Gli esperimenti condotti in questo video-articolo sono stati sviluppati per il concorso internazionale macchina Genetically Engineered 9. Gli autori desiderano ringraziare i membri del team iGEM Luca Bergwerff, Pieter van TM Boheemen, Jelmer Cnossen, Hugo F. Cueto Rojas e Ramon van der Valk per l&#39;assistenza nella ricerca. Ringraziamo Han de Winde, Stefan de Kok e Esengül Yıldırım per le discussioni utili e che ospitano questa ricerca. Questo lavoro è stato sostenuto dal TU Delft University Dipartimento di Biotecnologie, Il laboratorio di Bioinformatica Delft, TU Delft Dipartimento di Bionanoscience, Oil Sands Leadership Initiative (OSLI), Stud studentenuitzendbureau, Paesi Bassi Genomics Initiative, Kluyver Centro, Nederlandse Vereniging Biotechnologische (Stichting Biotecnologie Nederland) , DSM, Geneart, Greiner Bio-One e Genencor.

1. BioBrick Assemblea <ol><li> BioBricks della cancelleria di parti standard biologici sono forniti dalla sede centrale iGEM. Per costruire un nuovo BioBrick BioBricks esistenti, digerire il donatore BioBrick (fino a 1,0 mg) con gli enzimi EcoRI e SpeI di posizionamento dei donatori valle parte della parte accettore. Digerire con XbaI e PstI per posizionare la parte donatore monte della parte accettore. Aggiungi un enzima di restrizione terzo opportuno che interviene la spina dorsale del donatore. Eseguire le digestioni in un volume totale di 20-25 ml con il tampone appropriato, secondo il fornitore (concentrazione finale 1x). Utilizzare 5 unità / mg di DNA per gli enzimi di restrizione. </li><li> Digerire l&#39;accettore BioBrick sia con EcoRI e XbaI o SpeI e PstI. </li><li> Incubare le digestioni per (almeno) uno hr a 37 ° C. Inattivare le endonucleasi di restrizione da calore, incubazione a 80 ° C per 10 min e centrifugare brevemente. </li><li> Legare il BioBrick digeritoparti (donatore e accettore) insieme. Poiché XbaI e SpeI generare estremità DNA compatibili, un sito misto viene creato che non può essere tagliato con qualsiasi enzima di restrizione risultante in una nuova BioBrick &#39;combinato&#39; che affiancano i quattro siti di restrizione standard. Nella miscela di ligazione del DNA concentrazione finale è preferibilmente ~ 100 ng / pl. Effettuare la reazione di ligazione in un volume totale di 10-15 ml con il tampone di ligazione T4 (concentrazione finale 1x) e ligasi T4 (1 unità / mg di DNA). </li><li> Incubare la miscela di ligazione a 16 ° C per almeno 3 ore. </li><li> Eseguire la reazione di trasformazione con la metà circa del mix legatura. </li><li> Confermare la BioBrick corrette in sequenza. </li><li> Per costruire un BioBrick nuovo DNA sintetizzato, modificare i geni per la sintesi per l&#39;espressione ottimale in E. coli mediante lo strumento sito jcat ( <a href="http://www.jcat.de/" target="_blank">http://www.jcat.de/</a> ). Apportare ulteriori modifiche in conformità con i requisiti del B<html> ioBrick standard. Questa standardizzazione implica che ogni BioBrick è composto da una sequenza di DNA di interesse preceduto da un prefisso e seguito da un suffisso. Il prefisso e suffisso sono sequenze che contengono siti di restrizione predefiniti, che sono assenti nella sequenza rimanente plasmide. Questi siti di restrizione standard, rendono possibile intercambiare ed estendere gli inserti BioBrick flessibile 9. Il prefisso e suffisso sono le seguenti sequenze: </li></ol><table border="1"><tbody><tr><td> Nome </td><td> Sequenza </td><td> Commento </td></tr><tr><td> Prefisso </td><td> 5 &#39;GAATTCGCGGCCGCTTCTAG3&#39; </td><td></td></tr><tr><td></td><td> 5 &#39;GAATTCGCGGCCGCTTCTAGAG 3&#39; </td><td> Se la parte che segue è una sequenza codificante o qualsiasi parte che inizia con &quot;ATG&quot; </td></tr><tr><td> Suffisso </td><td> 5 &#39;TACTAGTAGCGGCCGCTGCAG 3&#39; </td><td></td></tr></tbody></table>ove_title &quot;&gt; 2. Alkane Conversione riposo Assay cellulare, In Vivo Questo saggio è stato eseguito secondo il metodo descritto da Fujii et al. (2004). <ol><li> Cultura E. coli che esprimono il sistema Alkane idrossilasi ( <a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_K398014</a> ) e cellule portando un vettore vuoto ( <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> ) in 5 ml di terreno LB con antibiotici appropriati overnight. </li><li> Trasferire 500 microlitri della coltura durante la notte in 50 ml di LB fresco (con antibiotico) e incubare fino alla torbidità cella raggiunta una DO (densità ottica) di 0,3 a 600 nm. </li><li> Centrifugare per 10 min a 4000 rpm e risospendere il pellet in 5 ml di tampone fosfato 0,1 M (pH 7,4). </li><li> Centrifugare nuovamente per 10 min a 4000 rpm e risospendere il pellet in 5 ml di tampone fosfato 0,1 M contenente sali ora E2 e 0,66% v / v glicerolo (azoto-deficienzet media). </li><li> Misurare la torbidità cella (OD 600). </li><li> Preparare cellule miscela aliquote da 6 ml in 25 ml chiusi con tappo a palloni di vetro e non a cellule di controllo (sali E2 + 0,66% v / v glicerolo). </li><li> Aggiungere 100 nmol di alcano a ciascun contenitore. </li><li> Incubare le miscele a 37 ° C per 24 ore (quando accorciare tassi più elevati sono ottenuti). </li><li> Misurare la OD 600 dopo l&#39;incubazione. </li><li> Estrarre gli idrocarburi nei terreni di coltura da acetato di etile e determinare la concentrazione di idrocarburi nella coltura cellulare mediante gascromatografia (vedi protocollo 3). </li><li> Calcolare la degradazione per unità di biomassa dividendo la quantità totale di alcano convertito dalla biomassa totale presente in ciascuna beuta (convertire OD 600 al peso secco). Dividendo il risultato per la durata sperimentale produce l&#39;attività di degradazione per unità di biomassa per unità di tempo. La media è tratto da tre singole corse. </li></ol> 3. Alkane conversione saggio enzimatico, inVitro Questo saggio è stato eseguito essenzialmente secondo il metodo descritto da Li et al. (2008). <ol><li> Cultura E. coli che esprimono il gene Lada ( <a href="http://partsregistry.org/Part:BBa_K398017" target="_blank">BBa_K398017</a> ) e le cellule che trasportano un vettore vuoto ( <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> ) in 50 ml di terreno LB con antibiotici appropriati durante la notte. </li><li> Trasferire 500 microlitri della coltura durante la notte in 50 ml di LB fresco (con antibiotico) e incubare fino alla torbidità cella raggiunta una densità ottica di 0,6 a 600 nm. </li><li> Centrifugare 10 min a 4000 rpm (4 ° C) e risospendere il pellet in 5 ml di 50 mM di tampone Tris. </li><li> Ultrasuoni (Cella disgregatore, LA Biosystems) le cellule a duty cycle del 40% con un controllo di uscita 4, mantenere la soluzione in ghiaccio per tutta la durata. </li><li> Centrifugare la miscela risultante per 5 min a 4000 rpm a 4 &amp; deg; C per rimuovere i detriti cellulari. Trasferire il surnatante in un flacone fresco. </li><li> Determinare la concentrazione di proteine ​​totali degli estratti di cellule mediante saggio Bradford. Nota: utilizzare fiale di vetro per prevenire l&#39;aumento di sfondo e / o perdita di proteine. </li><li> Preparare una miscela di 100 ml contenente 0,1% v / v alcano e 50 mM Tris-HCl. </li><li> Scaldare la miscela a 100 ° C per 5 min. Nota: Eseguire questo passaggio solo per i medio-lungo alcani a catena ad alto punto di ebollizione. (Ad esempio C 16: 287 ° C). </li><li> Per ottenere una solubilità ottimale del alcano, ultrasuoni per 1 min mentre è ancora caldo fino a omogenea, miscela viscosa si ottiene. </li><li> Aggiungere 1 mM di NADH, 1 mM FMN, 1 mM MgSO 4 e 0,01 v / v Triton X-100. </li><li> Preparare 6 aliquote ml in 25 ml chiuso con tappo a fiaschi. </li><li> Aggiungi adeguate quantità di estratto cellulare (dipende dal test Bradford, la concentrazione finale di 5 mg di proteina / l). Preparare un no-proteina di controllo. </li><li> Incubare a 60 ° C (per l&#39;e ottimalenzymatic attività) per 24 ore. </li><li> Estrarre gli idrocarburi nei terreni di coltura da acetato di etile e determinare la concentrazione di idrocarburi nella coltura cellulare mediante gascromatografia (vedi protocollo 3). </li><li> Calcolare la degradazione per unità di biomassa dividendo la quantità totale di alcano convertito proteina totale aggiunto a ciascun contenitore (Bradford dalla curva di calibrazione). Dividere ulteriormente per durata dell&#39;esperimento produce l&#39;attività di degradazione per unità di proteina cellulare per unità di tempo. La media è tratto da tre singole corse. </li></ol> 4. Etile acetato e di estrazione di idrocarburi misure di concentrazione <ol><li> Alcani sono estratte dalla soluzione acquosa mediante aggiunta di 2,5 ml di acetato di etile (apolare solvant) a 6 ml soluzione sperimentale. Uno standard interno viene aggiunto al solvente ad una concentrazione di 0,1% (v / v). Lo standard (ad esempio ciclo-decano) varia a seconda del range atteso dei picchi di interesse. </li><li> Opzionale: Aggiungi TritonX-100 alla miscela acquosa e centrifugare i