Los experimentos realizados en este video-artículo fueron desarrollados para la competición internacional Genetically Engineered Machine 9. Los autores desean agradecer a los miembros del equipo iGEM Lucas Bergwerff, Pieter van TM Boheemen, Cnossen Jelmer, Hugo F. Cueto Rojas y Ramón van der Valk para la asistencia en la investigación. Agradecemos Han de Winde, Stefan de Kok y Yıldırım Esengul útil para los debates y hosting esta investigación. Este trabajo fue apoyado por la TU Delft University Departamento de Biotecnología, el Laboratorio de Bioinformática Delft, TU Delft Departamento de Bionanoscience, Oil Sands Leadership Initiative (OSLI), Stud studentenuitzendbureau, la Iniciativa de Países Bajos Genómica, Centro Kluyver, Nederlandse Vereniging Biotechnologische (Stichting Biotecnología Nederland) , DSM, Geneart, Greiner Bio-One y Genencor.

1. BioBrick Asamblea <ol><li> BioBricks del Registro de partes biológicas estándar son proporcionados por la sede iGEM. Para construir un nuevo BioBrick de BioBricks existentes, digerir el donante BioBrick (hasta 1,0 g) con las enzimas EcoRI y SpeI para el posicionamiento de las partes aguas abajo de los donantes de la parte aceptor. Se digiere con XbaI y PstI para posicionar la parte donante aguas arriba de la parte aceptor. Añadir una tercera enzima de restricción apropiada que corta en la columna vertebral de la donante. Realizar las digestiones en un volumen total de 20-25 ml con el tampón apropiado, de acuerdo con el proveedor (concentración final 1x). Usar 5 unidades / g de ADN para las enzimas de restricción. </li><li> Se digiere el aceptor BioBrick ya sea con EcoRI y XbaI o SpeI y PstI. </li><li> Incubar las digestiones para (al menos) una hora a 37 ° C. Inactivar las endonucleasas de restricción por el calor, la incubación a 80 ° C durante 10 min y se centrifuga en breve. </li><li> Se liga el BioBrick digeridopartes (donante y aceptor) juntos. Dado que XbaI y SpeI generar extremos compatibles de ADN, un sitio mixto se crea que no se puede cortar con cualquier enzima de restricción que resulta en una nueva &quot;combinado&quot; que BioBrick flanqueado por los sitios de restricción estándar 4. En la mezcla de ligación a la concentración final de ADN es preferiblemente ~ 100 ng / l. Realizar la reacción de ligación en un volumen total de 10-15 ml con el tampón de ligación T4 (concentración final 1x) y la T4 ligasa (1 unidad / g de ADN). </li><li> Incubar la mezcla de ligación a 16 ° C durante al menos 3 h. </li><li> Realizar reacción de transformación con medio circa de la mezcla de ligadura. </li><li> Confirme la BioBrick ser correcta con la secuenciación. </li><li> Para construir un nuevo BioBrick de ADN sintetizado, modificar los genes para la síntesis para la expresión óptima en E. coli por medio de la herramienta de la página web JCat ( <a href="http://www.jcat.de/" target="_blank">http://www.jcat.de/</a> ). Realizar modificaciones adicionales de acuerdo con los requisitos de la B<html> ioBrick estándar. Esta normalización implica que cada BioBrick se compone de una secuencia de ADN de interés precedido por un prefijo y seguido de un sufijo. El prefijo y el sufijo son secuencias que contienen sitios de restricción predefinidos, que están ausentes en la secuencia del plásmido restante. Estos sitios de restricción estándar hacen posible el intercambio y extender los insertos BioBrick flexible 9. El prefijo y sufijo tienen las siguientes secuencias: </li></ol><table border="1"><tbody><tr><td> Nombre </td><td> Secuencia </td><td> Comentario </td></tr><tr><td> Prefijo </td><td> 5 &#39;GAATTCGCGGCCGCTTCTAG3&#39; </td><td></td></tr><tr><td></td><td> 5 &#39;GAATTCGCGGCCGCTTCTAGAG 3&#39; </td><td> Si la siguiente parte es una secuencia de codificación o cualquier parte que comienza con &quot;ATG&quot; </td></tr><tr><td> Sufijo </td><td> 5 &#39;TACTAGTAGCGGCCGCTGCAG 3&#39; </td><td></td></tr></tbody></table>ove_title &quot;&gt; 2. Alkane Análisis de Conversión célula en reposo, En Vivo Este ensayo se realizó según el método descrito por Fujii et al. (2004). <ol><li> Cultura E. células de E. coli que expresan el sistema hidroxilasa alcano ( <a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_K398014</a> ) y las que contienen un vector vacío ( <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> ) en 5 ml de medio LB con los antibióticos apropiados durante la noche. </li><li> Transferir 500 l de cultivo de una noche en 50 ml de LB fresco (con antibióticos) y se incuba hasta que la turbidez celular alcanzó una DO (densidad óptica) de 0,3 a 600 nm. </li><li> Centrifugar durante 10 min a 4.000 rpm y resuspender el sedimento en 5 ml de tampón fosfato 0,1 M (pH 7,4). </li><li> Se centrifuga de nuevo durante 10 min a 4.000 rpm y resuspender el sedimento en 5 ml de tampón de fosfato 0,1 M que contiene ahora sales E2 y 0,66% v / v de glicerol (nitrógeno-deficienmedio t). </li><li> Medir la turbiedad de células (OD 600). </li><li> Preparar la mezcla de células de alícuotas de 6 ml en matraces de 25 ml de vidrio cerrado de la tapa y no de células controles (sales de E2 + 0,66% v / v de glicerol). </li><li> Añadir 100 nmol de alcano a cada matraz. </li><li> Incubar las mezclas a 37 ° C durante 24 hr (acortar cuando se obtienen tasas más altas). </li><li> Mida la OD 600 después de incubación. </li><li> Extraer los hidrocarburos en los medios de cultivo por acetato de etilo y determinar la concentración de hidrocarburos en cultivo celular por cromatografía de gases (véase el protocolo 3). </li><li> Calcular la degradación por unidad de biomasa dividiendo la cantidad total de alcano convertido por la biomasa total presente en cada matraz (OD 600 convertir a peso seco). Dividiendo el resultado por la duración experimental produce la actividad de degradación por unidad de biomasa por unidad de tiempo. El promedio se toma de tres carreras individuales. </li></ol> 3. Alkane Conversion Ensayo enzimático, EnVitro Este ensayo se realizó esencialmente según el método descrito por Li et al. (2008). <ol><li> Cultura E. células de E. coli que expresan el gen LADA ( <a href="http://partsregistry.org/Part:BBa_K398017" target="_blank">BBa_K398017</a> ) y las células que llevan un vector vacío ( <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> ) en 50 ml de medio LB con los antibióticos apropiados durante la noche. </li><li> Transferir 500 l de cultivo de una noche en 50 ml de LB fresco (con antibióticos) y se incuba hasta que la turbidez celular alcanzó una densidad óptica de 0,6 a 600 nm. </li><li> Centrifugar 10 minutos a 4.000 rpm (4 ° C) y resuspender el sedimento en 5 ml de 50 mM de tampón Tris. </li><li> Baño de ultrasonidos (disruptor celular, LA Biosystems) las células en ciclo de trabajo de 40% con un control de salida de 4, mantener la solución en hielo durante toda la duración. </li><li> Centrifugar la mezcla resultante durante 5 min a 4.000 rpm a 4 y dpor ejemplo, C para eliminar los restos celulares. Transferir el sobrenadante a un vial nuevo. </li><li> Determinar la concentración de proteína total de los extractos celulares mediante ensayo de Bradford. Nota: Usar frascos de vidrio para evitar el aumento de fondo y / o la pérdida de proteína. </li><li> Preparar una mezcla de 100 ml que contiene 0,1% v / v alcano y 50 mM de tampón Tris-HCl. </li><li> Calentar la mezcla a 100 ° C durante 5 min. Nota: Realice este paso sólo para alcanos de cadena media de duración con alto punto de ebullición. (Por ejemplo, C 16: 287 ° C). </li><li> Para conseguir una solubilidad óptima del alcano, sonicar durante 1 min mientras está todavía caliente hasta obtener una mezcla homogénea y viscosa se obtiene. </li><li> Añadir 1 mM de NADH, 1 mM FMN, 1 mM MgSO 4 y 0,01 v / v Triton X-100. </li><li> Preparar alícuotas de 6 ml en 25 ml cerrado la tapa frascos. </li><li> Añadir una cantidad adecuada de extracto de células (depende de ensayos de Bradford, concentración final de 5 mg de proteína / l). Preparar un control sin proteína. </li><li> Incubar a 60 ° C (para el correo óptimanzymatic actividad) durante 24 horas. </li><li> Extraer los hidrocarburos en los medios de cultivo por acetato de etilo y determinar la concentración de hidrocarburos en cultivo celular por cromatografía de gases (véase el protocolo 3). </li><li> Calcular la degradación por unidad de biomasa dividiendo la cantidad total de alcano convertido por proteína total a cada matraz (por Bradford curva de calibración). Además dividir por duración del experimento se obtiene la actividad de degradación por unidad de proteína celular por unidad de tiempo. El promedio se toma de tres carreras individuales. </li></ol> 4. Acetato de etilo de extracción de hidrocarburos y Medidas de concentración <ol><li> Alcanos se extrae de la solución acuosa mediante la adición de 2,5 ml de acetato de etilo (apolar solvant) a 6 ml de solución experimental. Un patrón interno se añade al disolvente en una concentración de 0,1% (v / v). El estándar (por ejemplo, ciclo-decan) varió en función de la gama prevista de los picos de