Die Experimente in diesem Video-Artikel ausgeführt wurden für den internationalen Genetically Engineered Machine Wettbewerb 9 entwickelt. Die Autoren danken iGEM Teammitglieder Luke Bergwerff, Pieter TM van Boheemen, Jelmer Cnossen, Hugo F. Cueto Rojas und Ramon van der Valk für die Unterstützung in der Forschung. Wir danken Han de Winde, Stefan de Kok und Esengül Yıldırım für hilfreiche Diskussionen und Hosting dieser Forschung. Diese Arbeit wurde von der TU Delft University Department of Biotechnology, The Delft Bioinformatik-Labor, TU Delft Department of Bionanoscience, Oil Sands Leadership Initiative (OSLI), Stud studentenuitzendbureau, Niederlande Genomics Initiative, Kluyver Centre, Nederlandse Vereniging Biotechnologische (Stichting Biotechnology Nederland) unterstützt , DSM, Geneart, Greiner Bio-One und Genencor.

Ein. BioBrick Assembly <ol><li> BioBricks aus der Registry von Standard Biological Teile sind durch iGEM Hauptquartier zur Verfügung gestellt. Um eine neue BioBrick aus bestehenden BioBricks konstruieren, verdauen den Spender BioBrick (bis zu 1,0 ug) mit den Enzymen EcoRI und SpeI zur Positionierung der Donor Teil stromabwärts des Akzeptors Teil. Digest mit XbaI und PstI für die Positionierung des Spenders Teil stromaufwärts des Akzeptors Teil. Hinzufügen eines dritten entsprechenden Restriktionsenzym, das in der Hauptkette des Spenders schneidet. Führen Verdauungen in einem Gesamtvolumen von 20-25 ml mit dem geeigneten Puffer, nach dem Lieferanten (Endkonzentration 1x). Verwenden Sie 5 Einheiten / ug DNA für die Restriktionsenzyme. </li><li> Verdauen Akzeptor BioBrick entweder mit EcoRI und XbaI oder SpeI und PstI. </li><li> Inkubieren der Verdauungen für (mindestens) eine Stunde bei 37 ° C. Inaktivieren die Restriktionsendonukleasen durch Hitze, Inkubation bei 80 ° C für 10 min und zentrifugieren kurz. </li><li> Ligieren der verdauten BioBrickTeile (Donor und Akzeptor) zusammen. Da XbaI und SpeI generieren kompatible DNA-Enden wird ein gemischtes Website erstellt, die nicht mit einem Restriktionsenzym zu einem neuen &quot;kombinierte&quot; BioBrick, dass von den 4 Standard-Restriktionsstellen flankiert geschnitten werden. In dem Ligationsgemisch die endgültige DNA-Konzentration ist vorzugsweise ~ 100 ng / ul. Führen die Ligationsreaktion in einem Gesamtvolumen von 10-15 ml mit der T4 Ligationspuffer (Endkonzentration 1x) und T4-Ligase (1 Unit / ug DNA). </li><li> Inkubieren der Ligationsansatz bei 16 ° C für mindestens 3 Stunden. </li><li> Führen Transformation Reaktion mit circa die Hälfte der Ligationsgemisch. </li><li> Bestätigen Sie die BioBrick korrekt zu sein mit Sequenzierung. </li><li> Um eine neue BioBrick aus synthetisierten DNA-Konstrukt, ändern die Gene für die Synthese für eine optimale Expression in E. coli mittels der Website JCat Werkzeug ( <a href="http://www.jcat.de/" target="_blank">http://www.jcat.de/</a> ). Weitere Änderungen in Übereinstimmung mit den Anforderungen des B<html> ioBrick Standard. Diese Standardisierung impliziert, dass jeder BioBrick einer DNA-Sequenz von Interesse durch ein Präfix und gefolgt von einem Zusatz besteht. Das Präfix und Suffix sind Sequenzen, die vordefinierte Restriktionsstellen, die abwesend sind in den verbleibenden Plasmid-Sequenz enthalten. Diese Standard-Restriktionsstellen machen es möglich, austauschen und erweitern die BioBrick Einsätze flexibel 9. Das Präfix und Suffix haben die folgenden Sequenzen: </li></ol><table border="1"><tbody><tr><td> Name </td><td> Folge </td><td> Kommentar </td></tr><tr><td> Präfix </td><td> 5 &#39;GAATTCGCGGCCGCTTCTAG3&#39; </td><td></td></tr><tr><td></td><td> 5 &#39;GAATTCGCGGCCGCTTCTAGAG 3&#39; </td><td> Wenn das folgende Teil eine kodierende Sequenz oder ein Teil, der mit &quot;ATG&quot; beginnt </td></tr><tr><td> Suffix </td><td> 5 &#39;TACTAGTAGCGGCCGCTGCAG 3&#39; </td><td></td></tr></tbody></table>ove_title &quot;&gt; 2. Alkane Conversion Resting Zell-Assay, In Vivo Dieser Assay wurde basierend auf der Methode von Fujii et al. (2004) beschriebenen Verfahren durchgeführt. <ol><li> Kultur E. coli Zellen, die das Alkanhydroxylase-System ( <a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_K398014</a> ) und Zellen, die einen leeren Vektor ( <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> ) in 5 ml LB-Medium mit den entsprechenden Antibiotika über Nacht. </li><li> Übertragen 500 ul der Übernachtkultur in 50 ml frisches LB (mit Antibiotikum) und inkubieren, bis die Zelle Trübung eine OD (optische Dichte) von 0,3 bei 600 nm. </li><li> Zentrifuge für 10 min bei 4.000 rpm und das Pellet in 5 ml 0,1 M Phosphatpuffer (pH 7,4). </li><li> Zentrifugieren für 10 min bei 4.000 rpm und das Pellet in 5 ml 0,1 M Phosphatpuffer nun enthaltenden E2 Salze und 0,66% v / v Glycerin (Stickstoff-Mangelerscheinungent medium). </li><li> Messung der Trübung Zelle (OD 600). </li><li> Planen Zell-Gemisch von 6 ml Aliquots in 25 ml geschlossenen Kappe Glaskolben und No-Zellkontrollen (E2 Salze + 0,66% v / v Glycerol). </li><li> Fügen Sie 100 nmol von Alkan zu jeder Flasche. </li><li> Inkubieren der Mischungen bei 37 ° C für 24 h (verkürzen, wenn höhere Raten erzielt werden). </li><li> Messen Sie die OD 600 nach Inkubation. </li><li> Extrahieren der Kohlenwasserstoffe in den Kulturmedien durch Ethylacetat und bestimmen Kohlenwasserstoffkonzentration in Zellkultur durch Gaschromatographie (siehe Protokoll 3). </li><li> Berechnen den Abbau von Biomasse pro Zeiteinheit durch Teilen der Gesamtmenge des Alkans durch die gesamte Biomasse in jedem Kolben (konvertieren OD 600 auf Trockenmasse) umgerechnet. Teilen des Ergebnisses durch die Versuchsdauer ergibt die Abbauaktivität pro Biomasse pro Zeiteinheit. Der Durchschnitt wird aus drei einzelnen Läufe genommen. </li></ol> 3. Alkan Conversion-Enzym-Assay, InVitro Dieser Assay wurde im Wesentlichen nach der Methode von Li et al. (2008) beschriebenen Verfahren durchgeführt. <ol><li> Kultur