Les expériences réalisées dans cette vidéo-article ont été développés pour la compétition machine génétiquement internationale 9. Les auteurs tiennent à remercier les membres de l&#39;équipe iGEM Luc Bergwerff, Pieter van TM Boheemen, Jelmer Cnossen, Hugo F. Rojas et Ramon Cueto van der Valk pour l&#39;aide à la recherche. Nous remercions Han de Winde, Stefan de Kok et Esengül Yıldırım pour des discussions utiles et d&#39;hébergement de cette recherche. Ce travail a été soutenu par le ministère de la TU Delft University of Biotechnology, Delft Le laboratoire de bioinformatique, TU Delft Département de Bionanoscience, Oil Sands Leadership Initiative (OSLI), Stud studentenuitzendbureau, Pays-Bas Initiative en génomique, Kluyver Centre, Nederlandse Vereniging Biotechnologische (Stichting Nederland Biotechnologie) , DSM, Geneart, Greiner Bio-One et Genencor.

1. BioBrick Assemblée <ol><li> BioBricks du Registre de pièces normalisées biologiques sont fournis par le siège iGEM. Pour construire une nouvelle BioBrick de BioBricks existants, digérer le donateur (jusqu&#39;à 1,0 mg) BioBrick par les enzymes EcoRI et Spel pour le positionnement de la partie aval des bailleurs de fonds de la part accepteur. Digestion par XbaI et PstI pour positionner le donneur de la pièce en amont de la partie accepteur. Ajouter une troisième enzyme de restriction appropriée qui coupe dans le squelette du donneur. Effectuer les digestions dans un volume total de 20-25 ml avec le tampon approprié, selon le fournisseur (concentration finale 1x). Utilisez 5 unités / mg d&#39;ADN pour les enzymes de restriction. </li><li> Digérer l&#39;accepteur BioBrick soit avec EcoRI et XbaI ou Spel et PstI. </li><li> Incuber les digestions pour (au moins) une heure à 37 ° C. Inactiver les endonucléases de restriction par la chaleur, l&#39;incubation à 80 ° C pendant 10 min et centrifugation sous peu. </li><li> Ligaturer le BioBrick digéréparties (donneur et accepteur) ensemble. Depuis Xbal et Spel générer des extrémités d&#39;ADN compatibles, un site mixte est créé, qui ne peut pas être coupé avec une enzyme de restriction résultant en une nouvelle «combiné» BioBrick qui flanquaient par les 4 sites de restriction standard. Dans le mélange de ligature de la concentration finale en ADN est de préférence ~ 100 ng / ul. Effectuer la réaction de ligature dans un volume total de 10-15 ml avec le tampon de ligature T4 (concentration finale 1 x) et la T4 ligase (1 unité / mg d&#39;ADN). </li><li> Incuber le mélange de ligature à 16 ° C pendant au moins 3 h. </li><li> Effectuer réaction de transformation de la moitié vers le mélange de ligature. </li><li> Confirmez le BioBrick comme correctes pour le séquençage. </li><li> Pour construire une nouvelle BioBrick de l&#39;ADN synthétisé, de modifier les gènes de synthèse pour une expression optimale dans E. coli à l&#39;aide de l&#39;outil de site JCAT ( <a href="http://www.jcat.de/" target="_blank">http://www.jcat.de/</a> ). Apporter d&#39;autres modifications, conformément aux exigences de la B<html> ioBrick standard. Cette standardisation implique que chaque BioBrick est composé d&#39;une séquence d&#39;ADN d&#39;intérêt précédée d&#39;un préfixe et d&#39;un suffixe suivi. Le préfixe et le suffixe sont des séquences qui contiennent des sites de restriction prédéfinis, qui sont absents dans le reste de la séquence du plasmide. Ces sites de restriction standards permettent d&#39;échanger et de prolonger les inserts BioBrick flexible 9. Les préfixes et suffixes ont les séquences suivantes: </li></ol><table border="1"><tbody><tr><td> Nom </td><td> Séquence </td><td> Commenter </td></tr><tr><td> Préfixe </td><td> 5 &#39;GAATTCGCGGCCGCTTCTAG3&#39; </td><td></td></tr><tr><td></td><td> 5 &#39;GAATTCGCGGCCGCTTCTAGAG 3&#39; </td><td> Si la partie qui suit est une séquence codante ou toute partie qui commence par &quot;ATG&quot; </td></tr><tr><td> Suffixe </td><td> 5 &#39;TACTAGTAGCGGCCGCTGCAG 3&#39; </td><td></td></tr></tbody></table>ove_title &quot;&gt; 2. Conversion alcane cellule de dosage de repos, In Vivo Cet essai a été effectué sur la base de la méthode décrite par Fujii et al. (2004). <ol><li> Culture E. coli exprimant les cellules du système alcane hydroxylase ( <a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_K398014</a> ) et les cellules portant un vecteur vide ( <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> ) dans 5 ml de milieu LB avec des antibiotiques appropriés pendant la nuit. </li><li> Transfert 500 pi de la culture d&#39;une nuit dans 50 ml de LB frais (avec un antibiotique) et incuber jusqu&#39;à ce que la turbidité des cellules a atteint une DO (densité optique) de 0,3 à 600 nm. </li><li> Centrifuger pendant 10 min à 4000 rpm et remettre en suspension le culot dans 5 ml de tampon phosphate 0,1 M (pH 7,4). </li><li> Centrifuger à nouveau pendant 10 min à 4000 rpm et remettre en suspension le culot dans 5 ml de tampon phosphate 0,1 M contenant des sels maintenant E2 et 0,66% v / v de glycérol (azote carencest moyen). </li><li> Mesurer la turbidité cellulaire (DO 600). </li><li> Préparer cellule-mélange des aliquotes de 6 ml dans des flacons de 25 ml en verre fermé d&#39;assemblage et les contrôles non-cellulaires (E2 + 0,66 sels% v / v de glycérol). </li><li> Ajouter 100 nmol d&#39;alcane dans chaque flacon. </li><li> Incuber les mélanges à 37 ° C pendant 24 heures (raccourcir lorsque des taux plus élevés sont obtenus). </li><li> Mesurer la DO 600 après incubation. </li><li> Extraire les hydrocarbures dans les milieux de culture par l&#39;acétate d&#39;éthyle et de déterminer la concentration d&#39;hydrocarbures en culture cellulaire par chromatographie en phase gazeuse (voir le protocole 3). </li><li> Calculer la dégradation par unité de biomasse en divisant la quantité totale d&#39;alcane converti par la biomasse totale présente dans chaque fiole (OD 600 à convertir la matière sèche). En divisant le résultat par la durée expérimentale donne l&#39;activité de dégradation par unité de biomasse par unité de temps. La moyenne est calculée à partir de trois points différents. </li></ol> 3. Essai alcane enzyme de conversion, enVitro Cet essai a été réalisé essentiellement selon la méthode décrite par Li et al. (2008). <ol><li> Culture E. cellules de E. coli exprimant le gène