long chain alkane thiols on gold provide well-defined substrates for the formation of protein patterns and cell confinement. Microcontact printing of hexadecanethiol using a polydimethylsiloxane (PDMS) stamp followed by backfilling with a glycol-terminated alkane thiol monomer produces a pattern where protein and cells adsorb only to the stamped hexadecanethiol region.

단백질과 세포 교도소에 대한 2 차원 문양의 기판 만들기

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1  While microcontact printing ...

연구

생체공학

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic valve leaflets are composed of interstitial cells suspended within an extracellular matrix (ECM) and are lined with an endothelial cell monolayer. The valve withstands a harsh, dynamic environment and is constantly exposed to shear, flexion, tension, and compression. Research has shown calcific lesions in diseased valves occur in areas of high mechanical stress as a result of endothelial disruption or interstitial matrix damage1-3. Hence, it is not surprising that epidemiological studies have shown high blood pressure to be a leading risk factor in the onset of aortic valve disease4. 
The only treatment option currently available for valve disease is surgical replacement of the diseased valve with a bioprosthetic or mechanical valve5. Improved understanding of valve biology in response to physical stresses would help elucidate the mechanisms of valve pathogenesis. In turn, this could help in the development of non-invasive therapies such as pharmaceutical intervention or prevention. Several bioreactors have been previously developed to study the mechanobiology of native or engineered heart valves6-9. Pulsatile bioreactors have also been developed to study a range of tissues including cartilage10, bone11 and bladder12. The aim of this work was to develop a cyclic pressure system that could be used to elucidate the biological response of aortic valve leaflets to increased pressure loads. 
The system consisted of an acrylic chamber in which to place samples and produce cyclic pressure, viton diaphragm solenoid valves to control the timing of the pressure cycle, and a computer to control electrical devices. The pressure was monitored using a pressure transducer, and the signal was conditioned using a load cell conditioner. A LabVIEW program regulated the pressure using an analog device to pump compressed air into the system at the appropriate rate. The system mimicked the dynamic transvalvular pressure levels associated with the aortic valve; a saw tooth wave produced a gradual increase in pressure, typical of the transvalvular pressure gradient that is present across the valve during diastole, followed by a sharp pressure drop depicting valve opening in systole. The LabVIEW program allowed users to control the magnitude and frequency of cyclic pressure. The system was able to subject tissue samples to physiological and pathological pressure conditions. This device can be used to increase our understanding of how heart valves respond to changes in the local mechanical environment.

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

A cyclic pressure bioreactor capable of subjecting heart valve tissue to physiological and pathological pressure conditions has been designed. A LabVIEW program allows users to control pressure magnitude, amplitude and frequency. This device can be used to study the mechanobiology of heart valve tissue or isolated cells.

의 순환 압력 생물 반응기 설계 예 VIVO</em대동맥 심장 밸브> 학습

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic ...

Electric Field-controlled Directed Migration of Neural Progenitor Cells in 2D and 3D Environments

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the central nervous system1,2. These endogenous EFs are generated by cellular regulation of ionic transport combined with the electrical resistance of cells and tissues. It has been reported that applied EF treatment can promote functional repair of spinal cord injuries in animals and humans3,4. In particular, EF-directed cell migration has been demonstrated in a wide variety of cell types5,6, including neural progenitor cells (NPCs)7,8. Application of direct current (DC) EFs is not a commonly available technique in most laboratories. We have described detailed protocols for the application of DC EFs to cell and tissue cultures previously5,11. Here we present a video demonstration of standard methods based on a calculated field strength to set up 2D and 3D environments for NPCs, and to investigate cellular responses to EF stimulation in both single cell growth conditions in 2D, and the organotypic spinal cord slice in 3D. The spinal cordslice is an ideal recipient tissue for studying NPC ex vivo behaviours, post-transplantation, because the cytoarchitectonic tissue organization is well preserved within these cultures9,10. Additionally, this ex vivo model also allows procedures that are not technically feasible to track cells in vivo using time-lapse recording at the single cell level. It is critically essential to evaluate cell behaviours in not only a 2D environment, but also in a 3D organotypic condition which mimicks the in vivo environment. This system will allow high-resolution imaging using cover glass-based dishes in tissue or organ culture with 3D tracking of single cell migration in vitro and ex vivo and can be an intermediate step before moving onto in vivo paradigms.