campioni per 10 min a 4000 rpm per ottenere un adeguato sistema bifasico. </li><li> Agitare la miscela per 5 sec (1500 rpm) e incubare a temperatura ambiente fino a quando le due fasi separate. </li><li> Rimuovere una quantità massima dello strato organico (in alto) e asciugare il solvente utilizzando solfato di magnesio anidro. </li><li> Rimuovere MgSO4 per filtrazione (0,2 micron) e trasferire il filtrato in fiale di gas cromatografo per misure, o conservare a -20 ° C. </li><li> Determinare la concentrazione mediante gascromatografia usando una colonna CP-SIL 5CB (lunghezza = 5 m). Iniettare 10 ml di campione in modalità split (1:10, 230 ° C). Impostare il flusso di gas a colonna 1 ml / min (elio). Il seguente programma di temperatura del forno viene utilizzato: <table border="1"><tbody><tr><td> Tasso </td><td> Temperatura [° C] </td><td> Tempo [min] </td></tr><tr><td> 0 </td><td> 50 </td><td> 7,5 </td></tr><tr><td> 50 </td><td> 90 </td><td> 1,0 </td></tr><tr><td> 50 </td><td> 110 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 130 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 145 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 160 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 170 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 185 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 210 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 250 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 320 </td><td> 2,0 </td></tr></tbody></table></li><li> Integrare picchi e correggere le concentrazioni rispetto allo standard interno. </li></ol> 5. L&#39;alcol / aldeide deidrogenasi saggio di attività Questo saggio è stato eseguito essenzialmente secondo il metodo descritto da Kato et al.(2010). <ol><li> Cultura E. coli che esprimono l&#39;ADH ( <a href="http://partsregistry.org/Part:BBa_K398018" target="_blank">BBa_K398018</a> ) o ALDH ( <a href="http://partsregistry.org/Part:BBa_K398030" target="_blank">BBa_K398030</a> ) gene e le cellule che trasportano un vettore vuoto ( <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> ) in 50 ml di terreno LB con antibiotici appropriati durante la notte. </li><li> Trasferire 500 microlitri della coltura durante la notte in 50 ml di LB fresco (con antibiotico) e incubare fino alla torbidità cella raggiunta una densità ottica di 0,6 a 600 nm. </li><li> Centrifugare 10 min a 4000 rpm a 4 ° C e risospendere il pellet in 5 ml di tampone Tris 50 mM. </li><li> Sonicare la soluzione cellulare a duty cycle del 40%, con un controllo di uscita di 4 (conservare la soluzione in ghiaccio durante la sonicazione). </li><li> Centrifugare la miscela risultante per 5 min a 4000 rpm a 4 ° C per rimuovere i detriti cellulari. </li><li> Determinare la dila concentrazione di proteine ​​Tal degli estratti cellulari da Bradford assay (Nota: utilizzare un flacone di vetro per evitare legame con le proteine). </li><li> Caricare una piastra a 96 pozzetti con 180 microlitri 57 mM tampone glicina contenente NAD (concentrazione finale 1 mM, pH 9,5) in ciascun pozzetto. </li><li> Aggiungere 5 l di alcool (aldeide) da testare ai pozzetti. Nota: alcoli a catena lunga di calore prima dell&#39;inizio del saggio per avere un liquido. Per ciascun alcole (aldeide) un controllo senza substrato dovrebbe essere aggiunto (controllo negativo). Inoltre, preparare un bianco contenente una miscela di tampone e il substrato senza estratto cellulare. </li><li> Preriscaldare il piatto del lettore di piastre (Tecan Magellan v7.0) per 15 min a 37 ° C per raggiungere l&#39;equilibrio del sistema. </li><li> Aggiungi adeguate quantità di estratto cellulare (dipende dal test Bradford, la concentrazione finale di 5 mg di proteina / l). Preparare un no-proteina di controllo. </li><li> Misurare la produzione di NADH mediante uno spettrofotometro a una lunghezza d&#39;onda di 340 nm ogni 2-3 min per 1 ora a 37 ° C. &lt;/ Li&gt; <li> Calcolare il tasso di produzione di NADH dal versante del OD (340 nm). Prendere in considerazione la lunghezza del percorso di luce e il coefficiente di estinzione del NADH di 6220 M -1 cm -1. Dividere il tasso di produzione di NADH dalla quantità totale di proteine ​​aggiunte per esprimere l&#39;attività della reazione deidrogenasi nel estratto cellulare (U / mg di proteina cellula intera). Calcolare la media e la deviazione standard di tre prove indipendenti. </li></ol> 6. pCaiF Caratterizzazione <ol><li> Cultura E. coli che esprimono il pCaiF-GFP costrutto ( <a href="http://partsregistry.org/Part:BBa_K398331" target="_blank">BBa_K398331</a> ) e le cellule che trasportano il promotore da solo ( <a href="http://partsregistry.org/Part:BBa_K398326" target="_blank">BBa_K398326</a> ) durante la notte in 5 ml di terreno LB gli antibiotici appropriati durante la notte. </li><li> Inoculare 5 ml M9 contenente 10 g / l di glucosio e antibiotici con 50 microlitri della coltura durante la notte e crescere durante la notte. </li&gt; <li> Subculture 50 microlitri della outgrowth overnight in 5 ml di fresca M9 con 10 g / l ed incubare fino alla torbidità cella raggiunta una densità ottica di 0,2 a 600 nm. </li><li> Caricare una piastra a 96 pozzetti con 100 pl di mezzo fresco M9 contenente la quantità desiderata di fonte di carbonio per la prova in ciascun pozzetto. Effettuare esperimenti in triplo di valutazione statistica e aggiungere i rispettivi controlli negativi (wild-type E. coli K12). </li><li> Aggiungere 5 l di cultura overnight ai pozzetti contenenti medi. </li><li> Misurare la curva di crescita (OD 600) e GFP fluorescenza (eccitazione 485 nm e 520 di emissione) utilizzando un lettore di piastra ogni 10 min per 18 ore a 37 ° C con agitazione costante. </li><li> Calcolare il tasso di crescita e il contenuto GFP specifico dalle rispettive misurazioni e confrontare al controllo. Calcolare la media e la deviazione standard di almeno tre esperimenti indipendenti. </li></ol> 7. Tolleranza Assay <ol><li> CulturaE. coli gene che esprime PhPFDα e β ( <a href="http://partsregistry.org/Part:BBa_K398406" target="_blank">BBa_K398406</a> ) durante la notte in 5 ml di terreno LB e gli antibiotici appropriati. E. coli che esprimono LADA gene ( <a href="http://partsregistry.org/Part:BBa_K398017" target="_blank">BBa_K398017</a> ) viene usato come controllo negativo. </li><li> Subculture 10 microlitri della outgrowth overnight in fresco 5 ml di LB (con antibiotico) e incubare fino alla torbidità cella raggiunta una densità ottica da 0,3 a 0,4 a 600 nm. </li><li> Diluire le culture con terreno fresco fino a quando un OD 600 di 0,1 è stato raggiunto. </li><li> Caricare una piastra a 96 pozzetti con 180 microlitri mezzo M9 contenente antibiotici appropriati e la corretta concentrazione finale del composto tossico (per esempio 0, 4, 8, 10% di n-esano) in triplicato. Poiché alcano miscela acqua-potrebbe portare a due sistemi trifase è essenziale avere controlli appropriati sulla piastra (ad esempio dceppi ifferent e gli esperimenti relativi bianco). </li><li> Aggiungere 20 microlitri della coltura (controllo) nei pozzetti. </li><li> Misurare la concentrazione della biomassa (OD 600) utilizzando un lettore di piastra ogni 10 min per 24 ore a 37 ° C con agitazione costante. </li><li> Calcolare i tassi di crescita delle rispettive misurazioni per le diverse concentrazioni di agente e confrontare con il controllo negativo. Calcolare la media e la deviazione standard di almeno tre prove indipendenti. </li></ol> 8. Omologo Interazione Mapping <ol><li> L&#39;HIM applicazione è stata sviluppata per eseguire query di proteine ​​su un server PostgreSQL in esecuzione il database STRING (gratuito per uso accademico) 20. L&#39;interazione applicazione omologo mappatura identifica le proteine ​​che interagiscono nell&#39;organismo ospite originale utilizzando il database STRING. Le sequenze dei rispettivi geni interagenti sono utilizzati in una ricerca BLAST per trovare geni omologhi nell&#39;organismo bersaglio. Cytoscape 4 </sup&gt; è usato per visualizzare il risultato della mappatura. L&#39;HIM strumento software può essere scaricato al seguente indirizzo: <a href="https://github.com/jcnossen/InteractionHomologMapping" target="_blank">https://github.com/jcnossen/InteractionHomologMapping.</a> </li><li> Per eseguire una mappatura, (1) inserire l&#39;ID BioBrick e l&#39;applicazione scaricherà automaticamente i dati di sequenza parte dal Registro delle parti standard biologici 9, o (2) Inserire (incolla) i dati di sequenza nell&#39;applicazione. </li><li> Utilizza il sito web di database STRING per trovare l&#39;ID di proteine ​​STRING per la sequenza di entrata di amminoacidi. </li><li> Una proteina con alta omologia è determinata utilizzando BLAST. Successivamente l&#39;applicazione elenca ciascuna proteina interagente nota nell&#39;organismo di origine e cerca omologhi nell&#39;organismo ospitante (ad esempio E. coli). </li><li> Esporta elenco risultante putativo interazione al testo o Cytoscape. </li></ol>