de Lada ( <a href="http://partsregistry.org/Part:BBa_K398017" target="_blank">BBa_K398017</a> ) et les cellules portant un vecteur vide ( <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> ) dans 50 ml de milieu LB avec des antibiotiques appropriés pendant la nuit. </li><li> Transfert 500 pi de la culture d&#39;une nuit dans 50 ml de LB frais (avec un antibiotique) et incuber jusqu&#39;à ce que la turbidité des cellules a atteint une densité optique de 0,6 à 600 nm. </li><li> Centrifuger 10 min à 4000 rpm (4 ° C) et remettre en suspension le culot dans 5 ml de tampon Tris 50 mM. </li><li> Soniquer (cellulaire perturbateur, LA Biosystems), les cellules à rapport cyclique de 40% avec une commande de sortie de 4, maintenir la solution sur de la glace pendant toute la durée. </li><li> Centrifuger le mélange résultant pendant 5 min à 4000 rpm à 4 &amp; dpar exemple, C pour éliminer les débris cellulaires. Transférer le surnageant dans un nouveau tube. </li><li> Déterminer la concentration totale en protéines des extraits cellulaires par dosage de Bradford. Remarque: Utilisez des flacons en verre pour empêcher l&#39;augmentation du fond et / ou la perte de protéines. </li><li> Préparer un mélange 100 ml contenant 0,1% en volume / volume d&#39;alcane et 50 mM de tampon Tris-HCl. </li><li> Chauffer le mélange à 100 ° C pendant 5 min. Remarque: Effectuez cette étape uniquement pour les alcanes à chaîne moyenne et longue avec un point d&#39;ébullition élevé. (Par exemple C 16: 287 ° C). </li><li> Pour obtenir une solubilité optimale de l&#39;alcane, une sonication pendant 1 min encore chaude jusqu&#39;à ce qu&#39;une homogène, mélange visqueux est obtenu. </li><li> Ajouter 1 mM de NADH, 1 mM FMN, 1 mM de MgSO 4 et 0,01 v / v de Triton X-100. </li><li> Préparez 6 ml d&#39;aliquotes de 25 ml à bouchon fermé flacons. </li><li> Ajouter une quantité suffisante d&#39;extrait cellulaire (dépend de tests Bradford, la concentration finale de 5 mg de protéine / l). Préparer un témoin sans protéines. </li><li> Incuber à 60 ° C (par e optimalenzymatic activité) pendant 24 heures. </li><li> Extraire les hydrocarbures dans les milieux de culture par l&#39;acétate d&#39;éthyle et de déterminer la concentration d&#39;hydrocarbures en culture cellulaire par chromatographie en phase gazeuse (voir le protocole 3). </li><li> Calculer la dégradation par unité de biomasse en divisant la quantité totale d&#39;alcane converti en protéine totale dans chaque fiole (par Bradford courbe d&#39;étalonnage). En outre la division de la durée du test donne l&#39;activité de dégradation par unité de protéine cellulaire par unité de temps. La moyenne est calculée à partir de trois points différents. </li></ol> 4. Ethyl Acetate extraction d&#39;hydrocarbures et de concentration <ol><li> Alcanes sont extraits de la solution aqueuse en ajoutant 2,5 ml d&#39;acétate d&#39;éthyle (solvant apolaire) pour solution expérimentale 6 ml. Un étalon interne est ajouté au solvant à une concentration de 0,1% (v / v). La norme (par exemple cyclo-décane) varie en fonction de la fourchette prévue des pics d&#39;intérêt. </li><li> Facultatif: Ajouter TritonX-100 pour le mélange aqueux et centrifuger les échantillons pendant 10 min à 4000 rpm afin d&#39;obtenir un bon système biphasique. </li><li> Vortex le mélange pendant 5 sec (1,500 rpm) et incuber à température ambiante jusqu&#39;à ce que les deux phases se séparent. </li><li> Suppression d&#39;un montant maximal de la couche organique (en haut) et sécher le solvant en utilisant du sulfate de magnésium anhydre. </li><li> Retirer MgSO 4 par filtration (0,2 um) et transférer le filtrat dans des flacons chromatographe en phase gazeuse pour la mesure, ni le conserver à -20 ° C. </li><li> Déterminer la concentration par chromatographie en phase gazeuse en utilisant une colonne CP-SIL 5CB (longueur = 5 m). Injecter 10 ul d&#39;échantillon en mode split (1:10, 230 ° C). Régler le débit de gaz colonne à 1 ml / min (Hélium). Le programme du four suivant la température est utilisée: <table border="1"><tbody><tr><td> Taux </td><td> Température [° C] </td><td> Temps [min] </td></tr><tr><td> 0 </td><td> 50 </td><td> 7,5 </td></tr><tr><td> 50 </td><td> 90 </td><td> 1,0 </td></tr><tr><td> 50 </td><td> 110 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 130 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 145 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 160 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 170 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 185 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 210 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 250 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 320 </td><td> 2,0 </td></tr></tbody></table></li><li> Intégrer les pics et corriger les concentrations par rapport à l&#39;étalon interne. </li></ol> 5. Alcool / Test d&#39;activité aldéhyde déshydrogénase Cet essai a été réalisé essentiellement selon la méthode décrite par Kato et al.(2010). <ol><li> Culture E. cellules de E. coli exprimant l&#39;ADH ( <a href="http://partsregistry.org/Part:BBa_K398018" target="_blank">BBa_K398018</a> ) ou ALDH ( <a href="http://partsregistry.org/Part:BBa_K398030" target="_blank">BBa_K398030</a> ) des gènes et des cellules portant un vecteur vide ( <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> ) dans 50 ml de milieu LB avec des antibiotiques appropriés pendant la nuit. </li><li> Transfert 500 pi de la culture d&#39;une nuit dans 50 ml de LB frais (avec un antibiotique) et incuber jusqu&#39;à ce que la turbidité des cellules a atteint une densité optique de 0,6 à 600 nm. </li><li> Centrifuger 10 min à 4000 rpm à 4 ° C et remettre en suspension le culot dans 5 ml de tampon Tris 50 mM. </li><li> Soniquer la solution de cellules au facteur de marche 40%, avec une commande de sortie de 4 (maintenir la solution sur de la glace pendant la sonication). </li><li> Centrifuger le mélange résultant pendant 5 min à 4000 rpm à 4 ° C pour éliminer les débris cellulaires. </li><li> Déterminer le àconcentration en protéines tal des extraits cellulaires par Bradford dosage (Remarque: utiliser un flacon en verre pour empêcher la liaison des protéines). </li><li> Chargez une plaque de 96 puits avec 180 pl 57 mM tampon glycine contenant