This protocol demonstrates methods used to establish 2D and 3D environments in custom-designed electrotactic chambers, which can track cells in vivo/ex vivo using time-lapse recording at the single cell level, in order to investigate galvanotaxis/electrotaxis and other cellular responses to direct current (DC) electric fields (EFs).

2D 및 3D 환경에서 신경 전구 세포의 전기장 제어 감독 마이 그 레이션

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the ...

Cell Co-culture Patterning Using Aqueous Two-phase Systems

Cell patterning technologies that are fast, easy to use and affordable will be required for the future development of high throughput cell assays, platforms for studying cell-cell interactions and tissue engineered systems. This detailed protocol describes a method for generating co-cultures of cells using biocompatible solutions of dextran (DEX) and polyethylene glycol (PEG) that phase-separate when combined above threshold concentrations. Cells can be patterned in a variety of configurations using this method. Cell exclusion patterning can be performed by printing droplets of DEX on a substrate and covering them with a solution of PEG containing cells. The interfacial tension formed between the two polymer solutions causes cells to fall around the outside of the DEX droplet and form a circular clearing that can be used for migration assays. Cell islands can be patterned by dispensing a cell-rich DEX phase into a PEG solution or by covering the DEX droplet with a solution of PEG. Co-cultures can be formed directly by combining cell exclusion with DEX island patterning. These methods are compatible with a variety of liquid handling approaches, including manual micropipetting, and can be used with virtually any adherent cell type.

Aqueous two-phase systems were used to simultaneously pattern multiple populations of cells. This fast and easy method for cell patterning takes advantage of the phase separation of aqueous solutions of dextran and polyethylene glycol and the interfacial tension that exists between the two polymer solutions.

수성 2 단계 시스템을 사용하여 셀 공동 문화 패턴

Cell patterning  technologies that are fast, easy to use and affordable will be required for the  future development of high throughput cell assays, ...

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to intrinsic parameters within the process allow a high degree of control over scaffold characteristics including fiber diameter, alignment and porosity. By developing scaffolds with similar dimensions and topographies to organ- or tissue-specific extracellular matrices (ECM), micro-environments representative to those that cells are exposed to in situ can be created. 
The airway bronchiole wall, comprised of three main micro-environments, was selected as a model tissue. Using decellularized airway ECM as a guide, we electrospun the non-degradable polymer, polyethylene terephthalate (PET), by three different protocols to produce three individual electrospun scaffolds optimized for epithelial, fibroblast or smooth muscle cell-culture. Using a commercially available bioreactor system, we stably co-cultured the three cell-types to provide an in vitro model of the airway wall over an extended time period.
This model highlights the potential for such methods being employed in in vitro diagnostic studies investigating important inter-cellular cross-talk mechanisms or assessing novel pharmaceutical targets, by providing a relevant platform to allow the culture of fully differentiated adult cells within 3D, tissue-specific environments.

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Advancements in biomaterial technologies enable the development of three-dimensional multi-cell-type constructs. We have developed electrospinning protocols to produce three individual scaffolds to culture the main structural cells of the airway to provide a 3D in vitro model of the airway bronchiole wall.

전기 방사를 적응하는 것은 트라이 계층에 대한 세 가지 독특한 환경을 제공하기 위해<em&gt; 체외</em&gt;기도 벽의 모델

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to ...