<ol>
	<li>Allen, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Process+water+treatment+in+Canada's+oil+sands+industry:+I:+Target+pollutants+and+treatment+objectives.">Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives.</a> J. Environ. Eng. Sci. 7, 123-138 (2008).</li><li>Alon, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> An Introduction to Systems Biology: Design Principles of Biological Circuits. , (2007).</li><li>Center, O. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Understanding Oil Spills and Oil Spill Response. , (1999).</li><li>Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+the+caiF+gene+encoding+a+potential+transcriptional+activator+of+carnitine+metabolism+in+Escherichia+coli.">Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli.</a> J. Bacteriol. 178, 1248-1257 (1995).</li><li>Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+and+proteome+of+long-chain+alkane+degrading+Geobacillus+thermodenitrificans+NG80-2+isolated+from+a+deep-subsurface+oil+reservoir.">Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir.</a> Proc. Natl. Acad. Sci. U.S.A. 104 (13), 5602-5607 (2007).</li><li>Fujii, T., Narikawa, T., Takeda, K., Kato, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotransformation+of+various+alkanes+using+the+Escherichia+coli+expressing+an+alkane+hydroxylase+system+from+Gordonia+sp.+TF6.">Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6.</a> Biosci. Biotechnol. Biochem. 68 (10), 2171-2177 (2004).</li><li>Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cloning+of+an+alcohol+dehydrogenase+from+thermophilic+alkane-degrading+Bacillus+thermoleovorans+B23.">cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23.</a> J. Biosci. Bioeng. 91 (1), 100-102 (2001).</li><li>Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+cloning+and+characterization+of+an+aldehyde+dehydrogenase+from+long-chain+alkane-degrading+Geobacillus+thermoleovorans+B23.">Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23.</a> Extremophiles. 14, 33-39 (2010).</li><li>Kieboom, J., De Bont, J. a. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Bacterial Stress Responses. , (2000).</li><li>Kotte, O., Zaugg, J. B., Heinemann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+adaptation+through+distributed+sensing+of+metabolic+fluxes.">Bacterial adaptation through distributed sensing of metabolic fluxes.</a> Mol Syst Biol. 6, 355 (2010).</li><li>Kremling, A., Bettenbrock, K., Gilles, E. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+global+control+of+Escherichia+coli+carbohydrate+uptake.">Analysis of global control of Escherichia coli carbohydrate uptake.</a> BMC Syst. Biol. 1, (2007).</li><li>Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+long-chain+alkane+monooxygenase+(LadA)+in+complex+with+coenzyme+FMN:+unveiling+the+long-chain+alkane+hydroxylase.">Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase.</a> J. Mol. Biol. 376 (2), 453-465 (2008).</li><li>Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+the+maximum+specific+uptake+capacities+for+glucose+and+oxygen+in+glucose-limited+fed-batch+cultivations+of+Escherichia+coli.">Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli.</a> Biotechnol. Bioeng. 73 (5), 347-357 (2001).</li><li>Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overexpression+of+prefoldin+from+the+hyperthermophilic+archaeum+Pyrococcus+horikoshii+OT3+endowed+Escherichia+coli+with+organic+solvent+tolerance.">Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance.</a> Appl. Microbiol. Biotechnol. 79 (3), 443-449 (2008).</li><li>Rehm, H. J., Reiff, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+and+occurrence+of+microbial+oxidation+of+long-chain+alkanes.">Mechanisms and occurrence of microbial oxidation of long-chain alkanes.</a> Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).</li><li>Rojo, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Degradation+of+alkanes+by+bacteria.">Degradation of alkanes by bacteria.</a> Environ. Microbiol. 11 (10), 2477-2490 (2009).</li><li>Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Pseudomonas+putida+alkane-degradation+gene+clusters+and+flanking+insertion+sequences:+evolution+and+regulation+of+the+alk+genes.">Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes.</a> Microbiology. 147, 1621-1630 (2001).</li><li>Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+a+novel+thermophilic+Bacillus+strain+degrading+long-chain+n-alkanes.">Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes.</a> Extremophiles. 10 (4), 347-356 (2006).</li></ol>