du NAD (concentration finale 1 mM, pH 9,5) dans chaque puits. </li><li> Ajouter 5 ul de l&#39;alcool (aldéhyde) à tester dans les puits. Remarque: les alcools à longue chaîne de chaleur avant le début de l&#39;essai d&#39;avoir un liquide. Pour chaque alcool (aldéhyde) un contrôle sans substrat doit être ajouté (témoin négatif). En outre, de préparer une ébauche qui contient un mélange de tampon et le substrat sans extrait cellulaire. </li><li> Préchauffer la plaque de la plaque (Tecan Magellan v7.0) lecteur pendant 15 min à 37 ° C pour permettre l&#39;équilibrage du système. </li><li> Ajouter une quantité suffisante d&#39;extrait cellulaire (dépend de tests Bradford, la concentration finale de 5 mg de protéine / l). Préparer un témoin sans protéines. </li><li> Mesurer la production de NADH l&#39;aide d&#39;un spectrophotomètre à une longueur d&#39;onde de 340 nm toutes les 2-3 minutes pendant 1 heure à 37 ° C. &lt;/ Li&gt; <li> Calculer le taux de production de NADH à partir de la pente de la DO (340 nm). Prendre en compte la longueur de trajet de la lumière et le coefficient d&#39;extinction du NADH de 6220 M -1 cm -1. Diviser le rythme de production de NADH par la quantité totale de protéine ajoutée à exprimer l&#39;activité de la déshydrogénase de réaction dans l&#39;extrait cellulaire (U / mg de protéine de cellule entière). Calculer la moyenne et l&#39;écart type de trois essais indépendants. </li></ol> 6. Caractérisation pCaiF <ol><li> Culture E. cellules exprimant la construction coli pCaiF-GFP ( <a href="http://partsregistry.org/Part:BBa_K398331" target="_blank">BBa_K398331</a> ) et les cellules portant le promoteur seul ( <a href="http://partsregistry.org/Part:BBa_K398326" target="_blank">BBa_K398326</a> ) pendant une nuit dans 5 ml de milieu LB les antibiotiques appropriés pendant la nuit. </li><li> Inoculer 5 ml M9 contenant 10 g / l de glucose et les antibiotiques avec 50 ul de la culture de la nuit et du jour au lendemain se développer. </li&gt; <li> Subculture 50 pl de l&#39;excroissance du jour au lendemain dans 5 ml de frais M9 avec 10 g / l et incuber jusqu&#39;à ce que la turbidité des cellules a atteint une densité optique de 0,2 à 600 nm. </li><li> Chargez une plaque de 96 puits avec 100 ul de milieu M9 frais contenant la quantité désirée de source de carbone pour les essais dans chaque puits. Effectuer trois expériences pour l&#39;évaluation statistique et ajoutez les contrôles respectifs négatifs (de type sauvage de E. coli K12). </li><li> Ajouter 5 ul de la culture d&#39;une nuit dans les puits milieu contenant. </li><li> Mesurer la courbe de croissance (DO 600) et fluorescence de la GFP (485 nm d&#39;excitation et 520 émissions) en utilisant un lecteur de plaque toutes les 10 minutes pendant 18 heures à 37 ° C avec une agitation constante. </li><li> Calculer le taux de croissance et la teneur en GFP spécifique des mesures respectives et le comparer au contrôle. Calculer la moyenne et l&#39;écart type d&#39;au moins trois expériences indépendantes. </li></ol> 7. Essai de tolérance <ol><li> CultureE. coli exprimant le gène PhPFDα et β ( <a href="http://partsregistry.org/Part:BBa_K398406" target="_blank">BBa_K398406</a> ) pendant une nuit dans 5 ml de milieu LB et les antibiotiques appropriés. E. coli exprimant Lada gène ( <a href="http://partsregistry.org/Part:BBa_K398017" target="_blank">BBa_K398017</a> ) est utilisé comme contrôle négatif. </li><li> Subculture 10 pi du jour au lendemain en conséquence frais 5 ml de LB (avec un antibiotique) et incuber jusqu&#39;à ce que la turbidité des cellules a atteint une densité optique de 0,3 à 0,4 à 600 nm. </li><li> Diluer les cultures avec du milieu frais jusqu&#39;à une DO600 de 0,1 est atteint. </li><li> Chargez une plaque de 96 puits avec 180 ul de milieu M9 contenant les antibiotiques appropriés et la concentration finale appropriée du composé toxique (par exemple, 0, 4, 8, 10% de n-hexane) en trois exemplaires. Parce que alcane mélanges d&#39;eau et pourrait conduire à des systèmes à deux phases, il est essentiel d&#39;avoir des contrôles appropriés sur la plaque (par exemple, différents souches et les expériences respectives en blanc). </li><li> Ajouter 20 ul de la culture (contrôle) dans les puits. </li><li> Mesurer la concentration de la biomasse (OD 600) en utilisant un lecteur de plaque toutes les 10 minutes pendant 24 heures à 37 ° C avec une agitation constante. </li><li> Calculer les taux de croissance à partir des mesures respectives pour les différentes concentrations de l&#39;agent et le comparer au contrôle négatif. Calculer la moyenne et l&#39;écart type d&#39;au moins trois essais indépendants. </li></ol> 8. Cartographie interaction homologue <ol><li> L&#39;application a été développée pour LUI effectuer des requêtes de protéines sur un serveur PostgreSQL la base de données STRING (gratuit pour un usage académique) 20. L&#39;application de cartographie homologue de l&#39;interaction identifie les protéines qui interagissent dans l&#39;organisme hôte d&#39;origine en utilisant la base de données STRING. Les séquences des gènes respectifs interaction sont utilisés dans une recherche BLAST pour trouver des gènes homologues dans l&#39;organisme cible. Cytoscape 4 </sup&gt; est utilisé pour visualiser le résultat de la cartographie. L&#39;outil logiciel HIM peut être téléchargé à l&#39;adresse: <a href="https://github.com/jcnossen/InteractionHomologMapping" target="_blank">https://github.com/jcnossen/InteractionHomologMapping.</a> </li><li> Pour effectuer une cartographie, (1) entrez l&#39;ID BioBrick et l&#39;application va automatiquement télécharger les données de séquence de pièces tirées du Registre des standards biologiques Pièces 9, ou (2) ENTRER (coller) les données de séquence dans l&#39;application. </li><li> Utilisez le site Web de la base de données STRING pour trouver l&#39;ID de protéines STRING pour la séquence d&#39;acides aminés entré. </li><li> Une protéine ayant une forte homologie est déterminée en utilisant BLAST. Par la suite, l&#39;application répertorie chaque protéine d&#39;interaction connue dans l&#39;organisme source et recherche des homologues dans l&#39;organisme hôte (par exemple E. coli). </li><li> Exporter découlant liste interaction putative de texte ou Cytoscape. </li></ol>