E. coli-Zellen, die Lada-Gen ( <a href="http://partsregistry.org/Part:BBa_K398017" target="_blank">BBa_K398017</a> ) und Zellen, die einen leeren Vektor ( <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> ) in 50 ml LB-Medium mit entsprechenden Antibiotika über Nacht. </li><li> Übertragen 500 ul der Übernachtkultur in 50 ml frisches LB (mit Antibiotikum) und inkubieren, bis die Zelle Trübung erreicht eine optische Dichte von 0,6 bei 600 nm. </li><li> Zentrifuge 10 min bei 4000 rpm (4 ° C) und das Pellet in 5 ml 50 mM Tris-Puffer. </li><li> Beschallen (Cell Disruptor, LA Biosystems) wurden die Zellen bei 40% Einschaltdauer mit einer Leistung Steuerung von 4, halten Sie die Lösung auf Eis für die gesamte Dauer. </li><li> Zentrifugieren der resultierenden Mischung für 5 Minuten bei 4000 rpm bei 4 &amp; dzB, C, um die Zelltrümmer zu entfernen. Den Überstand in ein frisches Röhrchen. </li><li> Bestimmen die Gesamtproteinkonzentration der Zellextrakte nach Bradford. Hinweis: Verwenden Sie Glasfläschchen, die Erhöhung der Hintergrund und / oder Verlust des Proteins zu verhindern. </li><li> Vorbereiten einer Mischung, enthaltend 100 ml 0,1% v / v Alkan und 50 mM Tris-HCl-Puffer. </li><li> Das Gemisch wird bei 100 ° C für 5 min. Hinweis: Führen Sie diesen Schritt nur für mittel-bis langfristige Alkane mit hohem Siedepunkt. (ZB C 16: 287 ° C). </li><li> Um eine optimale Löslichkeit des Alkans zu erreichen, für 1 min und noch warm, bis eine homogene, viskose Mischung erhalten beschallen. </li><li> Hinzufügen 1mM von NADH, 1 mM FMN, 1 mM MgSO 4 und 0,01 v / v Triton X-100. </li><li> Bereiten Sie 6 ml Aliquots in 25 ml geschlossener Kappe Kolben. </li><li> Hinzufügen ausreichender Mengen von Zellextrakt (abhängig von Bradford-Assays, Endkonzentration von 5 mg Protein / l). Bereiten Sie eine nicht-Protein-Kontrolle. </li><li> Inkubieren bei 60 ° C (für eine optimale Enzymatic Aktivität) für 24 Stunden. </li><li> Extrahieren der Kohlenwasserstoffe in den Kulturmedien durch Ethylacetat und bestimmen Kohlenwasserstoffkonzentration in Zellkultur durch Gaschromatographie (siehe Protokoll 3). </li><li> Berechnen den Abbau von Biomasse pro Zeiteinheit durch Teilen der Gesamtmenge des Alkans durch Gesamtprotein umgewandelt hinzugefügt zu jedem Kolben (durch Bradford Eichkurve). Weitere Division durch Versuchsdauer ergibt die Abbauaktivität pro Einheit des zellulären Proteins pro Zeiteinheit. Der Durchschnitt wird aus drei einzelnen Läufe genommen. </li></ol> 4. Ethylacetat Hydrocarbon Extraction und Konzentrationsmessung <ol><li> Alkane werden aus der wässrigen Lösung durch Zugabe von 2,5 ml Ethylacetat (apolaren solvant) bis 6 ml experimentelle Lösung extrahiert. Ein interner Standard wird zum Lösungsmittel in einer Konzentration von 0,1% (v / v) zugegeben. Der Standard (z. B. Cyclo-decan) variiert in Abhängigkeit von der erwarteten Bereich der Spitzen von Interesse. </li><li> Optional: Add TritonX-100 zu der wässrigen Mischung und Zentrifugieren der Proben für 10 min bei 4.000 UpM, um eine ordnungsgemäße zweiphasige System zu erhalten. </li><li> Vortex die Mischung für 5 sec (1.500 rpm) und bei Raumtemperatur inkubieren, bis die beiden Phasen getrennt. </li><li> Entfernen einer maximalen Menge der organischen Schicht (oben) und Trocknen des Lösungsmittels unter Verwendung von wasserfreiem Magnesiumsulfat getrocknet. </li><li> Entfernen MgSO 4 durch Filtration (0,2 pm) und übertragen das Filtrat in Gaschromatographen Fläschchen für Messungen oder bei -20 ° C. </li><li> Bestimmen Sie die Konzentration durch Gaschromatographie unter Verwendung einer CP-SIL 5CB Säule (Länge = 5 m). Jeweils 10 ul Probe im Split-Modus (1:10, 230 ° C). Setzen der Säule Gasströmung auf 1 ml / min (Helium). Im folgenden Ofentemperatur Programm wird verwendet: <table border="1"><tbody><tr><td> Rate </td><td> Temperatur [° C] </td><td> Zeit [min] </td></tr><tr><td> 0 </td><td> 50 </td><td> 7,5 </td></tr><tr><td> 50 </td><td> 90 </td><td> 1,0 </td></tr><tr><td> 50 </td><td> 110 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 130 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 145 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 160 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 170 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 185 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 210 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 250 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 320 </td><td> 2,0 </td></tr></tbody></table></li><li> Integrieren Gipfeln und korrigieren die Konzentrationen gegenüber dem internen Standard. </li></ol> 5. Alkohol / Aldehyd-Dehydrogenase-Aktivitäts-Assay Dieser Assay wurde im Wesentlichen nach der Methode von Kato et al beschriebenen Verfahren durchgeführt.(2010). <ol><li> Kultur E. coli Zellen, die das ADH ( <a href="http://partsregistry.org/Part:BBa_K398018" target="_blank">BBa_K398018</a> ) oder ALDH ( <a href="http://partsregistry.org/Part:BBa_K398030" target="_blank">BBa_K398030</a> )-Gen und Zellen, die einen leeren Vektor ( <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> ) in 50 ml LB-Medium mit den entsprechenden Antibiotika über Nacht. </li><li> Übertragen 500 ul der Übernachtkultur in 50 ml frisches LB (mit Antibiotikum) und inkubieren, bis die Zelle Trübung erreicht eine optische Dichte von 0,6 bei 600 nm. </li><li> Zentrifuge 10 min bei 4000 rpm bei 4 ° C und das Pellet in 5 ml 50 mM Tris-Puffer. </li><li> Beschallen die Zelle bei 40% Einschaltdauer mit einer Leistung Kontrolle 4 (halten Sie die Lösung auf Eis während der Ultraschallbehandlung). </li><li> Zentrifugieren der resultierenden Mischung für 5 Minuten bei 4000 rpm bei 4 ° C, um Zelltrümmer zu entfernen. </li><li> Bestimmen Sie die zutal Proteinkonzentration der Zellextrakte nach Bradford (Hinweis: Verwenden Sie ein Glasfläschchen, um Protein-Bindung zu verhindern). </li><li> Legen Sie eine 96-Well-Platte mit 180 ul 