interés. </li><li> Opcional: Añadir TritonX-100 a la mezcla acuosa y centrifugar las muestras durante 10 min a 4.000 rpm con el fin de obtener un adecuado sistema bifásico. </li><li> Vórtice de la mezcla durante 5 seg (1.500 rpm) y se incuba a temperatura ambiente hasta que las dos fases separadas. </li><li> Eliminar una cantidad máxima de la capa orgánica (superior) y secar el solvente usando sulfato de magnesio anhidro. </li><li> Retire MgSO 4 por filtración (0,2 m) y transferir el filtrado en viales de cromatografía de gases para mediciones o almacenar a -20 ° C. </li><li> Determinar la concentración por cromatografía de gases utilizando una columna de CP-SIL 5CB (longitud = 5 m). Inyectar 10 ul de muestra en modo de división (1:10, 230 ° C). Establecer el flujo de gases en columna a 1 ml / min (helio). El programa de temperatura del horno se utiliza la siguiente: <table border="1"><tbody><tr><td> Velocidad </td><td> Temperatura [° C] </td><td> Tiempo [min] </td></tr><tr><td> 0 </td><td> 50 </td><td> 7,5 </td></tr><tr><td> 50 </td><td> 90 </td><td> 1,0 </td></tr><tr><td> 50 </td><td> 110 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 130 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 145 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 160 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 170 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 185 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 210 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 250 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 320 </td><td> 2,0 </td></tr></tbody></table></li><li> Integrar los picos y corregir las concentraciones con respecto al patrón interno. </li></ol> 5. Alcohol / aldehído deshidrogenasa Ensayo de actividad Este ensayo se realizó esencialmente según el método descrito por Kato et al.(2010). <ol><li> Cultura E. células de E. coli que expresan la ADH ( <a href="http://partsregistry.org/Part:BBa_K398018" target="_blank">BBa_K398018</a> ) o ALDH ( <a href="http://partsregistry.org/Part:BBa_K398030" target="_blank">BBa_K398030</a> ) de genes y las células que llevan un vector vacío ( <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> ) en 50 ml de medio LB con los antibióticos apropiados durante la noche. </li><li> Transferir 500 l de cultivo de una noche en 50 ml de LB fresco (con antibióticos) y se incuba hasta que la turbidez celular alcanzó una densidad óptica de 0,6 a 600 nm. </li><li> Centrifugar 10 minutos a 4.000 rpm a 4 ° C y resuspender el sedimento en 5 ml de 50 mM de tampón Tris. </li><li> Someter a ultrasonidos la solución de células en ciclo de trabajo del 40% con un control de salida de 4 (mantener la solución en hielo durante la sonicación). </li><li> Centrifugar la mezcla resultante durante 5 min a 4.000 rpm a 4 ° C para eliminar los restos celulares. </li><li> Determinar la queTal concentración de proteína de los extractos celulares mediante ensayo de Bradford (Nota: use un vial de vidrio para prevenir la proteína de unión). </li><li> Cargar una placa de 96 pocillos con 180 l 57 mM de glicina tampón que contenía NAD (concentración final 1 mM, pH 9,5) en cada pocillo. </li><li> Añadir 5 l de alcohol (aldehído) a ensayar a los pocillos. Nota: alcoholes de cadena larga de calor antes del comienzo del ensayo de tener un líquido. Para cada alcohol (aldehído) un control sin sustrato debe ser añadido (control negativo). Además, preparar un blanco que contiene una mezcla de tampón y sustrato sin el extracto celular. </li><li> Precalentar la placa del lector de placas (Tecan Magellan v7.0) durante 15 min a 37 ° C para permitir el equilibrio del sistema. </li><li> Añadir una cantidad adecuada de extracto de células (depende de ensayos de Bradford, concentración final de 5 mg de proteína / l). Preparar un control sin proteína. </li><li> Medir la producción de NADH usando un espectrofotómetro a una longitud de onda de 340 nm cada 2-3 min durante 1 hora a 37 ° C. &lt;/ Li&gt; <li> Cálculo de la tasa de producción de NADH a partir de la pendiente de la OD (340 nm). Tener en cuenta la longitud de la trayectoria de la luz y el coeficiente de extinción de la NADH de 6220 M -1 cm -1. Divide la tasa de producción de NADH por la cantidad total de proteína añadida para expresar la actividad de la deshidrogenasa de reacción en el extracto celular (U / mg de proteína celular total). Calcular la media y la desviación estándar de tres carreras independientes. </li></ol> 6. Caracterización pCaiF <ol><li> Cultura E. células de E. coli que expresan el constructo pCaiF-GFP ( <a href="http://partsregistry.org/Part:BBa_K398331" target="_blank">BBa_K398331</a> ) y las células que llevan el promotor solo ( <a href="http://partsregistry.org/Part:BBa_K398326" target="_blank">BBa_K398326</a> ) durante la noche en 5 ml de medio LB durante la noche los antibióticos apropiados. </li><li> Inocular 5 ml M9 que contenía 10 g / l de glucosa y los antibióticos con 50 l de cultivo de una noche y crecer durante la noche. </li&gt; <li> Subculture 50 l de la noche a la mañana excrecencia en 5 ml de M9 fresco g with10 / l y se incuba hasta que la turbidez celular alcanzó una densidad óptica de 0,2 a 600 nm. </li><li> Cargar una placa de 96 pocillos con 100 l de medio M9 fresco que contiene la cantidad deseada de fuente de carbono para la prueba en cada pocillo. Lleve a cabo tres experimentos para la evaluación estadística y añadir los respectivos controles negativos (tipo salvaje E. coli K12). </li><li> Añadir 5 l de cultivo de una noche a los pocillos que contienen medio. </li><li> Medir la curva de crecimiento (OD 600) y la fluorescencia de GFP (485 nm de excitación y de emisión de 520) usando un lector de placa de cada 10 minutos durante 18 horas a 37 ° C con agitación constante. </li><li> Cálculo de la tasa de crecimiento y el contenido de GFP específica de las respectivas mediciones y comparar con el control. Calcular la media y la desviación estándar de al menos tres experimentos independientes. </li></ol> 7. Ensayo Tolerancia <ol><li> CulturaE. coli que expresan genes PhPFDα y β ( <a href="http://partsregistry.org/Part:BBa_K398406" target="_blank">BBa_K398406</a> ) durante la noche en 5 ml de medio LB y los antibióticos adecuados. E. coli que expresan LADA gen ( <a href="http://partsregistry.org/Part:BBa_K398017" target="_blank">BBa_K398017</a> ) se utilizó como control negativo. </li><li> Subculture 10 l de la noche a la mañana en consecuencia fresco 5 ml de LB (con antibióticos) y se incuba hasta que la turbidez celular alcanzó una densidad óptica de 0,3 a 0,4 a 600 nm. </li><li> Diluir los cultivos con medio fresco hasta una OD 600 de 0,1 se alcanza. </li><li> Cargar una placa de 96 pocillos con 180 l medio M9 que contiene los antibióticos apropiados y la concentración final adecuada del compuesto tóxico (por ejemplo, 0, 4, 8, 10% de n-hexano) por triplicado. Dado que el agua alcano-mezclas podría conducir a sistemas de dos fases es esencial tener controles apropiados en la placa (por ejemplo, dcepas ifferent y los experimentos en blanco respectivos). </li><li> Añadir 20 l de la cultura (control) en los pocillos. </li><li> Medir la concentración de biomasa (OD 600) usando un lector de placas cada 10 minutos durante 24 horas a 37 ° C con agitación constante. </li><li> Calcular las tasas de crecimiento de las mediciones respectivas para las diferentes concentraciones de agente y comparar con el control negativo. Calcular la media y la desviación estándar de al menos tres carreras independientes. </li></ol> 8. Homólogo Mapping Interacción <ol><li> El HIM aplicación fue desarrollada para realizar consultas de proteínas en un servidor PostgreSQL ejecuta la base de datos STRING (gratuito para uso académico) 20. La interacción homólogo aplicación de mapeo identifica las proteínas que interactúan en el organismo huésped original utilizando la base de datos STRING. Las secuencias de los genes respectivos que interaccionan se utiliza en una búsqueda BLAST para encontrar genes homólogos en el organismo objetivo. Cytoscape 4 </shasta&gt; se utiliza para visualizar el resultado de la asignación. La herramienta de software HIM se puede descargar en: <a href="https://github.com/jcnossen/InteractionHomologMapping" target="_blank">https://github.com/jcnossen/InteractionHomologMapping.</a> </li><li> Para realizar un mapeo, (1) introducir el ID BioBrick y la aplicación se descargará automáticamente los datos de la secuencia parcial del Registro de partes biológicas estándar de 9, o (2) Intro (pegar) la secuencia de datos de la aplicación. </li><li> Utilizar el sitio web de base de datos STRING para encontrar el ID de proteína STRING para la secuencia de ácido amino entrado. </li><li> Una proteína con alta homología se determina usando BLAST. Posteriormente, la aplicación enumera cada proteína de interacción conocida en el organismo fuente y búsquedas de homólogos en el organismo huésped (por ejemplo, E. coli). </li><li> Exportar lista resultante interacción putativo de texto o Cytoscape. </li></ol>