<ol>
	<li>Allen, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Process+water+treatment+in+Canada's+oil+sands+industry:+I:+Target+pollutants+and+treatment+objectives.">Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives.</a> J. Environ. Eng. Sci. 7, 123-138 (2008).</li><li>Alon, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> An Introduction to Systems Biology: Design Principles of Biological Circuits. , (2007).</li><li>Center, O. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Understanding Oil Spills and Oil Spill Response. , (1999).</li><li>Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+the+caiF+gene+encoding+a+potential+transcriptional+activator+of+carnitine+metabolism+in+Escherichia+coli.">Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli.</a> J. Bacteriol. 178, 1248-1257 (1995).</li><li>Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+and+proteome+of+long-chain+alkane+degrading+Geobacillus+thermodenitrificans+NG80-2+isolated+from+a+deep-subsurface+oil+reservoir.">Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir.</a> Proc. Natl. Acad. Sci. U.S.A. 104 (13), 5602-5607 (2007).</li><li>Fujii, T., Narikawa, T., Takeda, K., Kato, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotransformation+of+various+alkanes+using+the+Escherichia+coli+expressing+an+alkane+hydroxylase+system+from+Gordonia+sp.+TF6.">Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6.</a> Biosci. Biotechnol. Biochem. 68 (10), 2171-2177 (2004).</li><li>Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cloning+of+an+alcohol+dehydrogenase+from+thermophilic+alkane-degrading+Bacillus+thermoleovorans+B23.">cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23.</a> J. Biosci. Bioeng. 91 (1), 100-102 (2001).</li><li>Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+cloning+and+characterization+of+an+aldehyde+dehydrogenase+from+long-chain+alkane-degrading+Geobacillus+thermoleovorans+B23.">Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23.</a> Extremophiles. 14, 33-39 (2010).</li><li>Kieboom, J., De Bont, J. a. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Bacterial Stress Responses. , (2000).</li><li>Kotte, O., Zaugg, J. B., Heinemann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+adaptation+through+distributed+sensing+of+metabolic+fluxes.">Bacterial adaptation through distributed sensing of metabolic fluxes.</a> Mol Syst Biol. 6, 355 (2010).</li><li>Kremling, A., Bettenbrock, K., Gilles, E. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+global+control+of+Escherichia+coli+carbohydrate+uptake.">Analysis of global control of Escherichia coli carbohydrate uptake.</a> BMC Syst. Biol. 1, (2007).</li><li>Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+long-chain+alkane+monooxygenase+(LadA)+in+complex+with+coenzyme+FMN:+unveiling+the+long-chain+alkane+hydroxylase.">Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase.</a> J. Mol. Biol. 376 (2), 453-465 (2008).</li><li>Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+the+maximum+specific+uptake+capacities+for+glucose+and+oxygen+in+glucose-limited+fed-batch+cultivations+of+Escherichia+coli.">Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli.</a> Biotechnol. Bioeng. 73 (5), 347-357 (2001).</li><li>Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overexpression+of+prefoldin+from+the+hyperthermophilic+archaeum+Pyrococcus+horikoshii+OT3+endowed+Escherichia+coli+with+organic+solvent+tolerance.">Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance.</a> Appl. Microbiol. Biotechnol. 79 (3), 443-449 (2008).</li><li>Rehm, H. J., Reiff, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+and+occurrence+of+microbial+oxidation+of+long-chain+alkanes.">Mechanisms and occurrence of microbial oxidation of long-chain alkanes.</a> Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).</li><li>Rojo, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Degradation+of+alkanes+by+bacteria.">Degradation of alkanes by bacteria.</a> Environ. Microbiol. 11 (10), 2477-2490 (2009).</li><li>Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Pseudomonas+putida+alkane-degradation+gene+clusters+and+flanking+insertion+sequences:+evolution+and+regulation+of+the+alk+genes.">Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes.</a> Microbiology. 147, 1621-1630 (2001).</li><li>Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+a+novel+thermophilic+Bacillus+strain+degrading+long-chain+n-alkanes.">Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes.</a> Extremophiles. 10 (4), 347-356 (2006).</li></ol>