57 mM Glycin-Puffer, der NAD (Endkonzentration 1 mM, pH 9,5) in jedes Well. </li><li> Hinzufügen 5 ul des Alkohols (Aldehyd), um in die Vertiefungen getestet werden. Anmerkung: Wärme langkettige Alkohole vor Beginn des Assays, um eine Flüssigkeit haben. Für jede Alkohol (Aldehyd) eine Kontrolle ohne Substrat sollte hinzugefügt (negative Kontrolle) werden. Zusätzlich wird eine Blindlösung, die eine Mischung aus Puffer und dem Substrat ohne Zellextrakt. </li><li> Vorheizen Platte des Plattenlesers (Tecan Magellan v7.0) für 15 min bei 37 ° C bis Äquilibrierung des Systems zu ermöglichen. </li><li> Hinzufügen ausreichender Mengen von Zellextrakt (abhängig von Bradford-Assays, Endkonzentration von 5 mg Protein / l). Bereiten Sie eine nicht-Protein-Kontrolle. </li><li> Messung der NADH-Produktion mit einem Spektralphotometer bei einer Wellenlänge von 340 nm alle 2-3 Min. für 1 Stunde bei 37 ° C &lt;/ Li&gt; <li> Berechnen den NADH-Produktionsrate von der Steigung der OD (340 nm). Berücksichtigen Sie das Licht Weglänge und des Extinktionskoeffizienten von NADH von 6220 M -1 cm -1. Unterteilen den NADH-Produktionsrate von der Gesamtmenge an Protein hinzugefügt, um die Aktivität des Dehydrogenaseumsetzung im Zellextrakt (U / mg gesamten Zellproteins) exprimieren. Berechnen des Mittelwertes und der Standardabweichung aus drei unabhängigen Läufen. </li></ol> 6. pCaiF Charakterisierung <ol><li> Kultur E. coli Zellen, die das Konstrukt pCaiF-GFP ( <a href="http://partsregistry.org/Part:BBa_K398331" target="_blank">BBa_K398331</a> ) und Zellen, die den Promotor alleine ( <a href="http://partsregistry.org/Part:BBa_K398326" target="_blank">BBa_K398326</a> ) über Nacht in 5 ml LB-Medium über Nacht die entsprechenden Antibiotika. </li><li> Beimpfen 5 ml M9 mit 10 g / l Glukose und Antibiotika mit 50 ul der Übernachtkultur und wachsen über Nacht. </li&gt; <li> Subkultur 50 ul der Übernacht-Auswuchs in 5 ml frisches M9 mit 10 g / l und inkubieren, bis die Zelle Trübung erreicht eine optische Dichte von 0,2 bei 600 nm aufweist. </li><li> Laden einer Platte mit 96 Vertiefungen mit 100 ml frisches M9-Medium, das die gewünschte Menge an Kohlenstoffquelle zum Prüfen in jeder Vertiefung. Führen Dreifachversuche der statistischen Auswertung und fügen Sie die entsprechenden negativen Kontrollen (Wildtyp E. coli K12). </li><li> Fügen Sie 5 ul der Übernachtkultur den Medium mit Brunnen. </li><li> Messung der Wachstumskurve (OD 600) und GFP-Fluoreszenz (485 nm Anregung und 520 Emission) unter Verwendung eines Plattenlesegeräts alle 10 min für 18 Stunden bei 37 ° C unter konstantem Schütteln inkubiert. </li><li> Berechnen Sie die Wachstumsrate und die spezifische GFP Inhalte aus den jeweiligen Messungen und vergleichen Sie die Kontrolle. Berechnen des Mittelwertes und der Standardabweichung von mindestens drei unabhängigen Experimenten. </li></ol> 7. Toleranz Assay <ol><li> KulturE. coli, PhPFDα und β-Gen ( <a href="http://partsregistry.org/Part:BBa_K398406" target="_blank">BBa_K398406</a> ) über Nacht in 5 ml LB-Medium und den entsprechenden Antibiotika. E. coli exprimierenden Lada Gen ( <a href="http://partsregistry.org/Part:BBa_K398017" target="_blank">BBa_K398017</a> ) als negative Kontrolle verwendet. </li><li> Subkultur 10 ul der Übernacht-Auswuchs in frisches 5 ml LB (mit Antibiotikum) und inkubieren, bis die Zelle Trübung erreicht eine optische Dichte von 0,3 bis 0,4 bei 600 nm aufweist. </li><li> Verdünnen Sie die Kulturen mit frischem Medium, bis eine OD 600 von 0,1 erreicht ist. </li><li> Laden einer Platte mit 96 Vertiefungen mit 180 ul M9 Medium mit den entsprechenden Antibiotika und die korrekte Endkonzentration der toxischen Verbindung (zB 0, 4, 8, 10% n-Hexan) in dreifacher Ausfertigung. Weil Alkan-Wasser-Gemischen zu zweiphasigen Systemen führen können ist es notwendig, geeignete Bedienelemente auf der Platte haben (zB dUNTERSCHIEDLICHE Stämme und die jeweiligen leere Experimente). </li><li> Fügen Sie 20 ul der Kultur (Kontrolle) in die Vertiefungen. </li><li> Messung der Biomassekonzentration (OD 600) unter Verwendung eines Plattenlesegeräts alle 10 min für 24 Stunden bei 37 ° C unter konstantem Schütteln inkubiert. </li><li> Berechnen Sie die Wachstumsraten aus den jeweiligen Messungen für die verschiedenen Wirkstoffkonzentrationen und im Vergleich zu der negativen Kontrolle. Berechnen des Mittelwertes und der Standardabweichung von mindestens drei unabhängigen Läufen. </li></ol> 8. Homolog Interaction Mapping <ol><li> Die Anwendung HIM wurde entwickelt, um Protein-Abfragen auf einer PostgreSQL-Server mit dem STRING-Datenbank (kostenlos für den akademischen Gebrauch) 20 durchzuführen. Das Homologe Interaktion Mapping-Anwendung identifiziert interagierende Proteine ​​in der ursprünglichen Wirtsorganismus mit dem STRING-Datenbank. Die Sequenzen der entsprechenden Gene sind in Wechselwirkung einer BLAST-Suche, um homologe Gene in den Zielorganismus finden verwendet. Cytoscape 4 </sbis&gt; verwendet wird, um das Ergebnis der Zuordnung zu visualisieren. : Die HIM-Software-Tool kann unter folgender Adresse heruntergeladen werden <a href="https://github.com/jcnossen/InteractionHomologMapping" target="_blank">https://github.com/jcnossen/InteractionHomologMapping.</a> </li><li> Um eine Zuordnung durchführen, (1) geben Sie die BioBrick ID und die Anwendung wird automatisch die Teilsequenz Daten aus der Registry von Standard Biological Parts 9 oder (2) Geben (Paste) der Sequenzdaten in der Anwendung. </li><li> Verwenden Sie den STRING Database Website, um die String-Protein-ID für die eingegebenen Aminosäuresequenz zu finden. </li><li> Ein Protein mit hoher Homologie wird unter Verwendung BLAST. Anschließend wird die Anwendung listet jeden bekannten interagierende Protein in der Quelle Organismus und sucht nach Homologen im Wirtsorganismus (zB E. coli). </li><li> Export resultierenden vermeintlichen Interaktion Liste Text oder Cytoscape. </li></ol>