Nessun conflitto di interessi dichiarati.

Il principio BioBrick viene utilizzato per costruire un telaio per la degradazione di alcani e una prova di principio per i singoli componenti del toolkit è stato ottenuto. Parecchi saggi sono proposto di misurare in vivo e in vitro di alcano pathway enzimi degradativi. Il lavoro presentato dimostra con successo un certo numero di metodi che possono essere utilizzati per determinare le attività enzimatiche e espressione nell&#39;ospite microrganismo E. coli dopo l&#39;implementazione di BioB...

Oil pollution is among the most serious causes of environmental contamination, and greatly affects ecosystems, businesses and communities 3. Solutions are for example required to battle the continuous oil pollution originating from the oil sands tailing waters in Alberta, Canada. During the process of oil extraction from oil sands, bitumen, a semi-solid oxidized form of oil, is removed using thermal recovery techniques that consume about 3.1 barrels of water per single barrel of oil 1. Oil contaminated process water, mainly originating from a local river, is stored in tailing ponds after bitumen extraction. A more effective recycling of process water in order to reduce the need for freshwater uptake is needed. To facilitate the bitumen extraction and to ensure that downstream sites meet water quality guidelines for the protection of aquatic ecosystems, process water treatments are rapidly evolving 3.
To treat pollution of organic compounds, bioremediation technologies employing microorganisms are presently encouraged 1. Alkanes are the most abundant family of hydrocarbons in crude oil, containing 5 to 40 carbon atoms per molecule 7, 21. Many bacteria are known to degrade alkanes of various lengths via sequential oxidation of the terminal methyl group forming first alcohols, then aldehydes and finally fatty acids 8. Within this iGEM project several enzymes from different organisms were expressed and characterized, and made available via the BioBrick standard and Registry of Standard Biological Parts.
The well-studied alkane hydroxylase system of Gordonia sp. TF6 facilitates the initial oxidation step of C5-C13 alkanes along with that of C5-C8 cycloalkanes using a minimum of four components: alkB2 (alkane 1-monooxygenase), rubA3, rubA4 (two rubredoxins) and RubB (rubredoxin reductase) 8, 21. Oxidation of long-chain alkanes (ranging from C15 up to C36) is reported to be performed by ladA, a flavoprotein alkane monooxygenase from Geobacillus thermodinitrificans NG-80-2 7, 15, 18, 22. LadA forms a catalytic complex with flavin mononucleotide (FMN) that utilizes atomic oxygen for oxidation. This results in the conversion of alkanes into the corresponding primary alkanol. The alcohols are further oxidized by alcohol and aldehyde dehydrogenases to fatty acids, which readily enter the &beta;-oxidation pathway 7, 21. A zinc-independent alcohol dehydrogenase from the thermophillic bacterium Geobacillus thermoleovorans B23 oxidizes medium-chain alkanols into their respective alkanals, using NAD+ as a cofactor 10. Aldehyde dehydrogenase from the same bacterium is able to catalyze the NAD+-dependent final step in the medium-chain oxidation 11.
In order to reduce induction costs and to maintain optimal proliferation of the bacterial system, the promoter pCaiF from E.coli was characterized. This promoter can regulate expression of the hydrocarbon degradation pathway components, and is regulated by cAMP-Crp levels, which in turn depend on glucose levels 6. At high extracellular glucose concentrations in the environment the cellular cAMP (cyclic Adenosine Mononucleotide Phosphate) level was low through the inhibition of adenylyl cyclase as a side effect of PTS mediated glucose transport. Conversely, during limitation (low glucose concentrations) the cAMP level increased and Crp bound to cAMP forming the complex, cAMP-Crp, which bound pCaiF and activated transcription of the downstream components 6, 14.
Wildtype E. coli can only tolerate moderate concentrations of hydrocarbons. To complete the toolkit, tolerance to hydrocarbons had to be addressed. Several organic solvent-tolerant bacteria are known to survive in water-solvent two-phase systems 12. Molecular components known to increase tolerance are chaperones that facilitate the correct folding of proteins. The prefoldin system from Pyrococcus horikoshii OT3, consisting of the proteins phPFD&alpha; and phPFD&beta;, was shown to increase hydrocarbon-tolerance 17.
The alkane conversion toolkit was constructed following the BioBrick principle, which is documented at the Registry of Standard Biological Parts 9. BioBricks are plasmids containing a specific functional insert that is flanked by 4 predefined restriction sites. The BioBrick inserts can be extended flexibly, allowing the construction of biological systems with new functions.