Aucun conflit d&#39;intérêt déclaré.

Le principe BioBrick est utilisé pour construire un châssis pour la dégradation des alcanes et une preuve de principe pour les composants individuels de la boîte à outils a été obtenu. Plusieurs dosages sont proposés pour mesurer l&#39;in vivo et in vitro l&#39;activité des enzymes de la voie d&#39;alcanes dégradantes. Le travail présenté démontre avec succès un certain nombre de méthodes qui peuvent être utilisées pour déterminer l&#39;activité des enzymes et de l&#39;expression dan...

Oil pollution is among the most serious causes of environmental contamination, and greatly affects ecosystems, businesses and communities 3. Solutions are for example required to battle the continuous oil pollution originating from the oil sands tailing waters in Alberta, Canada. During the process of oil extraction from oil sands, bitumen, a semi-solid oxidized form of oil, is removed using thermal recovery techniques that consume about 3.1 barrels of water per single barrel of oil 1. Oil contaminated process water, mainly originating from a local river, is stored in tailing ponds after bitumen extraction. A more effective recycling of process water in order to reduce the need for freshwater uptake is needed. To facilitate the bitumen extraction and to ensure that downstream sites meet water quality guidelines for the protection of aquatic ecosystems, process water treatments are rapidly evolving 3.
To treat pollution of organic compounds, bioremediation technologies employing microorganisms are presently encouraged 1. Alkanes are the most abundant family of hydrocarbons in crude oil, containing 5 to 40 carbon atoms per molecule 7, 21. Many bacteria are known to degrade alkanes of various lengths via sequential oxidation of the terminal methyl group forming first alcohols, then aldehydes and finally fatty acids 8. Within this iGEM project several enzymes from different organisms were expressed and characterized, and made available via the BioBrick standard and Registry of Standard Biological Parts.
The well-studied alkane hydroxylase system of Gordonia sp. TF6 facilitates the initial oxidation step of C5-C13 alkanes along with that of C5-C8 cycloalkanes using a minimum of four components: alkB2 (alkane 1-monooxygenase), rubA3, rubA4 (two rubredoxins) and RubB (rubredoxin reductase) 8, 21. Oxidation of long-chain alkanes (ranging from C15 up to C36) is reported to be performed by ladA, a flavoprotein alkane monooxygenase from Geobacillus thermodinitrificans NG-80-2 7, 15, 18, 22. LadA forms a catalytic complex with flavin mononucleotide (FMN) that utilizes atomic oxygen for oxidation. This results in the conversion of alkanes into the corresponding primary alkanol. The alcohols are further oxidized by alcohol and aldehyde dehydrogenases to fatty acids, which readily enter the &beta;-oxidation pathway 7, 21. A zinc-independent alcohol dehydrogenase from the thermophillic bacterium Geobacillus thermoleovorans B23 oxidizes medium-chain alkanols into their respective alkanals, using NAD+ as a cofactor 10. Aldehyde dehydrogenase from the same bacterium is able to catalyze the NAD+-dependent final step in the medium-chain oxidation 11.
In order to reduce induction costs and to maintain optimal proliferation of the bacterial system, the promoter pCaiF from E.coli was characterized. This promoter can regulate expression of the hydrocarbon degradation pathway components, and is regulated by cAMP-Crp levels, which in turn depend on glucose levels 6. At high extracellular glucose concentrations in the environment the cellular cAMP (cyclic Adenosine Mononucleotide Phosphate) level was low through the inhibition of adenylyl cyclase as a side effect of PTS mediated glucose transport. Conversely, during limitation (low glucose concentrations) the cAMP level increased and Crp bound to cAMP forming the complex, cAMP-Crp, which bound pCaiF and activated transcription of the downstream components 6, 14.
Wildtype E. coli can only tolerate moderate concentrations of hydrocarbons. To complete the toolkit, tolerance to hydrocarbons had to be addressed. Several organic solvent-tolerant bacteria are known to survive in water-solvent two-phase systems 12. Molecular components known to increase tolerance are chaperones that facilitate the correct folding of proteins. The prefoldin system from Pyrococcus horikoshii OT3, consisting of the proteins phPFD&alpha; and phPFD&beta;, was shown to increase hydrocarbon-tolerance 17.
The alkane conversion toolkit was constructed following the BioBrick principle, which is documented at the Registry of Standard Biological Parts 9. BioBricks are plasmids containing a specific functional insert that is flanked by 4 predefined restriction sites. The BioBrick inserts can be extended flexibly, allowing the construction of biological systems with new functions.

<table border="1">
	<tbody>
		<tr>
			<td>Name of the reagent</td>
			<td>Company</td>
			<td>Catalogue number</td>
			<td>Comments (optional)</td>
		</tr>
		<tr>
			<td>E. coli K12</td>
			<td>New England Biolabs</td>
			<td>C2523H</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Octane</td>
			<td>Fluka</td>
			<td>74822</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Hexadecane</td>
			<td>Fluka</td>
			<td>52209</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>octanol-1</td>
			<td>Fluka</td>
			<td>95446</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>dodecanol-1</td>
			<td>Sigma-Aldrich</td>
			<td>126799</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Hexane</td>
			<td>Sigma-Aldrich</td>
			<td>296090</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>NADH</td>
			<td>Sigma</td>
			<td>N4505</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>FMN</td>
			<td>Sigma</td>
			<td>F2253</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>J.T. Baker Casno</td>
			<td>7487 889</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T8787</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>T4 ligase</td>
			<td>New England Biolabs</td>
			<td>M0202L</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Gas chromatograph</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Cell disrupter</td>
			<td>LA Biosystems</td>
			<td>CD-019</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Amersham pharmacia</td>
			<td>spec 2000</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Plate reader</td>
			<td>Tecan</td>
			<td>Magellan v7.0</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>Innova, 44</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>BioBrick K398014: 
			BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_K398014</a></td>
			<td>Alkane Hydroxylase System 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398027: BBa_R0040-BBa_B0034-ladA</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398027" target="_blank">BBa_K398027</a></td>
			<td>ladA Protein Generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398018: BBa_J23100-BBa_J61101-ADH</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398018" target="_blank">BBa_K398018</a></td>
			<td>ADH generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398030: BBa_R0040-BBa_B0034-ALDH</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398030" target="_blank">BBa_K398030</a></td>
			<td>ALDH generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398326: pCaiF</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398326" target="_blank">BBa_K398326</a></td>
			<td>pCaiF promoter 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398331: pCaiF-BBa_B0032-BBa_I13401</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398331" target="_blank">BBa_K398331</a></td>
			<td>pCaiF measurement device 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398406: BBa_J23002-BBa_J61107-phPFD&alpha;-BBa_J61107-</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398406" target="_blank">BBa_K398406</a></td>
			<td>Solvent tolerance cluster 
			Resistance: Chloramphenicol</td>
		</tr>
	</tbody>
</table>

a toolkit to enable hydrocarbon conversion in aqueous environments

Ce travail met en avant un ensemble d&#39;outils qui permet la conversion d&#39;alcanes par Escherichia coli et présente une preuve de principe de son applicabilité. La boîte à outils se compose de plusieurs éléments standards interchangeables (BioBricks) 9 portant sur ​​la conversion d&#39;alcanes, la régulation de l&#39;expression génique et la survie des toxiques riches en hydrocarbures environnements. Un parcours en trois étapes pour la dégradation de l&#39;alcane a été mis en œuvre dans E. coli afin de permettre la conversion d&#39;alcanes à moyen et à longue chaîne à leurs alcanols, alcanals respectives et, finalement, des acides alcanoïque. Ces derniers ont été métabolisé par le natif de β-oxydation voie. Pour faciliter l&#39;oxydation des alcanes à chaîne moyenne (C5-C13) et de cycloalcanes (C5-C8), quatre gènes (alkB2, rubA3, rubA4 et Rubb) du système alcane hydroxylase de Gordonia sp. TF6 8,21 ont été transformés en E. coli. Pour la conversion desalcanes à longue chaîne (C15-C36), le gène de Lada thermodenitrificans Geobacillus a été mis en œuvre. Pour les autres étapes nécessaires du processus de dégradation, l&#39;ADH et l&#39;ALDH (provenant de thermodenitrificans G.) ont été introduites 10,11. L&#39;activité a été mesurée par des dosages de cellules au repos. Pour chaque étape d&#39;oxydation, l&#39;activité enzymatique a été observée. Afin d&#39;optimiser l&#39;efficacité des processus, l&#39;expression n&#39;a été induite dans des conditions hypoglycémie: un promoteur régulé substrat, pCaiF, a été utilisé. pCaiF est présent dans E. coli K12 et régule l&#39;expression des gènes impliqués dans la dégradation de la source de carbone non-glucose. La dernière partie de la trousse à outils - le ciblage de survie - a été mis en œuvre en utilisant des gènes de tolérance solvants, PhPFDα et β, deux de Pyrococcus horikoshii OT3. Les solvants organiques peuvent induire un stress cellulaire et une diminution de la survie par négativement affectinrepliement des protéines g. Comme chaperons, PhPFDα et β améliorer le processus de repliement des protéines, par exemple en présence d&#39;alcanes. L&#39;expression de ces gènes conduit à une tolérance améliorée d&#39;hydrocarbures montré un taux de croissance élevé (jusqu&#39;à 50%) dans les présences de 10% de n-hexane dans le milieu de culture ont été observés. En résumé, les résultats indiquent que la boîte à outils permet E. coli à convertir et à tolérer les hydrocarbures dans les milieux aqueux. En tant que tel, il constitue une première étape vers une solution durable pour le pétrole-remédiation en utilisant une approche de biologie synthétique.