<ol>
	<li>Allen, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Process+water+treatment+in+Canada's+oil+sands+industry:+I:+Target+pollutants+and+treatment+objectives.">Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives.</a> J. Environ. Eng. Sci. 7, 123-138 (2008).</li><li>Alon, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> An Introduction to Systems Biology: Design Principles of Biological Circuits. , (2007).</li><li>Center, O. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Understanding Oil Spills and Oil Spill Response. , (1999).</li><li>Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+the+caiF+gene+encoding+a+potential+transcriptional+activator+of+carnitine+metabolism+in+Escherichia+coli.">Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli.</a> J. Bacteriol. 178, 1248-1257 (1995).</li><li>Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+and+proteome+of+long-chain+alkane+degrading+Geobacillus+thermodenitrificans+NG80-2+isolated+from+a+deep-subsurface+oil+reservoir.">Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir.</a> Proc. Natl. Acad. Sci. U.S.A. 104 (13), 5602-5607 (2007).</li><li>Fujii, T., Narikawa, T., Takeda, K., Kato, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotransformation+of+various+alkanes+using+the+Escherichia+coli+expressing+an+alkane+hydroxylase+system+from+Gordonia+sp.+TF6.">Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6.</a> Biosci. Biotechnol. Biochem. 68 (10), 2171-2177 (2004).</li><li>Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cloning+of+an+alcohol+dehydrogenase+from+thermophilic+alkane-degrading+Bacillus+thermoleovorans+B23.">cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23.</a> J. Biosci. Bioeng. 91 (1), 100-102 (2001).</li><li>Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+cloning+and+characterization+of+an+aldehyde+dehydrogenase+from+long-chain+alkane-degrading+Geobacillus+thermoleovorans+B23.">Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23.</a> Extremophiles. 14, 33-39 (2010).</li><li>Kieboom, J., De Bont, J. a. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Bacterial Stress Responses. , (2000).</li><li>Kotte, O., Zaugg, J. B., Heinemann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+adaptation+through+distributed+sensing+of+metabolic+fluxes.">Bacterial adaptation through distributed sensing of metabolic fluxes.</a> Mol Syst Biol. 6, 355 (2010).</li><li>Kremling, A., Bettenbrock, K., Gilles, E. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+global+control+of+Escherichia+coli+carbohydrate+uptake.">Analysis of global control of Escherichia coli carbohydrate uptake.</a> BMC Syst. Biol. 1, (2007).</li><li>Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+long-chain+alkane+monooxygenase+(LadA)+in+complex+with+coenzyme+FMN:+unveiling+the+long-chain+alkane+hydroxylase.">Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase.</a> J. Mol. Biol. 376 (2), 453-465 (2008).</li><li>Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+the+maximum+specific+uptake+capacities+for+glucose+and+oxygen+in+glucose-limited+fed-batch+cultivations+of+Escherichia+coli.">Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli.</a> Biotechnol. Bioeng. 73 (5), 347-357 (2001).</li><li>Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overexpression+of+prefoldin+from+the+hyperthermophilic+archaeum+Pyrococcus+horikoshii+OT3+endowed+Escherichia+coli+with+organic+solvent+tolerance.">Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance.</a> Appl. Microbiol. Biotechnol. 79 (3), 443-449 (2008).</li><li>Rehm, H. J., Reiff, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+and+occurrence+of+microbial+oxidation+of+long-chain+alkanes.">Mechanisms and occurrence of microbial oxidation of long-chain alkanes.</a> Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).</li><li>Rojo, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Degradation+of+alkanes+by+bacteria.">Degradation of alkanes by bacteria.</a> Environ. Microbiol. 11 (10), 2477-2490 (2009).</li><li>Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Pseudomonas+putida+alkane-degradation+gene+clusters+and+flanking+insertion+sequences:+evolution+and+regulation+of+the+alk+genes.">Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes.</a> Microbiology. 147, 1621-1630 (2001).</li><li>Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+a+novel+thermophilic+Bacillus+strain+degrading+long-chain+n-alkanes.">Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes.</a> Extremophiles. 10 (4), 347-356 (2006).</li></ol>