<ol>
	<li>Allen, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Process+water+treatment+in+Canada's+oil+sands+industry:+I:+Target+pollutants+and+treatment+objectives.">Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives.</a> J. Environ. Eng. Sci. 7, 123-138 (2008).</li><li>Alon, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> An Introduction to Systems Biology: Design Principles of Biological Circuits. , (2007).</li><li>Center, O. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Understanding Oil Spills and Oil Spill Response. , (1999).</li><li>Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+the+caiF+gene+encoding+a+potential+transcriptional+activator+of+carnitine+metabolism+in+Escherichia+coli.">Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli.</a> J. Bacteriol. 178, 1248-1257 (1995).</li><li>Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+and+proteome+of+long-chain+alkane+degrading+Geobacillus+thermodenitrificans+NG80-2+isolated+from+a+deep-subsurface+oil+reservoir.">Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir.</a> Proc. Natl. Acad. Sci. U.S.A. 104 (13), 5602-5607 (2007).</li><li>Fujii, T., Narikawa, T., Takeda, K., Kato, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotransformation+of+various+alkanes+using+the+Escherichia+coli+expressing+an+alkane+hydroxylase+system+from+Gordonia+sp.+TF6.">Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6.</a> Biosci. Biotechnol. Biochem. 68 (10), 2171-2177 (2004).</li><li>Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cloning+of+an+alcohol+dehydrogenase+from+thermophilic+alkane-degrading+Bacillus+thermoleovorans+B23.">cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23.</a> J. Biosci. Bioeng. 91 (1), 100-102 (2001).</li><li>Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+cloning+and+characterization+of+an+aldehyde+dehydrogenase+from+long-chain+alkane-degrading+Geobacillus+thermoleovorans+B23.">Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23.</a> Extremophiles. 14, 33-39 (2010).</li><li>Kieboom, J., De Bont, J. a. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Bacterial Stress Responses. , (2000).</li><li>Kotte, O., Zaugg, J. B., Heinemann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+adaptation+through+distributed+sensing+of+metabolic+fluxes.">Bacterial adaptation through distributed sensing of metabolic fluxes.</a> Mol Syst Biol. 6, 355 (2010).</li><li>Kremling, A., Bettenbrock, K., Gilles, E. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+global+control+of+Escherichia+coli+carbohydrate+uptake.">Analysis of global control of Escherichia coli carbohydrate uptake.</a> BMC Syst. Biol. 1, (2007).</li><li>Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+long-chain+alkane+monooxygenase+(LadA)+in+complex+with+coenzyme+FMN:+unveiling+the+long-chain+alkane+hydroxylase.">Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase.</a> J. Mol. Biol. 376 (2), 453-465 (2008).</li><li>Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+the+maximum+specific+uptake+capacities+for+glucose+and+oxygen+in+glucose-limited+fed-batch+cultivations+of+Escherichia+coli.">Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli.</a> Biotechnol. Bioeng. 73 (5), 347-357 (2001).</li><li>Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overexpression+of+prefoldin+from+the+hyperthermophilic+archaeum+Pyrococcus+horikoshii+OT3+endowed+Escherichia+coli+with+organic+solvent+tolerance.">Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance.</a> Appl. Microbiol. Biotechnol. 79 (3), 443-449 (2008).</li><li>Rehm, H. J., Reiff, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+and+occurrence+of+microbial+oxidation+of+long-chain+alkanes.">Mechanisms and occurrence of microbial oxidation of long-chain alkanes.</a> Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).</li><li>Rojo, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Degradation+of+alkanes+by+bacteria.">Degradation of alkanes by bacteria.</a> Environ. Microbiol. 11 (10), 2477-2490 (2009).</li><li>Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Pseudomonas+putida+alkane-degradation+gene+clusters+and+flanking+insertion+sequences:+evolution+and+regulation+of+the+alk+genes.">Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes.</a> Microbiology. 147, 1621-1630 (2001).</li><li>Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+a+novel+thermophilic+Bacillus+strain+degrading+long-chain+n-alkanes.">Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes.</a> Extremophiles. 10 (4), 347-356 (2006).</li></ol>