<table border="1">
	<tbody>
		<tr>
			<td>Name of the reagent</td>
			<td>Company</td>
			<td>Catalogue number</td>
			<td>Comments (optional)</td>
		</tr>
		<tr>
			<td>E. coli K12</td>
			<td>New England Biolabs</td>
			<td>C2523H</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Octane</td>
			<td>Fluka</td>
			<td>74822</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Hexadecane</td>
			<td>Fluka</td>
			<td>52209</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>octanol-1</td>
			<td>Fluka</td>
			<td>95446</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>dodecanol-1</td>
			<td>Sigma-Aldrich</td>
			<td>126799</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Hexane</td>
			<td>Sigma-Aldrich</td>
			<td>296090</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>NADH</td>
			<td>Sigma</td>
			<td>N4505</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>FMN</td>
			<td>Sigma</td>
			<td>F2253</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>J.T. Baker Casno</td>
			<td>7487 889</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T8787</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>T4 ligase</td>
			<td>New England Biolabs</td>
			<td>M0202L</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Gas chromatograph</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Cell disrupter</td>
			<td>LA Biosystems</td>
			<td>CD-019</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Amersham pharmacia</td>
			<td>spec 2000</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Plate reader</td>
			<td>Tecan</td>
			<td>Magellan v7.0</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>Innova, 44</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>BioBrick K398014: 
			BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_K398014</a></td>
			<td>Alkane Hydroxylase System 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398027: BBa_R0040-BBa_B0034-ladA</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398027" target="_blank">BBa_K398027</a></td>
			<td>ladA Protein Generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398018: BBa_J23100-BBa_J61101-ADH</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398018" target="_blank">BBa_K398018</a></td>
			<td>ADH generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398030: BBa_R0040-BBa_B0034-ALDH</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398030" target="_blank">BBa_K398030</a></td>
			<td>ALDH generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398326: pCaiF</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398326" target="_blank">BBa_K398326</a></td>
			<td>pCaiF promoter 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398331: pCaiF-BBa_B0032-BBa_I13401</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398331" target="_blank">BBa_K398331</a></td>
			<td>pCaiF measurement device 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398406: BBa_J23002-BBa_J61107-phPFD&alpha;-BBa_J61107-</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398406" target="_blank">BBa_K398406</a></td>
			<td>Solvent tolerance cluster 
			Resistance: Chloramphenicol</td>
		</tr>
	</tbody>
</table>

a toolkit to enable hydrocarbon conversion in aqueous environments

Questo lavoro propone una serie di strumenti che consente la conversione di alcani da Escherichia coli e presenta una prova di principio della sua applicabilità. Il toolkit è costituito da più parti standard intercambiabili (BioBricks) 9 riguardanti la conversione di alcani, regolazione dell&#39;espressione genica e della sopravvivenza in idrocarburi tossici ambienti ricchi. A tre fasi pathway per la degradazione alcano è stato attuato in E. coli per consentire la conversione di alcani media e lunga catena ai loro rispettivi alcanoli, alkanals e infine alcanoico-acidi. Questi ultimi sono stati metabolizzati tramite il nativo di β-ossidazione percorso. Per facilitare l&#39;ossidazione di alcani a catena media (C5-C13) e cicloalcani (C5-C8), quattro geni (alkB2, rubA3, rubA4 e Rubb) del sistema idrossilasi alcano da Gordonia sp. TF6 8,21 sono stati trasformati in E. coli. Per la conversione dialcani a catena lunga (C15-C36), il gene Lada da thermodenitrificans Geobacillus è stato attuato. Per i passaggi necessari ulteriori del processo di degradazione, ADH e ALDH (provenienti da thermodenitrificans G.) sono stati introdotti 10,11. L&#39;attività è stata misurata mediante saggi su cellule quiescenti. Per ogni passaggio ossidativo, l&#39;attività enzimatica è stata osservata. Per ottimizzare l&#39;efficienza del processo, l&#39;espressione è indotta soltanto in condizioni di glucosio basso: un substrato regolato promotore, pCaiF, è stato utilizzato. pCaiF è presente in E. coli K12 e regola l&#39;espressione dei geni coinvolti nella degradazione del glucosio non fonti di carbonio. L&#39;ultima parte del toolkit - mira sopravvivenza - è stato implementato utilizzando geni di tolleranza solventi, PhPFDα e β, sia dal Pyrococcus horikoshii OT3. Solventi organici possono indurre stress cellulare e diminuiscono la capacità di sopravvivenza di negativo affecting ripiegamento delle proteine. Come accompagnatori, PhPFDα e β migliorare il ripiegamento ad esempio processi di proteina in presenza di alcani. L&#39;espressione di questi geni ha portato ad un miglioramento della tolleranza idrocarburo mostrato da una crescita maggiore (fino al 50%) in presenze del 10% di n-esano in mezzo di coltura sono stati osservati. Riassumendo, i risultati indicano che il toolkit consente di E. coli da convertire e tollerare idrocarburi in ambienti acquosi. In quanto tale, rappresenta un primo passo verso una soluzione sostenibile per l&#39;olio-bonifica utilizzando un approccio biologia sintetica.