Keine Interessenskonflikte erklärt.

Die BioBrick Prinzip wird ein Fahrwerk für den Abbau von Alkanen zu konstruieren und einen Beweis des Prinzips für die einzelnen Komponenten des Toolkits wurde erhalten. Mehrere Tests werden vorgeschlagen, um die in vivo und in-vitro-Aktivität von Alkan abbauenden Stoffwechselenzyme messen. Die vorliegende Arbeit demonstriert erfolgreich eine Reihe von Methoden, die verwendet werden, um Enzymaktivitäten und Ausdruck in der Wirtsorganismus E. bestimmt werden kann coli nach der Impl...

Oil pollution is among the most serious causes of environmental contamination, and greatly affects ecosystems, businesses and communities 3. Solutions are for example required to battle the continuous oil pollution originating from the oil sands tailing waters in Alberta, Canada. During the process of oil extraction from oil sands, bitumen, a semi-solid oxidized form of oil, is removed using thermal recovery techniques that consume about 3.1 barrels of water per single barrel of oil 1. Oil contaminated process water, mainly originating from a local river, is stored in tailing ponds after bitumen extraction. A more effective recycling of process water in order to reduce the need for freshwater uptake is needed. To facilitate the bitumen extraction and to ensure that downstream sites meet water quality guidelines for the protection of aquatic ecosystems, process water treatments are rapidly evolving 3.
To treat pollution of organic compounds, bioremediation technologies employing microorganisms are presently encouraged 1. Alkanes are the most abundant family of hydrocarbons in crude oil, containing 5 to 40 carbon atoms per molecule 7, 21. Many bacteria are known to degrade alkanes of various lengths via sequential oxidation of the terminal methyl group forming first alcohols, then aldehydes and finally fatty acids 8. Within this iGEM project several enzymes from different organisms were expressed and characterized, and made available via the BioBrick standard and Registry of Standard Biological Parts.
The well-studied alkane hydroxylase system of Gordonia sp. TF6 facilitates the initial oxidation step of C5-C13 alkanes along with that of C5-C8 cycloalkanes using a minimum of four components: alkB2 (alkane 1-monooxygenase), rubA3, rubA4 (two rubredoxins) and RubB (rubredoxin reductase) 8, 21. Oxidation of long-chain alkanes (ranging from C15 up to C36) is reported to be performed by ladA, a flavoprotein alkane monooxygenase from Geobacillus thermodinitrificans NG-80-2 7, 15, 18, 22. LadA forms a catalytic complex with flavin mononucleotide (FMN) that utilizes atomic oxygen for oxidation. This results in the conversion of alkanes into the corresponding primary alkanol. The alcohols are further oxidized by alcohol and aldehyde dehydrogenases to fatty acids, which readily enter the &beta;-oxidation pathway 7, 21. A zinc-independent alcohol dehydrogenase from the thermophillic bacterium Geobacillus thermoleovorans B23 oxidizes medium-chain alkanols into their respective alkanals, using NAD+ as a cofactor 10. Aldehyde dehydrogenase from the same bacterium is able to catalyze the NAD+-dependent final step in the medium-chain oxidation 11.
In order to reduce induction costs and to maintain optimal proliferation of the bacterial system, the promoter pCaiF from E.coli was characterized. This promoter can regulate expression of the hydrocarbon degradation pathway components, and is regulated by cAMP-Crp levels, which in turn depend on glucose levels 6. At high extracellular glucose concentrations in the environment the cellular cAMP (cyclic Adenosine Mononucleotide Phosphate) level was low through the inhibition of adenylyl cyclase as a side effect of PTS mediated glucose transport. Conversely, during limitation (low glucose concentrations) the cAMP level increased and Crp bound to cAMP forming the complex, cAMP-Crp, which bound pCaiF and activated transcription of the downstream components 6, 14.
Wildtype E. coli can only tolerate moderate concentrations of hydrocarbons. To complete the toolkit, tolerance to hydrocarbons had to be addressed. Several organic solvent-tolerant bacteria are known to survive in water-solvent two-phase systems 12. Molecular components known to increase tolerance are chaperones that facilitate the correct folding of proteins. The prefoldin system from Pyrococcus horikoshii OT3, consisting of the proteins phPFD&alpha; and phPFD&beta;, was shown to increase hydrocarbon-tolerance 17.
The alkane conversion toolkit was constructed following the BioBrick principle, which is documented at the Registry of Standard Biological Parts 9. BioBricks are plasmids containing a specific functional insert that is flanked by 4 predefined restriction sites. The BioBrick inserts can be extended flexibly, allowing the construction of biological systems with new functions.

<table border="1">
	<tbody>
		<tr>
			<td>Name of the reagent</td>
			<td>Company</td>
			<td>Catalogue number</td>
			<td>Comments (optional)</td>
		</tr>
		<tr>
			<td>E. coli K12</td>
			<td>New England Biolabs</td>
			<td>C2523H</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Octane</td>
			<td>Fluka</td>
			<td>74822</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Hexadecane</td>
			<td>Fluka</td>
			<td>52209</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>octanol-1</td>
			<td>Fluka</td>
			<td>95446</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>dodecanol-1</td>
			<td>Sigma-Aldrich</td>
			<td>126799</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Hexane</td>
			<td>Sigma-Aldrich</td>
			<td>296090</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>NADH</td>
			<td>Sigma</td>
			<td>N4505</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>FMN</td>
			<td>Sigma</td>
			<td>F2253</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>J.T. Baker Casno</td>
			<td>7487 889</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T8787</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>T4 ligase</td>
			<td>New England Biolabs</td>
			<td>M0202L</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Gas chromatograph</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Cell disrupter</td>
			<td>LA Biosystems</td>
			<td>CD-019</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Amersham pharmacia</td>
			<td>spec 2000</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Plate reader</td>
			<td>Tecan</td>
			<td>Magellan v7.0</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>Innova, 44</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>BioBrick K398014: 
			BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_K398014</a></td>
			<td>Alkane Hydroxylase System 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398027: BBa_R0040-BBa_B0034-ladA</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398027" target="_blank">BBa_K398027</a></td>
			<td>ladA Protein Generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398018: BBa_J23100-BBa_J61101-ADH</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398018" target="_blank">BBa_K398018</a></td>
			<td>ADH generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398030: BBa_R0040-BBa_B0034-ALDH</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398030" target="_blank">BBa_K398030</a></td>
			<td>ALDH generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398326: pCaiF</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398326" target="_blank">BBa_K398326</a></td>
			<td>pCaiF promoter 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398331: pCaiF-BBa_B0032-BBa_I13401</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398331" target="_blank">BBa_K398331</a></td>
			<td>pCaiF measurement device 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398406: BBa_J23002-BBa_J61107-phPFD&alpha;-BBa_J61107-</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398406" target="_blank">BBa_K398406</a></td>
			<td>Solvent tolerance cluster 
			Resistance: Chloramphenicol</td>
		</tr>
	</tbody>
</table>

a toolkit to enable hydrocarbon conversion in aqueous environments

Diese Arbeit schlägt eine Toolkit, das die Umwandlung von Alkanen ermöglicht durch Escherichia coli und präsentiert ein Beweis für das Prinzip ihrer Anwendbarkeit. Das Toolkit besteht aus mehreren Standard-austauschbare Teile (BioBricks) 9 Bewältigung der Umwandlung von Alkanen, Regulation der Genexpression und Überleben in giftige Kohlenwasserstoff-reiche Umgebungen. Ein Drei-Schritt-Weg für Alkan-Abbau wurde in E. implementiert coli, die Umwandlung von mittel-und langkettige Alkane, ihre jeweiligen Alkanole, Alkanale und letztlich Alkan-Säuren ermöglichen. Letztere wurden über die native β-Oxidationsweg metabolisiert. Um die Oxidation des Mediums Alkane (C5-C13) und Cycloalkanen (C5-C8), vier Gene (alkB2, rubA3, rubA4 und Rubb) der Alkanhydroxylase-System von Gordonia sp erleichtern. TF6 8,21 wurden in E. transformierten coli. Für die Umwandlung vonlangkettige Alkane (C15-C36) wurde der Lada-Gen aus Geobacillus thermodenitrificans umgesetzt. Für die erforderlichen weiteren Schritte des Abbauprozesses wurden ADH und ALDH (aus G. thermodenitrificans) 10,11 eingeführt. Die Aktivität wurde durch ruhende Zelle Assays gemessen. Für jede oxidative Schritt wurde Enzymaktivität beobachtet. Um den Prozess zu optimieren, wurde die Expression nur unter Bedingungen induziert niedrigen Glucose: ein Substrat-regulierte Promotor, pCaiF, wurde verwendet. pCaiF ist in E. coli K12 und reguliert die Expression der Gene in den Abbau von Nicht-Glucose-Kohlenstoffquelle beteiligt. Der letzte Teil des Toolkits - Targeting Überleben - umgesetzt wurde unter Verwendung von Lösungsmittel Toleranz Gene, PhPFDα und β, die beide aus Pyrococcus horikoshii OT3. Organische Lösemittel induzieren können Zellstress und verringerte Überlebensfähigkeit durch negativ affecting Proteinfaltung. Als Chaperone, verbessern PhPFDα und β das Protein Faltvorgang zB unter Anwesenheit von Alkanen. Die Expression dieser Gene führte zu einer verbesserten Toleranz Kohlenwasserstoff durch eine erhöhte Wachstumsrate (bis 50%) in den Anwesenheiten von 10% n-Hexan im Kulturmedium dargestellt beobachtet. Zusammenfassend zeigen die Ergebnisse, dass das Toolkit E. ermöglicht coli zu konvertieren und tolerieren Kohlenwasserstoffe in wässriger Umgebung. Als solche ist sie ein erster Schritt hin zu einer nachhaltigen Lösung für die Öl-Sanierung mit Hilfe eines synthetischen Biologie Ansatz.