No hay conflictos de interés declarado.

El principio BioBrick se utiliza para construir un chasis para la degradación de alcanos y una prueba de principio para los componentes individuales de la caja de herramientas se obtuvo. Se proponen varios ensayos para medir la in vivo e in vitro de la actividad de enzimas de la ruta de degradación de alcanos. El trabajo presentado con éxito demuestra un número de métodos que pueden utilizarse para determinar la actividad enzimática y la expresión en el organismo huésped E. coli despu?...

Oil pollution is among the most serious causes of environmental contamination, and greatly affects ecosystems, businesses and communities 3. Solutions are for example required to battle the continuous oil pollution originating from the oil sands tailing waters in Alberta, Canada. During the process of oil extraction from oil sands, bitumen, a semi-solid oxidized form of oil, is removed using thermal recovery techniques that consume about 3.1 barrels of water per single barrel of oil 1. Oil contaminated process water, mainly originating from a local river, is stored in tailing ponds after bitumen extraction. A more effective recycling of process water in order to reduce the need for freshwater uptake is needed. To facilitate the bitumen extraction and to ensure that downstream sites meet water quality guidelines for the protection of aquatic ecosystems, process water treatments are rapidly evolving 3.
To treat pollution of organic compounds, bioremediation technologies employing microorganisms are presently encouraged 1. Alkanes are the most abundant family of hydrocarbons in crude oil, containing 5 to 40 carbon atoms per molecule 7, 21. Many bacteria are known to degrade alkanes of various lengths via sequential oxidation of the terminal methyl group forming first alcohols, then aldehydes and finally fatty acids 8. Within this iGEM project several enzymes from different organisms were expressed and characterized, and made available via the BioBrick standard and Registry of Standard Biological Parts.
The well-studied alkane hydroxylase system of Gordonia sp. TF6 facilitates the initial oxidation step of C5-C13 alkanes along with that of C5-C8 cycloalkanes using a minimum of four components: alkB2 (alkane 1-monooxygenase), rubA3, rubA4 (two rubredoxins) and RubB (rubredoxin reductase) 8, 21. Oxidation of long-chain alkanes (ranging from C15 up to C36) is reported to be performed by ladA, a flavoprotein alkane monooxygenase from Geobacillus thermodinitrificans NG-80-2 7, 15, 18, 22. LadA forms a catalytic complex with flavin mononucleotide (FMN) that utilizes atomic oxygen for oxidation. This results in the conversion of alkanes into the corresponding primary alkanol. The alcohols are further oxidized by alcohol and aldehyde dehydrogenases to fatty acids, which readily enter the &beta;-oxidation pathway 7, 21. A zinc-independent alcohol dehydrogenase from the thermophillic bacterium Geobacillus thermoleovorans B23 oxidizes medium-chain alkanols into their respective alkanals, using NAD+ as a cofactor 10. Aldehyde dehydrogenase from the same bacterium is able to catalyze the NAD+-dependent final step in the medium-chain oxidation 11.
In order to reduce induction costs and to maintain optimal proliferation of the bacterial system, the promoter pCaiF from E.coli was characterized. This promoter can regulate expression of the hydrocarbon degradation pathway components, and is regulated by cAMP-Crp levels, which in turn depend on glucose levels 6. At high extracellular glucose concentrations in the environment the cellular cAMP (cyclic Adenosine Mononucleotide Phosphate) level was low through the inhibition of adenylyl cyclase as a side effect of PTS mediated glucose transport. Conversely, during limitation (low glucose concentrations) the cAMP level increased and Crp bound to cAMP forming the complex, cAMP-Crp, which bound pCaiF and activated transcription of the downstream components 6, 14.
Wildtype E. coli can only tolerate moderate concentrations of hydrocarbons. To complete the toolkit, tolerance to hydrocarbons had to be addressed. Several organic solvent-tolerant bacteria are known to survive in water-solvent two-phase systems 12. Molecular components known to increase tolerance are chaperones that facilitate the correct folding of proteins. The prefoldin system from Pyrococcus horikoshii OT3, consisting of the proteins phPFD&alpha; and phPFD&beta;, was shown to increase hydrocarbon-tolerance 17.
The alkane conversion toolkit was constructed following the BioBrick principle, which is documented at the Registry of Standard Biological Parts 9. BioBricks are plasmids containing a specific functional insert that is flanked by 4 predefined restriction sites. The BioBrick inserts can be extended flexibly, allowing the construction of biological systems with new functions.