Alkane conversion
The activity of the three oxidation steps from the alkane to the respective fatty acid was evaluated using resting cell assays and enzyme activity measurements. The results are presented following the pathway reactions (1) alkane hydroxylase, (2) alcohol dehydrogenase and (3) aldehyde dehydrogenase. 
For the first step, different plasmids were constructed for medium and long-chain alkanes. The plasmid <a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_...

Watch this Scientific Journal Video about A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments at JoVE.com

Une boîte à outils pour permettre la conversion des hydrocarbures dans les environnements aqueux | Bioingénierie | Vidéo

A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

Un système de régulation automatique durable bactérienne pour l&#39;assainissement des pollutions pétrolières a été conçu en utilisant des pièces interchangeables (ADN BioBricks). Une ingénierie<em&gt; E. coli</em&gt; Les contraintes a été utilisée pour dégrader les alcanes par β-oxydation dans des milieux aqueux toxiques. Les enzymes respectives de différentes espèces ont montré une activité dégradation alcane. En outre, une tolérance accrue à<em&gt; N</em&gt;-Hexane a été réalisée par l&#39;introduction de gènes de bactéries résistantes alcane.

Une boîte à outils pour permettre la conversion d&#39;hydrocarbures en milieu aqueux

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The ...

a-toolkit-to-enable-hydrocarbon-conversion-in-aqueous-environments

Education

Research

JoVE Core

JoVE Journal

Organic Chemistry

Biology

Bioengineering

Ecology

Unit 1

Ecosystems

Alkanes and Cycloalkanes

SCIENTISTS IN ACTION

14.0K vues.  Delft University of Technology. Un système de régulation automatique durable bactérienne pour l'assainissement des pollutions pétrolières a été conçu en utilisant des pièces interchangeables (ADN BioBricks). Une ingénierie E. coli Les contraintes a été utilisée pour dégrader les alcanes par β-oxydation dans des milieux aqueux toxiques. Les enzymes respectives de différentes espèces ont montré une activité dégradation alcane. En outre, une tolérance accrue à

Vidéo: A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

Creating Two-Dimensional Patterned Substrates for Protein and Cell Confinement

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1 While microcontact printing can be employed to directly print a large number of molecules, including proteins,2 DNA,3 and silanes,4 the formation of self-assembled monolayers (SAMs) from long chain alkane thiols on gold provides a simple way to confine proteins and cells to specific patterns containing adhesive and resistant regions. This confinement can be used to control cell morphology and is useful for examining a variety of questions in protein and cell biology. Here, we describe a general method for the creation of well-defined protein patterns for cellular studies.5 This process involves three steps: the production of a patterned master using photolithography, the creation of a PDMS stamp, and microcontact printing of a gold-coated substrate. Once patterned, these cell culture substrates are capable of confining proteins and/or cells (primary cells or cell lines) to the pattern.
The use of self-assembled monolayer chemistry allows for precise control over the patterned protein/cell adhesive regions and non-adhesive regions; this cannot be achieved using direct protein stamping. Hexadecanethiol, the long chain alkane thiol used in the microcontact printing step, produces a hydrophobic surface that readily adsorbs protein from solution. The glycol-terminated thiol, used for backfilling the non-printed regions of the substrate, creates a monolayer that is resistant to protein adsorption and therefore cell growth.6 These thiol monomers produce highly structured monolayers that precisely define regions of the substrate that can support protein adsorption and cell growth. As a result, these substrates are useful for a wide variety of applications from the study of intercellular behavior7 to the creation of microelectronics.8
While other types of monolayer chemistry have been used for cell culture studies, including work from our group using trichlorosilanes to create patterns directly on glass substrates,9 patterned monolayers formed from alkane thiols on gold are straight-forward to prepare. Moreover, the monomers used for monolayer preparation are commercially available, stable, and do not require storage or handling under inert atmosphere. Patterned substrates prepared from alkane thiols can also be recycled and reused several times, maintaining cell confinement.10

Self-assembled monolayers (SAMs) formed from long chain alkane thiols on gold provide well-defined substrates for the formation of protein patterns and cell confinement. Microcontact printing of hexadecanethiol using a polydimethylsiloxane (PDMS) stamp followed by backfilling with a glycol-terminated alkane thiol monomer produces a pattern where protein and cells adsorb only to the stamped hexadecanethiol region.

Créer deux dimensions Substrats motifs pour le confinement des protéines et de cellules

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1  While microcontact printing ...

Recherche

Bio-ingénierie

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic valve leaflets are composed of interstitial cells suspended within an extracellular matrix (ECM) and are lined with an endothelial cell monolayer. The valve withstands a harsh, dynamic environment and is constantly exposed to shear, flexion, tension, and compression. Research has shown calcific lesions in diseased valves occur in areas of high mechanical stress as a result of endothelial disruption or interstitial matrix damage1-3. Hence, it is not surprising that epidemiological studies have shown high blood pressure to be a leading risk factor in the onset of aortic valve disease4. 
The only treatment option currently available for valve disease is surgical replacement of the diseased valve with a bioprosthetic or mechanical valve5. Improved understanding of valve biology in response to physical stresses would help elucidate the mechanisms of valve pathogenesis. In turn, this could help in the development of non-invasive therapies such as pharmaceutical intervention or prevention. Several bioreactors have been previously developed to study the mechanobiology of native or engineered heart valves6-9. Pulsatile bioreactors have also been developed to study a range of tissues including cartilage10, bone11 and bladder12. The aim of this work was to develop a cyclic pressure system that could be used to elucidate the biological response of aortic valve leaflets to increased pressure loads. 
The system consisted of an acrylic chamber in which to place samples and produce cyclic pressure, viton diaphragm solenoid valves to control the timing of the pressure cycle, and a computer to control electrical devices. The pressure was monitored using a pressure transducer, and the signal was conditioned using a load cell conditioner. A LabVIEW program regulated the pressure using an analog device to pump compressed air into the system at the appropriate rate. The system mimicked the dynamic transvalvular pressure levels associated with the aortic valve; a saw tooth wave produced a gradual increase in pressure, typical of the transvalvular pressure gradient that is present across the valve during diastole, followed by a sharp pressure drop depicting valve opening in systole. The LabVIEW program allowed users to control the magnitude and frequency of cyclic pressure. The system was able to subject tissue samples to physiological and pathological pressure conditions. This device can be used to increase our understanding of how heart valves respond to changes in the local mechanical environment.