Alkane conversion
The activity of the three oxidation steps from the alkane to the respective fatty acid was evaluated using resting cell assays and enzyme activity measurements. The results are presented following the pathway reactions (1) alkane hydroxylase, (2) alcohol dehydrogenase and (3) aldehyde dehydrogenase. 
For the first step, different plasmids were constructed for medium and long-chain alkanes. The plasmid <a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_...

Watch this Scientific Journal Video about A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments at JoVE.com

Ein Toolkit zur Ermöglichung der Kohlenwasserstoffumwandlung in wässrigen Umgebungen | Bioingenieurwesen | Video

A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

Eine nachhaltige auto Regulierung bakteriellen System für die Sanierung von Ölverschmutzungen wurde entwickelt, unter Verwendung von Standard austauschbare DNA Teile (BioBricks). Ein ausgereiftes<em&gt; E. coli</em&gt; Stamm wurde verwendet, um Alkane via β-Oxidation in toxischen wässrigen Umgebungen beeinträchtigen. Die entsprechenden Enzyme aus verschiedenen Arten zeigten Alkan Abbauaktivität. Darüber hinaus wird ein erhöhter Toleranz gegenüber<em&gt; N</em&gt;-Hexan wurde durch Einbringen von Genen aus Alkan-tolerante Bakterien erreicht.

Ein Toolkit zur Umwandlung von Kohlenwasserstoffen in wässrigen Umgebungen aktivieren

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The ...

a-toolkit-to-enable-hydrocarbon-conversion-in-aqueous-environments

Education

Research

JoVE Core

JoVE Journal

Organic Chemistry

Biology

Bioengineering

Ecology

Unit 1

Ecosystems

Alkanes and Cycloalkanes

SCIENTISTS IN ACTION

14.0K Aufrufe.  Delft University of Technology. Eine nachhaltige auto Regulierung bakteriellen System für die Sanierung von Ölverschmutzungen wurde entwickelt, unter Verwendung von Standard austauschbare DNA Teile (BioBricks). Ein ausgereiftes E. coli Stamm wurde verwendet, um Alkane via β-Oxidation in toxischen wässrigen Umgebungen beeinträchtigen. Die entsprechenden Enzyme aus verschiedenen Arten zeigten Alkan Abbauaktivität. Darüber hinaus wird ein erhöhter Toleranz gegenüber N...

Serie: A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

Creating Two-Dimensional Patterned Substrates for Protein and Cell Confinement

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1 While microcontact printing can be employed to directly print a large number of molecules, including proteins,2 DNA,3 and silanes,4 the formation of self-assembled monolayers (SAMs) from long chain alkane thiols on gold provides a simple way to confine proteins and cells to specific patterns containing adhesive and resistant regions. This confinement can be used to control cell morphology and is useful for examining a variety of questions in protein and cell biology. Here, we describe a general method for the creation of well-defined protein patterns for cellular studies.5 This process involves three steps: the production of a patterned master using photolithography, the creation of a PDMS stamp, and microcontact printing of a gold-coated substrate. Once patterned, these cell culture substrates are capable of confining proteins and/or cells (primary cells or cell lines) to the pattern.
The use of self-assembled monolayer chemistry allows for precise control over the patterned protein/cell adhesive regions and non-adhesive regions; this cannot be achieved using direct protein stamping. Hexadecanethiol, the long chain alkane thiol used in the microcontact printing step, produces a hydrophobic surface that readily adsorbs protein from solution. The glycol-terminated thiol, used for backfilling the non-printed regions of the substrate, creates a monolayer that is resistant to protein adsorption and therefore cell growth.6 These thiol monomers produce highly structured monolayers that precisely define regions of the substrate that can support protein adsorption and cell growth. As a result, these substrates are useful for a wide variety of applications from the study of intercellular behavior7 to the creation of microelectronics.8
While other types of monolayer chemistry have been used for cell culture studies, including work from our group using trichlorosilanes to create patterns directly on glass substrates,9 patterned monolayers formed from alkane thiols on gold are straight-forward to prepare. Moreover, the monomers used for monolayer preparation are commercially available, stable, and do not require storage or handling under inert atmosphere. Patterned substrates prepared from alkane thiols can also be recycled and reused several times, maintaining cell confinement.10

Self-assembled monolayers (SAMs) formed from long chain alkane thiols on gold provide well-defined substrates for the formation of protein patterns and cell confinement. Microcontact printing of hexadecanethiol using a polydimethylsiloxane (PDMS) stamp followed by backfilling with a glycol-terminated alkane thiol monomer produces a pattern where protein and cells adsorb only to the stamped hexadecanethiol region.

Erstellen Zweidimensionale Patterned Substrate für Protein-und Zell-Confinement

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1  While microcontact printing ...

Forschung

Biotechnik

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic valve leaflets are composed of interstitial cells suspended within an extracellular matrix (ECM) and are lined with an endothelial cell monolayer. The valve withstands a harsh, dynamic environment and is constantly exposed to shear, flexion, tension, and compression. Research has shown calcific lesions in diseased valves occur in areas of high mechanical stress as a result of endothelial disruption or interstitial matrix damage1-3. Hence, it is not surprising that epidemiological studies have shown high blood pressure to be a leading risk factor in the onset of aortic valve disease4. 
The only treatment option currently available for valve disease is surgical replacement of the diseased valve with a bioprosthetic or mechanical valve5. Improved understanding of valve biology in response to physical stresses would help elucidate the mechanisms of valve pathogenesis. In turn, this could help in the development of non-invasive therapies such as pharmaceutical intervention or prevention. Several bioreactors have been previously developed to study the mechanobiology of native or engineered heart valves6-9. Pulsatile bioreactors have also been developed to study a range of tissues including cartilage10, bone11 and bladder12. The aim of this work was to develop a cyclic pressure system that could be used to elucidate the biological response of aortic valve leaflets to increased pressure loads. 
The system consisted of an acrylic chamber in which to place samples and produce cyclic pressure, viton diaphragm solenoid valves to control the timing of the pressure cycle, and a computer to control electrical devices. The pressure was monitored using a pressure transducer, and the signal was conditioned using a load cell conditioner. A LabVIEW program regulated the pressure using an analog device to pump compressed air into the system at the appropriate rate. The system mimicked the dynamic transvalvular pressure levels associated with the aortic valve; a saw tooth wave produced a gradual increase in pressure, typical of the transvalvular pressure gradient that is present across the valve during diastole, followed by a sharp pressure drop depicting valve opening in systole. The LabVIEW program allowed users to control the magnitude and frequency of cyclic pressure. The system was able to subject tissue samples to physiological and pathological pressure conditions. This device can be used to increase our understanding of how heart valves respond to changes in the local mechanical environment.