<table border="1">
	<tbody>
		<tr>
			<td>Name of the reagent</td>
			<td>Company</td>
			<td>Catalogue number</td>
			<td>Comments (optional)</td>
		</tr>
		<tr>
			<td>E. coli K12</td>
			<td>New England Biolabs</td>
			<td>C2523H</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Octane</td>
			<td>Fluka</td>
			<td>74822</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Hexadecane</td>
			<td>Fluka</td>
			<td>52209</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>octanol-1</td>
			<td>Fluka</td>
			<td>95446</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>dodecanol-1</td>
			<td>Sigma-Aldrich</td>
			<td>126799</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Hexane</td>
			<td>Sigma-Aldrich</td>
			<td>296090</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>NADH</td>
			<td>Sigma</td>
			<td>N4505</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>FMN</td>
			<td>Sigma</td>
			<td>F2253</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>J.T. Baker Casno</td>
			<td>7487 889</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T8787</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>T4 ligase</td>
			<td>New England Biolabs</td>
			<td>M0202L</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Gas chromatograph</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Cell disrupter</td>
			<td>LA Biosystems</td>
			<td>CD-019</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Amersham pharmacia</td>
			<td>spec 2000</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Plate reader</td>
			<td>Tecan</td>
			<td>Magellan v7.0</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>Innova, 44</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>BioBrick K398014: 
			BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_K398014</a></td>
			<td>Alkane Hydroxylase System 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398027: BBa_R0040-BBa_B0034-ladA</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398027" target="_blank">BBa_K398027</a></td>
			<td>ladA Protein Generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398018: BBa_J23100-BBa_J61101-ADH</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398018" target="_blank">BBa_K398018</a></td>
			<td>ADH generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398030: BBa_R0040-BBa_B0034-ALDH</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398030" target="_blank">BBa_K398030</a></td>
			<td>ALDH generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398326: pCaiF</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398326" target="_blank">BBa_K398326</a></td>
			<td>pCaiF promoter 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398331: pCaiF-BBa_B0032-BBa_I13401</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398331" target="_blank">BBa_K398331</a></td>
			<td>pCaiF measurement device 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398406: BBa_J23002-BBa_J61107-phPFD&alpha;-BBa_J61107-</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398406" target="_blank">BBa_K398406</a></td>
			<td>Solvent tolerance cluster 
			Resistance: Chloramphenicol</td>
		</tr>
	</tbody>
</table>

a toolkit to enable hydrocarbon conversion in aqueous environments

Este trabajo expone un conjunto de herramientas que permite la conversión de alcanos por Escherichia coli y presenta una prueba de principio de su aplicabilidad. El juego de herramientas se compone de varias piezas estándar intercambiables (BioBricks) 9 abordan la conversión de alcanos, la regulación de la expresión génica y la supervivencia en tóxicos ambientes ricos en hidrocarburos. Una vía de tres pasos para la degradación de alcano se llevó a cabo en E. coli para permitir la conversión de alcanos a medio y largo de cadena a sus respectivos alcanoles, alcanales y, finalmente, ácidos alcanoicos. Este último se metaboliza a través de la nativo β-oxidación vía. Para facilitar la oxidación de alcanos de cadena media-(C5-C13) y cicloalcanos (C5-C8), cuatro genes (alkB2, rubA3, rubA4 y Rubb) del sistema hidroxilasa alcano de Gordonia sp. TF6 8,21 se transformaron en E. coli. Para la conversión de losalcanos de cadena larga (C15-C36), el gen Lada de Geobacillus thermodenitrificans fue implementado. Para conocer los pasos necesarios adicionales del proceso de degradación, ADH y ALDH (procedente de thermodenitrificans G.) se introdujeron 10,11. La actividad se midió mediante ensayos de células en reposo. Para cada etapa oxidativa, la actividad enzimática se observó. Para optimizar la eficacia del proceso, la expresión fue inducida sólo bajo condiciones bajas de glucosa: un promotor regulado sustrato, pCaiF, se utilizó. pCaiF está presente en E. coli K12 y regula la expresión de los genes implicados en la degradación de fuentes de carbono distintas a la glucosa. La última parte del conjunto de instrumentos - focalización supervivencia - se implementó el uso de genes de tolerancia, solventes PhPFDα y β, ambos de Pyrococcus horikoshii OT3. Disolventes orgánicos pueden inducir estrés celular y la disminución de la supervivencia de forma negativa affecting plegamiento de proteínas. Como chaperones, PhPFDα y β mejorar el proceso de plegamiento de proteínas por ejemplo en virtud de la presencia de alcanos. La expresión de estos genes condujeron a una tolerancia mejorada de hidrocarburos se muestra por una tasa de crecimiento mayor (hasta 50%) en la presencia de 10% de n-hexano en el medio de cultivo se observaron. En resumen, los resultados indican que el kit de herramientas permite E. coli para convertir y tolerar hidrocarburos en ambientes acuosos. Como tal, representa un primer paso hacia una solución sostenible para la recuperación de petróleo mediante un enfoque de la biología sintética.