Alkane conversion
The activity of the three oxidation steps from the alkane to the respective fatty acid was evaluated using resting cell assays and enzyme activity measurements. The results are presented following the pathway reactions (1) alkane hydroxylase, (2) alcohol dehydrogenase and (3) aldehyde dehydrogenase. 
For the first step, different plasmids were constructed for medium and long-chain alkanes. The plasmid <a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_...

Watch this Scientific Journal Video about A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments at JoVE.com

Un kit di strumenti per consentire la conversione degli idrocarburi in ambienti acquosi | Bioingegneria | Video

A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

Un sistema di regolazione automatica sostenibile batterica per la bonifica di inquinamenti del petrolio è stato progettato utilizzando le normali parti di DNA intercambiabili (BioBricks). L&#39;ingegneria<em&gt; E. coli</emCeppo&gt; è stato usato per degradare alcani tramite β-ossidazione tossici in ambienti acquosi. Gli enzimi rispettivi di specie diverse hanno mostrato un&#39;attività alcano degrado. Inoltre, una maggiore tolleranza<em&gt; N</em&gt;-Esano è stato ottenuto con l&#39;introduzione di geni di alcano-tolleranti batteri.

Un Toolkit per permettere la conversione di idrocarburi in ambienti acquosi

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The ...

a-toolkit-to-enable-hydrocarbon-conversion-in-aqueous-environments

Education

Research

JoVE Core

JoVE Journal

Organic Chemistry

Biology

Bioengineering

Ecology

Unit 1

Ecosystems

Alkanes and Cycloalkanes

SCIENTISTS IN ACTION

14.0K Views.  Delft University of Technology. Un sistema di regolazione automatica sostenibile batterica per la bonifica di inquinamenti del petrolio è stato progettato utilizzando le normali parti di DNA intercambiabili (BioBricks). L'ingegneria E. coli è stato usato per degradare alcani tramite β-ossidazione tossici in ambienti acquosi. Gli enzimi rispettivi di specie diverse hanno mostrato un'attività alcano degrado. Inoltre, una maggiore tolleranza N-Esano è stato o...

Video: A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

Creating Two-Dimensional Patterned Substrates for Protein and Cell Confinement

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1 While microcontact printing can be employed to directly print a large number of molecules, including proteins,2 DNA,3 and silanes,4 the formation of self-assembled monolayers (SAMs) from long chain alkane thiols on gold provides a simple way to confine proteins and cells to specific patterns containing adhesive and resistant regions. This confinement can be used to control cell morphology and is useful for examining a variety of questions in protein and cell biology. Here, we describe a general method for the creation of well-defined protein patterns for cellular studies.5 This process involves three steps: the production of a patterned master using photolithography, the creation of a PDMS stamp, and microcontact printing of a gold-coated substrate. Once patterned, these cell culture substrates are capable of confining proteins and/or cells (primary cells or cell lines) to the pattern.
The use of self-assembled monolayer chemistry allows for precise control over the patterned protein/cell adhesive regions and non-adhesive regions; this cannot be achieved using direct protein stamping. Hexadecanethiol, the long chain alkane thiol used in the microcontact printing step, produces a hydrophobic surface that readily adsorbs protein from solution. The glycol-terminated thiol, used for backfilling the non-printed regions of the substrate, creates a monolayer that is resistant to protein adsorption and therefore cell growth.6 These thiol monomers produce highly structured monolayers that precisely define regions of the substrate that can support protein adsorption and cell growth. As a result, these substrates are useful for a wide variety of applications from the study of intercellular behavior7 to the creation of microelectronics.8
While other types of monolayer chemistry have been used for cell culture studies, including work from our group using trichlorosilanes to create patterns directly on glass substrates,9 patterned monolayers formed from alkane thiols on gold are straight-forward to prepare. Moreover, the monomers used for monolayer preparation are commercially available, stable, and do not require storage or handling under inert atmosphere. Patterned substrates prepared from alkane thiols can also be recycled and reused several times, maintaining cell confinement.10

Self-assembled monolayers (SAMs) formed from long chain alkane thiols on gold provide well-defined substrates for the formation of protein patterns and cell confinement. Microcontact printing of hexadecanethiol using a polydimethylsiloxane (PDMS) stamp followed by backfilling with a glycol-terminated alkane thiol monomer produces a pattern where protein and cells adsorb only to the stamped hexadecanethiol region.

La creazione di substrati Patterned bidimensionali per confinamento di proteine ​​e cellule

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1  While microcontact printing ...

Ricerca

Bioingegneria

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic valve leaflets are composed of interstitial cells suspended within an extracellular matrix (ECM) and are lined with an endothelial cell monolayer. The valve withstands a harsh, dynamic environment and is constantly exposed to shear, flexion, tension, and compression. Research has shown calcific lesions in diseased valves occur in areas of high mechanical stress as a result of endothelial disruption or interstitial matrix damage1-3. Hence, it is not surprising that epidemiological studies have shown high blood pressure to be a leading risk factor in the onset of aortic valve disease4. 
The only treatment option currently available for valve disease is surgical replacement of the diseased valve with a bioprosthetic or mechanical valve5. Improved understanding of valve biology in response to physical stresses would help elucidate the mechanisms of valve pathogenesis. In turn, this could help in the development of non-invasive therapies such as pharmaceutical intervention or prevention. Several bioreactors have been previously developed to study the mechanobiology of native or engineered heart valves6-9. Pulsatile bioreactors have also been developed to study a range of tissues including cartilage10, bone11 and bladder12. The aim of this work was to develop a cyclic pressure system that could be used to elucidate the biological response of aortic valve leaflets to increased pressure loads. 
The system consisted of an acrylic chamber in which to place samples and produce cyclic pressure, viton diaphragm solenoid valves to control the timing of the pressure cycle, and a computer to control electrical devices. The pressure was monitored using a pressure transducer, and the signal was conditioned using a load cell conditioner. A LabVIEW program regulated the pressure using an analog device to pump compressed air into the system at the appropriate rate. The system mimicked the dynamic transvalvular pressure levels associated with the aortic valve; a saw tooth wave produced a gradual increase in pressure, typical of the transvalvular pressure gradient that is present across the valve during diastole, followed by a sharp pressure drop depicting valve opening in systole. The LabVIEW program allowed users to control the magnitude and frequency of cyclic pressure. The system was able to subject tissue samples to physiological and pathological pressure conditions. This device can be used to increase our understanding of how heart valves respond to changes in the local mechanical environment.