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

A cyclic pressure bioreactor capable of subjecting heart valve tissue to physiological and pathological pressure conditions has been designed. A LabVIEW program allows users to control pressure magnitude, amplitude and frequency. This device can be used to study the mechanobiology of heart valve tissue or isolated cells.

Entwurf eines zyklischen Druck Bioreaktor für die Ex Vivo Studium der Aorten-Herzklappen

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic ...

Electric Field-controlled Directed Migration of Neural Progenitor Cells in 2D and 3D Environments

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the central nervous system1,2. These endogenous EFs are generated by cellular regulation of ionic transport combined with the electrical resistance of cells and tissues. It has been reported that applied EF treatment can promote functional repair of spinal cord injuries in animals and humans3,4. In particular, EF-directed cell migration has been demonstrated in a wide variety of cell types5,6, including neural progenitor cells (NPCs)7,8. Application of direct current (DC) EFs is not a commonly available technique in most laboratories. We have described detailed protocols for the application of DC EFs to cell and tissue cultures previously5,11. Here we present a video demonstration of standard methods based on a calculated field strength to set up 2D and 3D environments for NPCs, and to investigate cellular responses to EF stimulation in both single cell growth conditions in 2D, and the organotypic spinal cord slice in 3D. The spinal cordslice is an ideal recipient tissue for studying NPC ex vivo behaviours, post-transplantation, because the cytoarchitectonic tissue organization is well preserved within these cultures9,10. Additionally, this ex vivo model also allows procedures that are not technically feasible to track cells in vivo using time-lapse recording at the single cell level. It is critically essential to evaluate cell behaviours in not only a 2D environment, but also in a 3D organotypic condition which mimicks the in vivo environment. This system will allow high-resolution imaging using cover glass-based dishes in tissue or organ culture with 3D tracking of single cell migration in vitro and ex vivo and can be an intermediate step before moving onto in vivo paradigms.

This protocol demonstrates methods used to establish 2D and 3D environments in custom-designed electrotactic chambers, which can track cells in vivo/ex vivo using time-lapse recording at the single cell level, in order to investigate galvanotaxis/electrotaxis and other cellular responses to direct current (DC) electric fields (EFs).

Electric Field-gesteuerte gerichtete Wanderung von neuralen Vorläuferzellen in 2D-und 3D-Umgebungen

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the ...

Cell Co-culture Patterning Using Aqueous Two-phase Systems

Cell patterning technologies that are fast, easy to use and affordable will be required for the future development of high throughput cell assays, platforms for studying cell-cell interactions and tissue engineered systems. This detailed protocol describes a method for generating co-cultures of cells using biocompatible solutions of dextran (DEX) and polyethylene glycol (PEG) that phase-separate when combined above threshold concentrations. Cells can be patterned in a variety of configurations using this method. Cell exclusion patterning can be performed by printing droplets of DEX on a substrate and covering them with a solution of PEG containing cells. The interfacial tension formed between the two polymer solutions causes cells to fall around the outside of the DEX droplet and form a circular clearing that can be used for migration assays. Cell islands can be patterned by dispensing a cell-rich DEX phase into a PEG solution or by covering the DEX droplet with a solution of PEG. Co-cultures can be formed directly by combining cell exclusion with DEX island patterning. These methods are compatible with a variety of liquid handling approaches, including manual micropipetting, and can be used with virtually any adherent cell type.

Aqueous two-phase systems were used to simultaneously pattern multiple populations of cells. This fast and easy method for cell patterning takes advantage of the phase separation of aqueous solutions of dextran and polyethylene glycol and the interfacial tension that exists between the two polymer solutions.

Zelle Co-Kultur Strukturierung mit wässrigen Zwei-Phasen-Systeme

Cell patterning  technologies that are fast, easy to use and affordable will be required for the  future development of high throughput cell assays, ...

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to intrinsic parameters within the process allow a high degree of control over scaffold characteristics including fiber diameter, alignment and porosity. By developing scaffolds with similar dimensions and topographies to organ- or tissue-specific extracellular matrices (ECM), micro-environments representative to those that cells are exposed to in situ can be created. 
The airway bronchiole wall, comprised of three main micro-environments, was selected as a model tissue. Using decellularized airway ECM as a guide, we electrospun the non-degradable polymer, polyethylene terephthalate (PET), by three different protocols to produce three individual electrospun scaffolds optimized for epithelial, fibroblast or smooth muscle cell-culture. Using a commercially available bioreactor system, we stably co-cultured the three cell-types to provide an in vitro model of the airway wall over an extended time period.
This model highlights the potential for such methods being employed in in vitro diagnostic studies investigating important inter-cellular cross-talk mechanisms or assessing novel pharmaceutical targets, by providing a relevant platform to allow the culture of fully differentiated adult cells within 3D, tissue-specific environments.

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Advancements in biomaterial technologies enable the development of three-dimensional multi-cell-type constructs. We have developed electrospinning protocols to produce three individual scaffolds to culture the main structural cells of the airway to provide a 3D in vitro model of the airway bronchiole wall.

Anpassung der Elektrospinnverfahren für einen Dreischicht stellen drei einzigartige Umgebungen<em&gt; In-vitro-</em&gt; Modell der Atemwegswand

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to ...

Photopatterning Proteins and Cells in Aqueous Environment Using TiO2 Photocatalysis

Organic contaminants adsorbed on the surface of titanium dioxide (TiO2) can be decomposed by photocatalysis under ultraviolet (UV) light. Here we describe a novel protocol employing the TiO2 photocatalysis to locally alter cell affinity of the substrate surface. For this experiment, a thin TiO2 film was sputter-coated on a glass coverslip, and the TiO2 surface was subsequently modified with an organosilane monolayer derived from octadecyltrichlorosilane (OTS), which inhibits cell adhesion. The sample was immersed in a cell culture medium, and focused UV light was irradiated to an octagonal region. When a neuronal cell line PC12 cells were plated on the sample, cells adhered only on the UV-irradiated area. We further show that this surface modification can also be performed in situ, i.e., even when cells are growing on the substrate. Proper modification of the surface required an extracellular matrix protein collagen to be present in the medium at the time of UV irradiation. The technique presented here can potentially be employed in patterning multiple cell types for constructing coculture systems or to arbitrarily manipulate cells under culture.