Alkane conversion
The activity of the three oxidation steps from the alkane to the respective fatty acid was evaluated using resting cell assays and enzyme activity measurements. The results are presented following the pathway reactions (1) alkane hydroxylase, (2) alcohol dehydrogenase and (3) aldehyde dehydrogenase. 
For the first step, different plasmids were constructed for medium and long-chain alkanes. The plasmid <a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_...

Watch this Scientific Journal Video about A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments at JoVE.com

Un conjunto de herramientas para permitir la conversión de hidrocarburos en ambientes acuosos | Bioingeniería | Video

A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

Un auto sostenible sistema de regulación de las bacterias para la remediación de contaminaciones de aceite ha sido diseñado utilizando piezas estándar de ADN intercambiables (BioBricks). Una ingeniería<em&gt; E. coli</emCepa&gt; se utiliza para degradar alcanos a través de β-oxidación en ambientes acuosos tóxicos. Las respectivas enzimas de diferentes especies mostraron actividad de degradación de alcano. Además, una mayor tolerancia a<em&gt; N</em&gt;-Hexano se obtuvo mediante la introducción de genes de alcano bacterias tolerantes.

Un juego de herramientas para la conversión de hidrocarburos en ambientes acuosos

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The ...

a-toolkit-to-enable-hydrocarbon-conversion-in-aqueous-environments

Education

Research

JoVE Core

JoVE Journal

Organic Chemistry

Biology

Bioengineering

Ecology

Unit 1

Ecosystems

Alkanes and Cycloalkanes

SCIENTISTS IN ACTION

14.0K vistas.  Delft University of Technology. Un auto sostenible sistema de regulación de las bacterias para la remediación de contaminaciones de aceite ha sido diseñado utilizando piezas estándar de ADN intercambiables (BioBricks). Una ingeniería E. coli se utiliza para degradar alcanos a través de β-oxidación en ambientes acuosos tóxicos. Las respectivas enzimas de diferentes especies mostraron actividad de degradación de alcano. Además, una mayor tolerancia a N-Hexano s...

Video: A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

Creating Two-Dimensional Patterned Substrates for Protein and Cell Confinement

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1 While microcontact printing can be employed to directly print a large number of molecules, including proteins,2 DNA,3 and silanes,4 the formation of self-assembled monolayers (SAMs) from long chain alkane thiols on gold provides a simple way to confine proteins and cells to specific patterns containing adhesive and resistant regions. This confinement can be used to control cell morphology and is useful for examining a variety of questions in protein and cell biology. Here, we describe a general method for the creation of well-defined protein patterns for cellular studies.5 This process involves three steps: the production of a patterned master using photolithography, the creation of a PDMS stamp, and microcontact printing of a gold-coated substrate. Once patterned, these cell culture substrates are capable of confining proteins and/or cells (primary cells or cell lines) to the pattern.
The use of self-assembled monolayer chemistry allows for precise control over the patterned protein/cell adhesive regions and non-adhesive regions; this cannot be achieved using direct protein stamping. Hexadecanethiol, the long chain alkane thiol used in the microcontact printing step, produces a hydrophobic surface that readily adsorbs protein from solution. The glycol-terminated thiol, used for backfilling the non-printed regions of the substrate, creates a monolayer that is resistant to protein adsorption and therefore cell growth.6 These thiol monomers produce highly structured monolayers that precisely define regions of the substrate that can support protein adsorption and cell growth. As a result, these substrates are useful for a wide variety of applications from the study of intercellular behavior7 to the creation of microelectronics.8
While other types of monolayer chemistry have been used for cell culture studies, including work from our group using trichlorosilanes to create patterns directly on glass substrates,9 patterned monolayers formed from alkane thiols on gold are straight-forward to prepare. Moreover, the monomers used for monolayer preparation are commercially available, stable, and do not require storage or handling under inert atmosphere. Patterned substrates prepared from alkane thiols can also be recycled and reused several times, maintaining cell confinement.10

Self-assembled monolayers (SAMs) formed from long chain alkane thiols on gold provide well-defined substrates for the formation of protein patterns and cell confinement. Microcontact printing of hexadecanethiol using a polydimethylsiloxane (PDMS) stamp followed by backfilling with a glycol-terminated alkane thiol monomer produces a pattern where protein and cells adsorb only to the stamped hexadecanethiol region.

La creación de dos dimensiones con dibujos sustratos para el confinamiento de proteínas y células

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1  While microcontact printing ...

Investigación

Bioingeniería

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic valve leaflets are composed of interstitial cells suspended within an extracellular matrix (ECM) and are lined with an endothelial cell monolayer. The valve withstands a harsh, dynamic environment and is constantly exposed to shear, flexion, tension, and compression. Research has shown calcific lesions in diseased valves occur in areas of high mechanical stress as a result of endothelial disruption or interstitial matrix damage1-3. Hence, it is not surprising that epidemiological studies have shown high blood pressure to be a leading risk factor in the onset of aortic valve disease4. 
The only treatment option currently available for valve disease is surgical replacement of the diseased valve with a bioprosthetic or mechanical valve5. Improved understanding of valve biology in response to physical stresses would help elucidate the mechanisms of valve pathogenesis. In turn, this could help in the development of non-invasive therapies such as pharmaceutical intervention or prevention. Several bioreactors have been previously developed to study the mechanobiology of native or engineered heart valves6-9. Pulsatile bioreactors have also been developed to study a range of tissues including cartilage10, bone11 and bladder12. The aim of this work was to develop a cyclic pressure system that could be used to elucidate the biological response of aortic valve leaflets to increased pressure loads. 
The system consisted of an acrylic chamber in which to place samples and produce cyclic pressure, viton diaphragm solenoid valves to control the timing of the pressure cycle, and a computer to control electrical devices. The pressure was monitored using a pressure transducer, and the signal was conditioned using a load cell conditioner. A LabVIEW program regulated the pressure using an analog device to pump compressed air into the system at the appropriate rate. The system mimicked the dynamic transvalvular pressure levels associated with the aortic valve; a saw tooth wave produced a gradual increase in pressure, typical of the transvalvular pressure gradient that is present across the valve during diastole, followed by a sharp pressure drop depicting valve opening in systole. The LabVIEW program allowed users to control the magnitude and frequency of cyclic pressure. The system was able to subject tissue samples to physiological and pathological pressure conditions. This device can be used to increase our understanding of how heart valves respond to changes in the local mechanical environment.