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

A cyclic pressure bioreactor capable of subjecting heart valve tissue to physiological and pathological pressure conditions has been designed. A LabVIEW program allows users to control pressure magnitude, amplitude and frequency. This device can be used to study the mechanobiology of heart valve tissue or isolated cells.

Conception d&#39;un bioréacteur pour la pression cyclique Ex Vivo Étude des valves cardiaques aortiques

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic ...

Electric Field-controlled Directed Migration of Neural Progenitor Cells in 2D and 3D Environments

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the central nervous system1,2. These endogenous EFs are generated by cellular regulation of ionic transport combined with the electrical resistance of cells and tissues. It has been reported that applied EF treatment can promote functional repair of spinal cord injuries in animals and humans3,4. In particular, EF-directed cell migration has been demonstrated in a wide variety of cell types5,6, including neural progenitor cells (NPCs)7,8. Application of direct current (DC) EFs is not a commonly available technique in most laboratories. We have described detailed protocols for the application of DC EFs to cell and tissue cultures previously5,11. Here we present a video demonstration of standard methods based on a calculated field strength to set up 2D and 3D environments for NPCs, and to investigate cellular responses to EF stimulation in both single cell growth conditions in 2D, and the organotypic spinal cord slice in 3D. The spinal cordslice is an ideal recipient tissue for studying NPC ex vivo behaviours, post-transplantation, because the cytoarchitectonic tissue organization is well preserved within these cultures9,10. Additionally, this ex vivo model also allows procedures that are not technically feasible to track cells in vivo using time-lapse recording at the single cell level. It is critically essential to evaluate cell behaviours in not only a 2D environment, but also in a 3D organotypic condition which mimicks the in vivo environment. This system will allow high-resolution imaging using cover glass-based dishes in tissue or organ culture with 3D tracking of single cell migration in vitro and ex vivo and can be an intermediate step before moving onto in vivo paradigms.

This protocol demonstrates methods used to establish 2D and 3D environments in custom-designed electrotactic chambers, which can track cells in vivo/ex vivo using time-lapse recording at the single cell level, in order to investigate galvanotaxis/electrotaxis and other cellular responses to direct current (DC) electric fields (EFs).

Champ électrique contrôlé par les migrations des Réalisé cellules progénitrices neurales dans des environnements 2D et 3D

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the ...

Cell Co-culture Patterning Using Aqueous Two-phase Systems

Cell patterning technologies that are fast, easy to use and affordable will be required for the future development of high throughput cell assays, platforms for studying cell-cell interactions and tissue engineered systems. This detailed protocol describes a method for generating co-cultures of cells using biocompatible solutions of dextran (DEX) and polyethylene glycol (PEG) that phase-separate when combined above threshold concentrations. Cells can be patterned in a variety of configurations using this method. Cell exclusion patterning can be performed by printing droplets of DEX on a substrate and covering them with a solution of PEG containing cells. The interfacial tension formed between the two polymer solutions causes cells to fall around the outside of the DEX droplet and form a circular clearing that can be used for migration assays. Cell islands can be patterned by dispensing a cell-rich DEX phase into a PEG solution or by covering the DEX droplet with a solution of PEG. Co-cultures can be formed directly by combining cell exclusion with DEX island patterning. These methods are compatible with a variety of liquid handling approaches, including manual micropipetting, and can be used with virtually any adherent cell type.

Aqueous two-phase systems were used to simultaneously pattern multiple populations of cells. This fast and easy method for cell patterning takes advantage of the phase separation of aqueous solutions of dextran and polyethylene glycol and the interfacial tension that exists between the two polymer solutions.

La co-culture de cellules utilisant une solution aqueuse Modélisation des systèmes biphasiques

Cell patterning  technologies that are fast, easy to use and affordable will be required for the  future development of high throughput cell assays, ...

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to intrinsic parameters within the process allow a high degree of control over scaffold characteristics including fiber diameter, alignment and porosity. By developing scaffolds with similar dimensions and topographies to organ- or tissue-specific extracellular matrices (ECM), micro-environments representative to those that cells are exposed to in situ can be created. 
The airway bronchiole wall, comprised of three main micro-environments, was selected as a model tissue. Using decellularized airway ECM as a guide, we electrospun the non-degradable polymer, polyethylene terephthalate (PET), by three different protocols to produce three individual electrospun scaffolds optimized for epithelial, fibroblast or smooth muscle cell-culture. Using a commercially available bioreactor system, we stably co-cultured the three cell-types to provide an in vitro model of the airway wall over an extended time period.
This model highlights the potential for such methods being employed in in vitro diagnostic studies investigating important inter-cellular cross-talk mechanisms or assessing novel pharmaceutical targets, by providing a relevant platform to allow the culture of fully differentiated adult cells within 3D, tissue-specific environments.

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Advancements in biomaterial technologies enable the development of three-dimensional multi-cell-type constructs. We have developed electrospinning protocols to produce three individual scaffolds to culture the main structural cells of the airway to provide a 3D in vitro model of the airway bronchiole wall.

Adapter le processus Électrofilage de fournir trois environnements uniques pour un Tri-couches<em&gt; In Vitro</em&gt; Modèle du mur Airway

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to ...