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

A cyclic pressure bioreactor capable of subjecting heart valve tissue to physiological and pathological pressure conditions has been designed. A LabVIEW program allows users to control pressure magnitude, amplitude and frequency. This device can be used to study the mechanobiology of heart valve tissue or isolated cells.

Progettazione di un bioreattore per la pressione ciclica Ex Vivo Studio delle valvole cardiache aortica

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic ...

Electric Field-controlled Directed Migration of Neural Progenitor Cells in 2D and 3D Environments

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the central nervous system1,2. These endogenous EFs are generated by cellular regulation of ionic transport combined with the electrical resistance of cells and tissues. It has been reported that applied EF treatment can promote functional repair of spinal cord injuries in animals and humans3,4. In particular, EF-directed cell migration has been demonstrated in a wide variety of cell types5,6, including neural progenitor cells (NPCs)7,8. Application of direct current (DC) EFs is not a commonly available technique in most laboratories. We have described detailed protocols for the application of DC EFs to cell and tissue cultures previously5,11. Here we present a video demonstration of standard methods based on a calculated field strength to set up 2D and 3D environments for NPCs, and to investigate cellular responses to EF stimulation in both single cell growth conditions in 2D, and the organotypic spinal cord slice in 3D. The spinal cordslice is an ideal recipient tissue for studying NPC ex vivo behaviours, post-transplantation, because the cytoarchitectonic tissue organization is well preserved within these cultures9,10. Additionally, this ex vivo model also allows procedures that are not technically feasible to track cells in vivo using time-lapse recording at the single cell level. It is critically essential to evaluate cell behaviours in not only a 2D environment, but also in a 3D organotypic condition which mimicks the in vivo environment. This system will allow high-resolution imaging using cover glass-based dishes in tissue or organ culture with 3D tracking of single cell migration in vitro and ex vivo and can be an intermediate step before moving onto in vivo paradigms.

This protocol demonstrates methods used to establish 2D and 3D environments in custom-designed electrotactic chambers, which can track cells in vivo/ex vivo using time-lapse recording at the single cell level, in order to investigate galvanotaxis/electrotaxis and other cellular responses to direct current (DC) electric fields (EFs).

Di campo elettrico controllato migrazione diretta di cellule progenitrici neurali in ambienti 2D e 3D

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the ...

Cell Co-culture Patterning Using Aqueous Two-phase Systems

Cell patterning technologies that are fast, easy to use and affordable will be required for the future development of high throughput cell assays, platforms for studying cell-cell interactions and tissue engineered systems. This detailed protocol describes a method for generating co-cultures of cells using biocompatible solutions of dextran (DEX) and polyethylene glycol (PEG) that phase-separate when combined above threshold concentrations. Cells can be patterned in a variety of configurations using this method. Cell exclusion patterning can be performed by printing droplets of DEX on a substrate and covering them with a solution of PEG containing cells. The interfacial tension formed between the two polymer solutions causes cells to fall around the outside of the DEX droplet and form a circular clearing that can be used for migration assays. Cell islands can be patterned by dispensing a cell-rich DEX phase into a PEG solution or by covering the DEX droplet with a solution of PEG. Co-cultures can be formed directly by combining cell exclusion with DEX island patterning. These methods are compatible with a variety of liquid handling approaches, including manual micropipetting, and can be used with virtually any adherent cell type.

Aqueous two-phase systems were used to simultaneously pattern multiple populations of cells. This fast and easy method for cell patterning takes advantage of the phase separation of aqueous solutions of dextran and polyethylene glycol and the interfacial tension that exists between the two polymer solutions.

Cella Co-cultura Patterning Uso acquose due sistemi monofase

Cell patterning  technologies that are fast, easy to use and affordable will be required for the  future development of high throughput cell assays, ...

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to intrinsic parameters within the process allow a high degree of control over scaffold characteristics including fiber diameter, alignment and porosity. By developing scaffolds with similar dimensions and topographies to organ- or tissue-specific extracellular matrices (ECM), micro-environments representative to those that cells are exposed to in situ can be created. 
The airway bronchiole wall, comprised of three main micro-environments, was selected as a model tissue. Using decellularized airway ECM as a guide, we electrospun the non-degradable polymer, polyethylene terephthalate (PET), by three different protocols to produce three individual electrospun scaffolds optimized for epithelial, fibroblast or smooth muscle cell-culture. Using a commercially available bioreactor system, we stably co-cultured the three cell-types to provide an in vitro model of the airway wall over an extended time period.
This model highlights the potential for such methods being employed in in vitro diagnostic studies investigating important inter-cellular cross-talk mechanisms or assessing novel pharmaceutical targets, by providing a relevant platform to allow the culture of fully differentiated adult cells within 3D, tissue-specific environments.

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Advancements in biomaterial technologies enable the development of three-dimensional multi-cell-type constructs. We have developed electrospinning protocols to produce three individual scaffolds to culture the main structural cells of the airway to provide a 3D in vitro model of the airway bronchiole wall.

Adattamento del processo Electrospinning per fornire tre ambienti unici per un Tri-livello<em&gt; In Vitro</em&gt; Modello della parete delle vie aeree

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to ...

Photopatterning Proteins and Cells in Aqueous Environment Using TiO2 Photocatalysis

Organic contaminants adsorbed on the surface of titanium dioxide (TiO2) can be decomposed by photocatalysis under ultraviolet (UV) light. Here we describe a novel protocol employing the TiO2 photocatalysis to locally alter cell affinity of the substrate surface. For this experiment, a thin TiO2 film was sputter-coated on a glass coverslip, and the TiO2 surface was subsequently modified with an organosilane monolayer derived from octadecyltrichlorosilane (OTS), which inhibits cell adhesion. The sample was immersed in a cell culture medium, and focused UV light was irradiated to an octagonal region. When a neuronal cell line PC12 cells were plated on the sample, cells adhered only on the UV-irradiated area. We further show that this surface modification can also be performed in situ, i.e., even when cells are growing on the substrate. Proper modification of the surface required an extracellular matrix protein collagen to be present in the medium at the time of UV irradiation. The technique presented here can potentially be employed in patterning multiple cell types for constructing coculture systems or to arbitrarily manipulate cells under culture.

Photopatterning Proteins and Cells in Aqueous Environment Using TiO2 Photocatalysis

We describe a protocol for modifying cell affinity of a scaffold surface in aqueous environment. The method takes advantage of titanium dioxide photocatalysis to decompose organic film in the photo-irradiated region. We show that it can be used to create microdomains of scaffolding proteins, both ex situ and in situ.