Photopatterning Proteins and Cells in Aqueous Environment Using TiO2 Photocatalysis

Organic contaminants adsorbed on the surface of titanium dioxide (TiO2) can be decomposed by photocatalysis under ultraviolet (UV) light. Here we describe a novel protocol employing the TiO2 photocatalysis to locally alter cell affinity of the substrate surface. For this experiment, a thin TiO2 film was sputter-coated on a glass coverslip, and the TiO2 surface was subsequently modified with an organosilane monolayer derived from octadecyltrichlorosilane (OTS), which inhibits cell adhesion. The sample was immersed in a cell culture medium, and focused UV light was irradiated to an octagonal region. When a neuronal cell line PC12 cells were plated on the sample, cells adhered only on the UV-irradiated area. We further show that this surface modification can also be performed in situ, i.e., even when cells are growing on the substrate. Proper modification of the surface required an extracellular matrix protein collagen to be present in the medium at the time of UV irradiation. The technique presented here can potentially be employed in patterning multiple cell types for constructing coculture systems or to arbitrarily manipulate cells under culture.

Photopatterning Proteins and Cells in Aqueous Environment Using TiO2 Photocatalysis

We describe a protocol for modifying cell affinity of a scaffold surface in aqueous environment. The method takes advantage of titanium dioxide photocatalysis to decompose organic film in the photo-irradiated region. We show that it can be used to create microdomains of scaffolding proteins, both ex situ and in situ.

산화 티타늄을 사용하여 수성 환경에서 단백질과 세포를 포토 패터닝<sub&gt; 2</sub&gt; 광촉매

Organic contaminants adsorbed on the surface of titanium dioxide (TiO2) can be decomposed by photocatalysis under ultraviolet (UV) light. Here we describe ...

Aqueous Droplets Used as Enzymatic Microreactors and Their Electromagnetic Actuation

For the successful implementation of microfluidic reaction systems, such as PCR and electrophoresis, the movement of small liquid volumes is essential. In conventional lab-on-a-chip-platforms, solvents and samples are passed through defined microfluidic channels with complex flow control installations. The droplet actuation platform presented here is a promising alternative. With it, it is possible to move a liquid drop (microreactor) on a planar surface of a reaction platform (lab-in-a-drop). The actuation of microreactors on the hydrophobic surface of the platform is based on the use of magnetic forces acting on the outer shell of the liquid drops which is made of a thin layer of superhydrophobic magnetite particles. The hydrophobic surface of the platform is needed to avoid any contact between the liquid core and the surface to allow a smooth movement of the microreactor. On the platform, one or more microreactors with volumes of 10 &#181;L can be positioned and moved simultaneously. The platform itself consists of a 3 x 3 matrix of electrical double coils which accommodate either neodymium or iron cores. The magnetic field gradients are automatically controlled. By variation of the magnetic field gradients, the microreactors' magnetic hydrophobic shell can be manipulated automatically to move the microreactor or open the shell reversibly. Reactions of substrates and corresponding enzymes can be initiated by merging the microreactors or bringing them into contact with surface immobilized catalysts.

Lab-in-a-drop reaction systems allow the versatile implementation of complex reactions in a microfluidic scale. An automated actuation platform consisting of a 3 x 3 matrix of electromagnetic coils was developed and successfully used to merge two 10 &#181;L microreactors and thereby initiate an enzymatic reaction in the resulting liquid marbles.

효소 Microreactors 및 그들의 전자기 작동기로 사용 하는 수성 방울

For the successful implementation of microfluidic reaction systems, such as PCR and electrophoresis, the movement of small liquid volumes is essential. In ...