Photopatterning Proteins and Cells in Aqueous Environment Using TiO2 Photocatalysis

We describe a protocol for modifying cell affinity of a scaffold surface in aqueous environment. The method takes advantage of titanium dioxide photocatalysis to decompose organic film in the photo-irradiated region. We show that it can be used to create microdomains of scaffolding proteins, both ex situ and in situ.

Photostrukturierungs Proteinen und Zellen in wässriger Umgebung Mit TiO<sub&gt; 2</sub&gt; Photokatalyse

Organic contaminants adsorbed on the surface of titanium dioxide (TiO2) can be decomposed by photocatalysis under ultraviolet (UV) light. Here we describe ...

Aqueous Droplets Used as Enzymatic Microreactors and Their Electromagnetic Actuation

For the successful implementation of microfluidic reaction systems, such as PCR and electrophoresis, the movement of small liquid volumes is essential. In conventional lab-on-a-chip-platforms, solvents and samples are passed through defined microfluidic channels with complex flow control installations. The droplet actuation platform presented here is a promising alternative. With it, it is possible to move a liquid drop (microreactor) on a planar surface of a reaction platform (lab-in-a-drop). The actuation of microreactors on the hydrophobic surface of the platform is based on the use of magnetic forces acting on the outer shell of the liquid drops which is made of a thin layer of superhydrophobic magnetite particles. The hydrophobic surface of the platform is needed to avoid any contact between the liquid core and the surface to allow a smooth movement of the microreactor. On the platform, one or more microreactors with volumes of 10 &#181;L can be positioned and moved simultaneously. The platform itself consists of a 3 x 3 matrix of electrical double coils which accommodate either neodymium or iron cores. The magnetic field gradients are automatically controlled. By variation of the magnetic field gradients, the microreactors' magnetic hydrophobic shell can be manipulated automatically to move the microreactor or open the shell reversibly. Reactions of substrates and corresponding enzymes can be initiated by merging the microreactors or bringing them into contact with surface immobilized catalysts.

Lab-in-a-drop reaction systems allow the versatile implementation of complex reactions in a microfluidic scale. An automated actuation platform consisting of a 3 x 3 matrix of electromagnetic coils was developed and successfully used to merge two 10 &#181;L microreactors and thereby initiate an enzymatic reaction in the resulting liquid marbles.

Wässrige Tröpfchen als enzymatische Mikroreaktoren und deren elektromagnetischen Betätigung

For the successful implementation of microfluidic reaction systems, such as PCR and electrophoresis, the movement of small liquid volumes is essential. In ...

Characterizing Cell Migration Within Three-dimensional In Vitro Wound Environments

Currently, most in vitro models of wound healing, such as well-established scratch assays, involve studying cell migration and wound closure on two-dimensional surfaces. However, the physiological environment in which in vivo wound healing takes place is three-dimensional rather than two-dimensional. It is becoming increasingly clear that cell behavior differs greatly in two-dimensional vs. three-dimensional environments; therefore, there is a need for more physiologically relevant in vitro models for studying cell migration behaviors in wound closure. The method described herein allows for the study of cell migration in a three-dimensional model that better reflects physiological conditions than previously established two-dimensional scratch assays. The purpose of this model is to evaluate cell outgrowth via the examination of cell migration away from a spheroid body embedded within a fibrin matrix in the presence of pro- or anti-migratory factors. Using this method, cell outgrowth from the spheroid body in a three-dimensional matrix can be observed and is easily quantifiable over time via brightfield microscopy and analysis of spheroid body area. The effect of pro-migratory and/or inhibitory factors on cell migration can also be evaluated in this system. This method provides researchers with a simple method of analyzing cell migration in three-dimensional wound associated matrices in vitro, thus increasing the relevance of in vitro cell studies prior to the use of in vivo animal models.

Characterizing Cell Migration Within Three-dimensional In Vitro Wound Environments

The goal of this protocol is to evaluate the effect of pro- and anti-migratory factors on cell migration within a three-dimensional fibrin matrix.

Zellwanderung in dreidimensionales In Vitro Charakterisierung Wunde Umgebungen

Currently, most in vitro models of wound healing, such as well-established scratch assays, involve studying cell migration and wound closure on ...

Protocol for MicroRNA Transfer into Adult Bone Marrow-derived Hematopoietic Stem Cells to Enable Cell Engineering Combined with Magnetic Targeting

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates after injection into injured tissues as well as the observed massive cell death rates lead to very restricted therapeutic effects. To overcome these limitations, we sought to establish a non-viral based protocol for suitable cell engineering prior to their administration. The modification of human CD133+ expressing SCs using microRNA (miR) loaded magnetic polyplexes was addressed with respect to uptake efficiency and safety as well as the targeting potential of the cells. Relying on our protocol, we can achieve high miR uptake rates of 80&#8211;90% while the CD133+ stem cell properties remain unaffected. Moreover, these modified cells offer the option of magnetic targeting. We describe here a safe and highly efficient procedure for the modification of CD133+ SCs. We expect this approach to provide a standard technology for optimization of therapeutic stem cell effects and for monitoring of the administered cell product via magnetic resonance imaging (MRI).

This protocol illustrates a safe and efficient procedure to modify CD133+ hematopoietic stem cells. The presented non-viral, magnetic polyplex-based approach may provide a basis for the optimization of therapeutic stem cell effects as well as for monitoring the administered cell product via magnetic resonance imaging.

Protokoll für MicroRNA Transfer an adulten Knochenmark gewonnenen Hämatopoetischen Stammzellen Zelle Engineering kombiniert mit magnetischen Ausrichtung ermöglichen

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates ...

Material Formation of Recombinant Spider Silks through Aqueous Solvation using Heat and Pressure

Many spiders produce seven types of silks. Six of the silks are fiber in form when produced by the spiders. These fibers are not water soluble. In order to reproduce the remarkable mechanical properties of spider silks, they must be produced in heterologous hosts as spiders are both territorial and cannibalistic. The synthetic analogs of spider silk also tend to be insoluble in aqueous solutions. Thus, a large percentage of research in recombinant spider silks rely upon organic solvents that are detrimental to large scale production of materials. Our group&#8217;s method forces the solvation of these recombinant spider silks into water. Remarkably, when these proteins are prepared using this method of heat and pressure, a wide range of material forms can be prepared from the same solution of recombinant spider silk proteins (rSSp) including: films, fibers, sponge, hydrogel, lyogel, and adhesives. This article demonstrates the production of the solvated rSSp and material forms in a manner that is more easily understood than from written materials and methods alone.

Here, we present a protocol to produce water soluble recombinant spider silk protein solutions and the material forms that can be formed from those solutions.

Materialbildung von Rekombinanten Spider-Seiden durch wässrige Lösung mit Wärme und Druck

Many spiders produce seven types of silks. Six of the silks are fiber in form when produced by the spiders. These fibers are not water soluble. In order ...