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

A cyclic pressure bioreactor capable of subjecting heart valve tissue to physiological and pathological pressure conditions has been designed. A LabVIEW program allows users to control pressure magnitude, amplitude and frequency. This device can be used to study the mechanobiology of heart valve tissue or isolated cells.

Diseño de un biorreactor de presión cíclica de la Ex Vivo Estudio de las válvulas aórtica del corazón

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic ...

Electric Field-controlled Directed Migration of Neural Progenitor Cells in 2D and 3D Environments

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the central nervous system1,2. These endogenous EFs are generated by cellular regulation of ionic transport combined with the electrical resistance of cells and tissues. It has been reported that applied EF treatment can promote functional repair of spinal cord injuries in animals and humans3,4. In particular, EF-directed cell migration has been demonstrated in a wide variety of cell types5,6, including neural progenitor cells (NPCs)7,8. Application of direct current (DC) EFs is not a commonly available technique in most laboratories. We have described detailed protocols for the application of DC EFs to cell and tissue cultures previously5,11. Here we present a video demonstration of standard methods based on a calculated field strength to set up 2D and 3D environments for NPCs, and to investigate cellular responses to EF stimulation in both single cell growth conditions in 2D, and the organotypic spinal cord slice in 3D. The spinal cordslice is an ideal recipient tissue for studying NPC ex vivo behaviours, post-transplantation, because the cytoarchitectonic tissue organization is well preserved within these cultures9,10. Additionally, this ex vivo model also allows procedures that are not technically feasible to track cells in vivo using time-lapse recording at the single cell level. It is critically essential to evaluate cell behaviours in not only a 2D environment, but also in a 3D organotypic condition which mimicks the in vivo environment. This system will allow high-resolution imaging using cover glass-based dishes in tissue or organ culture with 3D tracking of single cell migration in vitro and ex vivo and can be an intermediate step before moving onto in vivo paradigms.

This protocol demonstrates methods used to establish 2D and 3D environments in custom-designed electrotactic chambers, which can track cells in vivo/ex vivo using time-lapse recording at the single cell level, in order to investigate galvanotaxis/electrotaxis and other cellular responses to direct current (DC) electric fields (EFs).

Campo eléctrico controlado por migración dirigida de células progenitoras neurales en entornos 2D y 3D

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the ...

Cell Co-culture Patterning Using Aqueous Two-phase Systems

Cell patterning technologies that are fast, easy to use and affordable will be required for the future development of high throughput cell assays, platforms for studying cell-cell interactions and tissue engineered systems. This detailed protocol describes a method for generating co-cultures of cells using biocompatible solutions of dextran (DEX) and polyethylene glycol (PEG) that phase-separate when combined above threshold concentrations. Cells can be patterned in a variety of configurations using this method. Cell exclusion patterning can be performed by printing droplets of DEX on a substrate and covering them with a solution of PEG containing cells. The interfacial tension formed between the two polymer solutions causes cells to fall around the outside of the DEX droplet and form a circular clearing that can be used for migration assays. Cell islands can be patterned by dispensing a cell-rich DEX phase into a PEG solution or by covering the DEX droplet with a solution of PEG. Co-cultures can be formed directly by combining cell exclusion with DEX island patterning. These methods are compatible with a variety of liquid handling approaches, including manual micropipetting, and can be used with virtually any adherent cell type.

Aqueous two-phase systems were used to simultaneously pattern multiple populations of cells. This fast and easy method for cell patterning takes advantage of the phase separation of aqueous solutions of dextran and polyethylene glycol and the interfacial tension that exists between the two polymer solutions.

Co-cultivo celular Patterning Uso acuoso de dos fases Sistemas

Cell patterning  technologies that are fast, easy to use and affordable will be required for the  future development of high throughput cell assays, ...

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to intrinsic parameters within the process allow a high degree of control over scaffold characteristics including fiber diameter, alignment and porosity. By developing scaffolds with similar dimensions and topographies to organ- or tissue-specific extracellular matrices (ECM), micro-environments representative to those that cells are exposed to in situ can be created. 
The airway bronchiole wall, comprised of three main micro-environments, was selected as a model tissue. Using decellularized airway ECM as a guide, we electrospun the non-degradable polymer, polyethylene terephthalate (PET), by three different protocols to produce three individual electrospun scaffolds optimized for epithelial, fibroblast or smooth muscle cell-culture. Using a commercially available bioreactor system, we stably co-cultured the three cell-types to provide an in vitro model of the airway wall over an extended time period.
This model highlights the potential for such methods being employed in in vitro diagnostic studies investigating important inter-cellular cross-talk mechanisms or assessing novel pharmaceutical targets, by providing a relevant platform to allow the culture of fully differentiated adult cells within 3D, tissue-specific environments.

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Advancements in biomaterial technologies enable the development of three-dimensional multi-cell-type constructs. We have developed electrospinning protocols to produce three individual scaffolds to culture the main structural cells of the airway to provide a 3D in vitro model of the airway bronchiole wall.

Adaptación del Proceso Electrohilado para proporcionar tres ambientes únicos para un Tri-capa<em&gt; In Vitro</em&gt; Modelo de la pared de la vía aérea

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to ...

Photopatterning Proteins and Cells in Aqueous Environment Using TiO2 Photocatalysis

Organic contaminants adsorbed on the surface of titanium dioxide (TiO2) can be decomposed by photocatalysis under ultraviolet (UV) light. Here we describe a novel protocol employing the TiO2 photocatalysis to locally alter cell affinity of the substrate surface. For this experiment, a thin TiO2 film was sputter-coated on a glass coverslip, and the TiO2 surface was subsequently modified with an organosilane monolayer derived from octadecyltrichlorosilane (OTS), which inhibits cell adhesion. The sample was immersed in a cell culture medium, and focused UV light was irradiated to an octagonal region. When a neuronal cell line PC12 cells were plated on the sample, cells adhered only on the UV-irradiated area. We further show that this surface modification can also be performed in situ, i.e., even when cells are growing on the substrate. Proper modification of the surface required an extracellular matrix protein collagen to be present in the medium at the time of UV irradiation. The technique presented here can potentially be employed in patterning multiple cell types for constructing coculture systems or to arbitrarily manipulate cells under culture.

Photopatterning Proteins and Cells in Aqueous Environment Using TiO2 Photocatalysis

We describe a protocol for modifying cell affinity of a scaffold surface in aqueous environment. The method takes advantage of titanium dioxide photocatalysis to decompose organic film in the photo-irradiated region. We show that it can be used to create microdomains of scaffolding proteins, both ex situ and in situ.