Characterizing Cell Migration Within Three-dimensional In Vitro Wound Environments

Currently, most in vitro models of wound healing, such as well-established scratch assays, involve studying cell migration and wound closure on two-dimensional surfaces. However, the physiological environment in which in vivo wound healing takes place is three-dimensional rather than two-dimensional. It is becoming increasingly clear that cell behavior differs greatly in two-dimensional vs. three-dimensional environments; therefore, there is a need for more physiologically relevant in vitro models for studying cell migration behaviors in wound closure. The method described herein allows for the study of cell migration in a three-dimensional model that better reflects physiological conditions than previously established two-dimensional scratch assays. The purpose of this model is to evaluate cell outgrowth via the examination of cell migration away from a spheroid body embedded within a fibrin matrix in the presence of pro- or anti-migratory factors. Using this method, cell outgrowth from the spheroid body in a three-dimensional matrix can be observed and is easily quantifiable over time via brightfield microscopy and analysis of spheroid body area. The effect of pro-migratory and/or inhibitory factors on cell migration can also be evaluated in this system. This method provides researchers with a simple method of analyzing cell migration in three-dimensional wound associated matrices in vitro, thus increasing the relevance of in vitro cell studies prior to the use of in vivo animal models.

Characterizing Cell Migration Within Three-dimensional In Vitro Wound Environments

The goal of this protocol is to evaluate the effect of pro- and anti-migratory factors on cell migration within a three-dimensional fibrin matrix.

환경 상처 3 차원 생체 외에서 내 셀 마이그레이션 특성화

Currently, most in vitro models of wound healing, such as well-established scratch assays, involve studying cell migration and wound closure on ...

Protocol for MicroRNA Transfer into Adult Bone Marrow-derived Hematopoietic Stem Cells to Enable Cell Engineering Combined with Magnetic Targeting

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates after injection into injured tissues as well as the observed massive cell death rates lead to very restricted therapeutic effects. To overcome these limitations, we sought to establish a non-viral based protocol for suitable cell engineering prior to their administration. The modification of human CD133+ expressing SCs using microRNA (miR) loaded magnetic polyplexes was addressed with respect to uptake efficiency and safety as well as the targeting potential of the cells. Relying on our protocol, we can achieve high miR uptake rates of 80&#8211;90% while the CD133+ stem cell properties remain unaffected. Moreover, these modified cells offer the option of magnetic targeting. We describe here a safe and highly efficient procedure for the modification of CD133+ SCs. We expect this approach to provide a standard technology for optimization of therapeutic stem cell effects and for monitoring of the administered cell product via magnetic resonance imaging (MRI).

This protocol illustrates a safe and efficient procedure to modify CD133+ hematopoietic stem cells. The presented non-viral, magnetic polyplex-based approach may provide a basis for the optimization of therapeutic stem cell effects as well as for monitoring the administered cell product via magnetic resonance imaging.

성인 골 수 유래 조 혈 줄기 세포로 세포 공학 자기 대상으로 함께 있도록 예측에 관한 전송을 위한 프로토콜

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates ...

Material Formation of Recombinant Spider Silks through Aqueous Solvation using Heat and Pressure

Many spiders produce seven types of silks. Six of the silks are fiber in form when produced by the spiders. These fibers are not water soluble. In order to reproduce the remarkable mechanical properties of spider silks, they must be produced in heterologous hosts as spiders are both territorial and cannibalistic. The synthetic analogs of spider silk also tend to be insoluble in aqueous solutions. Thus, a large percentage of research in recombinant spider silks rely upon organic solvents that are detrimental to large scale production of materials. Our group&#8217;s method forces the solvation of these recombinant spider silks into water. Remarkably, when these proteins are prepared using this method of heat and pressure, a wide range of material forms can be prepared from the same solution of recombinant spider silk proteins (rSSp) including: films, fibers, sponge, hydrogel, lyogel, and adhesives. This article demonstrates the production of the solvated rSSp and material forms in a manner that is more easily understood than from written materials and methods alone.

Here, we present a protocol to produce water soluble recombinant spider silk protein solutions and the material forms that can be formed from those solutions.

열과 압력을 이용한 수성 용 매 화를 통한 재조합 거미 실크의 재료 형성

Many spiders produce seven types of silks. Six of the silks are fiber in form when produced by the spiders. These fibers are not water soluble. In order ...