Photopatterning proteine ​​e cellule in acquosa ambiente utilizzando TiO<sub&gt; 2</sub&gt; Fotocatalisi

Organic contaminants adsorbed on the surface of titanium dioxide (TiO2) can be decomposed by photocatalysis under ultraviolet (UV) light. Here we describe ...

Aqueous Droplets Used as Enzymatic Microreactors and Their Electromagnetic Actuation

For the successful implementation of microfluidic reaction systems, such as PCR and electrophoresis, the movement of small liquid volumes is essential. In conventional lab-on-a-chip-platforms, solvents and samples are passed through defined microfluidic channels with complex flow control installations. The droplet actuation platform presented here is a promising alternative. With it, it is possible to move a liquid drop (microreactor) on a planar surface of a reaction platform (lab-in-a-drop). The actuation of microreactors on the hydrophobic surface of the platform is based on the use of magnetic forces acting on the outer shell of the liquid drops which is made of a thin layer of superhydrophobic magnetite particles. The hydrophobic surface of the platform is needed to avoid any contact between the liquid core and the surface to allow a smooth movement of the microreactor. On the platform, one or more microreactors with volumes of 10 &#181;L can be positioned and moved simultaneously. The platform itself consists of a 3 x 3 matrix of electrical double coils which accommodate either neodymium or iron cores. The magnetic field gradients are automatically controlled. By variation of the magnetic field gradients, the microreactors' magnetic hydrophobic shell can be manipulated automatically to move the microreactor or open the shell reversibly. Reactions of substrates and corresponding enzymes can be initiated by merging the microreactors or bringing them into contact with surface immobilized catalysts.

Lab-in-a-drop reaction systems allow the versatile implementation of complex reactions in a microfluidic scale. An automated actuation platform consisting of a 3 x 3 matrix of electromagnetic coils was developed and successfully used to merge two 10 &#181;L microreactors and thereby initiate an enzymatic reaction in the resulting liquid marbles.

Acquose goccioline utilizzate come microreattori enzimatica e loro attuazione elettromagnetica

For the successful implementation of microfluidic reaction systems, such as PCR and electrophoresis, the movement of small liquid volumes is essential. In ...

Characterizing Cell Migration Within Three-dimensional In Vitro Wound Environments

Currently, most in vitro models of wound healing, such as well-established scratch assays, involve studying cell migration and wound closure on two-dimensional surfaces. However, the physiological environment in which in vivo wound healing takes place is three-dimensional rather than two-dimensional. It is becoming increasingly clear that cell behavior differs greatly in two-dimensional vs. three-dimensional environments; therefore, there is a need for more physiologically relevant in vitro models for studying cell migration behaviors in wound closure. The method described herein allows for the study of cell migration in a three-dimensional model that better reflects physiological conditions than previously established two-dimensional scratch assays. The purpose of this model is to evaluate cell outgrowth via the examination of cell migration away from a spheroid body embedded within a fibrin matrix in the presence of pro- or anti-migratory factors. Using this method, cell outgrowth from the spheroid body in a three-dimensional matrix can be observed and is easily quantifiable over time via brightfield microscopy and analysis of spheroid body area. The effect of pro-migratory and/or inhibitory factors on cell migration can also be evaluated in this system. This method provides researchers with a simple method of analyzing cell migration in three-dimensional wound associated matrices in vitro, thus increasing the relevance of in vitro cell studies prior to the use of in vivo animal models.

Characterizing Cell Migration Within Three-dimensional In Vitro Wound Environments

The goal of this protocol is to evaluate the effect of pro- and anti-migratory factors on cell migration within a three-dimensional fibrin matrix.

Che caratterizzano la migrazione delle cellule all'interno del tridimensionale In Vitro ferita ambienti

Currently, most in vitro models of wound healing, such as well-established scratch assays, involve studying cell migration and wound closure on ...

Protocol for MicroRNA Transfer into Adult Bone Marrow-derived Hematopoietic Stem Cells to Enable Cell Engineering Combined with Magnetic Targeting

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates after injection into injured tissues as well as the observed massive cell death rates lead to very restricted therapeutic effects. To overcome these limitations, we sought to establish a non-viral based protocol for suitable cell engineering prior to their administration. The modification of human CD133+ expressing SCs using microRNA (miR) loaded magnetic polyplexes was addressed with respect to uptake efficiency and safety as well as the targeting potential of the cells. Relying on our protocol, we can achieve high miR uptake rates of 80&#8211;90% while the CD133+ stem cell properties remain unaffected. Moreover, these modified cells offer the option of magnetic targeting. We describe here a safe and highly efficient procedure for the modification of CD133+ SCs. We expect this approach to provide a standard technology for optimization of therapeutic stem cell effects and for monitoring of the administered cell product via magnetic resonance imaging (MRI).

This protocol illustrates a safe and efficient procedure to modify CD133+ hematopoietic stem cells. The presented non-viral, magnetic polyplex-based approach may provide a basis for the optimization of therapeutic stem cell effects as well as for monitoring the administered cell product via magnetic resonance imaging.

Protocollo per il trasferimento di MicroRNA in adulto cellule staminali emopoietiche derivate da midollo osseo per abilitare ingegneria cellulare combinata con il Targeting magnetico

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates ...

Material Formation of Recombinant Spider Silks through Aqueous Solvation using Heat and Pressure

Many spiders produce seven types of silks. Six of the silks are fiber in form when produced by the spiders. These fibers are not water soluble. In order to reproduce the remarkable mechanical properties of spider silks, they must be produced in heterologous hosts as spiders are both territorial and cannibalistic. The synthetic analogs of spider silk also tend to be insoluble in aqueous solutions. Thus, a large percentage of research in recombinant spider silks rely upon organic solvents that are detrimental to large scale production of materials. Our group&#8217;s method forces the solvation of these recombinant spider silks into water. Remarkably, when these proteins are prepared using this method of heat and pressure, a wide range of material forms can be prepared from the same solution of recombinant spider silk proteins (rSSp) including: films, fibers, sponge, hydrogel, lyogel, and adhesives. This article demonstrates the production of the solvated rSSp and material forms in a manner that is more easily understood than from written materials and methods alone.

Here, we present a protocol to produce water soluble recombinant spider silk protein solutions and the material forms that can be formed from those solutions.

Formazione del materiale di sete di ragno ricombinante attraverso la Solvazione acquosa utilizzando calore e pressione

Many spiders produce seven types of silks. Six of the silks are fiber in form when produced by the spiders. These fibers are not water soluble. In order ...