Photopatterning proteínas y células en el medio ambiente acuoso Usando TiO<sub&gt; 2</sub&gt; Fotocatálisis

Organic contaminants adsorbed on the surface of titanium dioxide (TiO2) can be decomposed by photocatalysis under ultraviolet (UV) light. Here we describe ...

Aqueous Droplets Used as Enzymatic Microreactors and Their Electromagnetic Actuation

For the successful implementation of microfluidic reaction systems, such as PCR and electrophoresis, the movement of small liquid volumes is essential. In conventional lab-on-a-chip-platforms, solvents and samples are passed through defined microfluidic channels with complex flow control installations. The droplet actuation platform presented here is a promising alternative. With it, it is possible to move a liquid drop (microreactor) on a planar surface of a reaction platform (lab-in-a-drop). The actuation of microreactors on the hydrophobic surface of the platform is based on the use of magnetic forces acting on the outer shell of the liquid drops which is made of a thin layer of superhydrophobic magnetite particles. The hydrophobic surface of the platform is needed to avoid any contact between the liquid core and the surface to allow a smooth movement of the microreactor. On the platform, one or more microreactors with volumes of 10 &#181;L can be positioned and moved simultaneously. The platform itself consists of a 3 x 3 matrix of electrical double coils which accommodate either neodymium or iron cores. The magnetic field gradients are automatically controlled. By variation of the magnetic field gradients, the microreactors' magnetic hydrophobic shell can be manipulated automatically to move the microreactor or open the shell reversibly. Reactions of substrates and corresponding enzymes can be initiated by merging the microreactors or bringing them into contact with surface immobilized catalysts.

Lab-in-a-drop reaction systems allow the versatile implementation of complex reactions in a microfluidic scale. An automated actuation platform consisting of a 3 x 3 matrix of electromagnetic coils was developed and successfully used to merge two 10 &#181;L microreactors and thereby initiate an enzymatic reaction in the resulting liquid marbles.

Gotas acuosas utilizan como enzimática microreactores y su accionamiento electromagnético

For the successful implementation of microfluidic reaction systems, such as PCR and electrophoresis, the movement of small liquid volumes is essential. In ...

Characterizing Cell Migration Within Three-dimensional In Vitro Wound Environments

Currently, most in vitro models of wound healing, such as well-established scratch assays, involve studying cell migration and wound closure on two-dimensional surfaces. However, the physiological environment in which in vivo wound healing takes place is three-dimensional rather than two-dimensional. It is becoming increasingly clear that cell behavior differs greatly in two-dimensional vs. three-dimensional environments; therefore, there is a need for more physiologically relevant in vitro models for studying cell migration behaviors in wound closure. The method described herein allows for the study of cell migration in a three-dimensional model that better reflects physiological conditions than previously established two-dimensional scratch assays. The purpose of this model is to evaluate cell outgrowth via the examination of cell migration away from a spheroid body embedded within a fibrin matrix in the presence of pro- or anti-migratory factors. Using this method, cell outgrowth from the spheroid body in a three-dimensional matrix can be observed and is easily quantifiable over time via brightfield microscopy and analysis of spheroid body area. The effect of pro-migratory and/or inhibitory factors on cell migration can also be evaluated in this system. This method provides researchers with a simple method of analyzing cell migration in three-dimensional wound associated matrices in vitro, thus increasing the relevance of in vitro cell studies prior to the use of in vivo animal models.

Characterizing Cell Migration Within Three-dimensional In Vitro Wound Environments

The goal of this protocol is to evaluate the effect of pro- and anti-migratory factors on cell migration within a three-dimensional fibrin matrix.

Caracterización de la migración de la célula en tres dimensiones In Vitro herida ambientes

Currently, most in vitro models of wound healing, such as well-established scratch assays, involve studying cell migration and wound closure on ...

Protocol for MicroRNA Transfer into Adult Bone Marrow-derived Hematopoietic Stem Cells to Enable Cell Engineering Combined with Magnetic Targeting

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates after injection into injured tissues as well as the observed massive cell death rates lead to very restricted therapeutic effects. To overcome these limitations, we sought to establish a non-viral based protocol for suitable cell engineering prior to their administration. The modification of human CD133+ expressing SCs using microRNA (miR) loaded magnetic polyplexes was addressed with respect to uptake efficiency and safety as well as the targeting potential of the cells. Relying on our protocol, we can achieve high miR uptake rates of 80&#8211;90% while the CD133+ stem cell properties remain unaffected. Moreover, these modified cells offer the option of magnetic targeting. We describe here a safe and highly efficient procedure for the modification of CD133+ SCs. We expect this approach to provide a standard technology for optimization of therapeutic stem cell effects and for monitoring of the administered cell product via magnetic resonance imaging (MRI).

This protocol illustrates a safe and efficient procedure to modify CD133+ hematopoietic stem cells. The presented non-viral, magnetic polyplex-based approach may provide a basis for the optimization of therapeutic stem cell effects as well as for monitoring the administered cell product via magnetic resonance imaging.

Protocolo para la transferencia de microARN en médula ósea hematopoyéticas células madre adultas para permitir ingeniería celular combinado con orientación magnética

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates ...

Material Formation of Recombinant Spider Silks through Aqueous Solvation using Heat and Pressure

Many spiders produce seven types of silks. Six of the silks are fiber in form when produced by the spiders. These fibers are not water soluble. In order to reproduce the remarkable mechanical properties of spider silks, they must be produced in heterologous hosts as spiders are both territorial and cannibalistic. The synthetic analogs of spider silk also tend to be insoluble in aqueous solutions. Thus, a large percentage of research in recombinant spider silks rely upon organic solvents that are detrimental to large scale production of materials. Our group&#8217;s method forces the solvation of these recombinant spider silks into water. Remarkably, when these proteins are prepared using this method of heat and pressure, a wide range of material forms can be prepared from the same solution of recombinant spider silk proteins (rSSp) including: films, fibers, sponge, hydrogel, lyogel, and adhesives. This article demonstrates the production of the solvated rSSp and material forms in a manner that is more easily understood than from written materials and methods alone.

Here, we present a protocol to produce water soluble recombinant spider silk protein solutions and the material forms that can be formed from those solutions.

Formación material de la araña recombinante sedas a través de la Solvación acuosa utilizando calor y presión

Many spiders produce seven types of silks. Six of the silks are fiber in form when produced by the spiders. These fibers are not water soluble. In order ...