Photopatterning Proteins and Cells in Aqueous Environment Using TiO2 Photocatalysis

Organic contaminants adsorbed on the surface of titanium dioxide (TiO2) can be decomposed by photocatalysis under ultraviolet (UV) light. Here we describe a novel protocol employing the TiO2 photocatalysis to locally alter cell affinity of the substrate surface. For this experiment, a thin TiO2 film was sputter-coated on a glass coverslip, and the TiO2 surface was subsequently modified with an organosilane monolayer derived from octadecyltrichlorosilane (OTS), which inhibits cell adhesion. The sample was immersed in a cell culture medium, and focused UV light was irradiated to an octagonal region. When a neuronal cell line PC12 cells were plated on the sample, cells adhered only on the UV-irradiated area. We further show that this surface modification can also be performed in situ, i.e., even when cells are growing on the substrate. Proper modification of the surface required an extracellular matrix protein collagen to be present in the medium at the time of UV irradiation. The technique presented here can potentially be employed in patterning multiple cell types for constructing coculture systems or to arbitrarily manipulate cells under culture.

Photopatterning Proteins and Cells in Aqueous Environment Using TiO2 Photocatalysis

We describe a protocol for modifying cell affinity of a scaffold surface in aqueous environment. The method takes advantage of titanium dioxide photocatalysis to decompose organic film in the photo-irradiated region. We show that it can be used to create microdomains of scaffolding proteins, both ex situ and in situ.

Photopatterning protéines et des cellules dans une solution aqueuse Environnement Utilisation de TiO<sub&gt; 2</sub&gt; Photocatalyse

Organic contaminants adsorbed on the surface of titanium dioxide (TiO2) can be decomposed by photocatalysis under ultraviolet (UV) light. Here we describe ...

Aqueous Droplets Used as Enzymatic Microreactors and Their Electromagnetic Actuation

For the successful implementation of microfluidic reaction systems, such as PCR and electrophoresis, the movement of small liquid volumes is essential. In conventional lab-on-a-chip-platforms, solvents and samples are passed through defined microfluidic channels with complex flow control installations. The droplet actuation platform presented here is a promising alternative. With it, it is possible to move a liquid drop (microreactor) on a planar surface of a reaction platform (lab-in-a-drop). The actuation of microreactors on the hydrophobic surface of the platform is based on the use of magnetic forces acting on the outer shell of the liquid drops which is made of a thin layer of superhydrophobic magnetite particles. The hydrophobic surface of the platform is needed to avoid any contact between the liquid core and the surface to allow a smooth movement of the microreactor. On the platform, one or more microreactors with volumes of 10 &#181;L can be positioned and moved simultaneously. The platform itself consists of a 3 x 3 matrix of electrical double coils which accommodate either neodymium or iron cores. The magnetic field gradients are automatically controlled. By variation of the magnetic field gradients, the microreactors' magnetic hydrophobic shell can be manipulated automatically to move the microreactor or open the shell reversibly. Reactions of substrates and corresponding enzymes can be initiated by merging the microreactors or bringing them into contact with surface immobilized catalysts.

Lab-in-a-drop reaction systems allow the versatile implementation of complex reactions in a microfluidic scale. An automated actuation platform consisting of a 3 x 3 matrix of electromagnetic coils was developed and successfully used to merge two 10 &#181;L microreactors and thereby initiate an enzymatic reaction in the resulting liquid marbles.

Aqueux gouttelettes servis de microréacteurs enzymatiques et leur déclenchement électromagnétique

For the successful implementation of microfluidic reaction systems, such as PCR and electrophoresis, the movement of small liquid volumes is essential. In ...

Characterizing Cell Migration Within Three-dimensional In Vitro Wound Environments

Currently, most in vitro models of wound healing, such as well-established scratch assays, involve studying cell migration and wound closure on two-dimensional surfaces. However, the physiological environment in which in vivo wound healing takes place is three-dimensional rather than two-dimensional. It is becoming increasingly clear that cell behavior differs greatly in two-dimensional vs. three-dimensional environments; therefore, there is a need for more physiologically relevant in vitro models for studying cell migration behaviors in wound closure. The method described herein allows for the study of cell migration in a three-dimensional model that better reflects physiological conditions than previously established two-dimensional scratch assays. The purpose of this model is to evaluate cell outgrowth via the examination of cell migration away from a spheroid body embedded within a fibrin matrix in the presence of pro- or anti-migratory factors. Using this method, cell outgrowth from the spheroid body in a three-dimensional matrix can be observed and is easily quantifiable over time via brightfield microscopy and analysis of spheroid body area. The effect of pro-migratory and/or inhibitory factors on cell migration can also be evaluated in this system. This method provides researchers with a simple method of analyzing cell migration in three-dimensional wound associated matrices in vitro, thus increasing the relevance of in vitro cell studies prior to the use of in vivo animal models.

Characterizing Cell Migration Within Three-dimensional In Vitro Wound Environments

The goal of this protocol is to evaluate the effect of pro- and anti-migratory factors on cell migration within a three-dimensional fibrin matrix.

Caractérisation de la Migration cellulaire dans les trois dimensions In Vitro plaie environnements

Currently, most in vitro models of wound healing, such as well-established scratch assays, involve studying cell migration and wound closure on ...

Protocol for MicroRNA Transfer into Adult Bone Marrow-derived Hematopoietic Stem Cells to Enable Cell Engineering Combined with Magnetic Targeting

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates after injection into injured tissues as well as the observed massive cell death rates lead to very restricted therapeutic effects. To overcome these limitations, we sought to establish a non-viral based protocol for suitable cell engineering prior to their administration. The modification of human CD133+ expressing SCs using microRNA (miR) loaded magnetic polyplexes was addressed with respect to uptake efficiency and safety as well as the targeting potential of the cells. Relying on our protocol, we can achieve high miR uptake rates of 80&#8211;90% while the CD133+ stem cell properties remain unaffected. Moreover, these modified cells offer the option of magnetic targeting. We describe here a safe and highly efficient procedure for the modification of CD133+ SCs. We expect this approach to provide a standard technology for optimization of therapeutic stem cell effects and for monitoring of the administered cell product via magnetic resonance imaging (MRI).

This protocol illustrates a safe and efficient procedure to modify CD133+ hematopoietic stem cells. The presented non-viral, magnetic polyplex-based approach may provide a basis for the optimization of therapeutic stem cell effects as well as for monitoring the administered cell product via magnetic resonance imaging.

Protocole de transfert de micro-ARN dans la moelle osseuse hématopoïétique cellules souches adultes pour activer la cellule génie combiné avec un ciblage magnétique

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates ...

Material Formation of Recombinant Spider Silks through Aqueous Solvation using Heat and Pressure

Many spiders produce seven types of silks. Six of the silks are fiber in form when produced by the spiders. These fibers are not water soluble. In order to reproduce the remarkable mechanical properties of spider silks, they must be produced in heterologous hosts as spiders are both territorial and cannibalistic. The synthetic analogs of spider silk also tend to be insoluble in aqueous solutions. Thus, a large percentage of research in recombinant spider silks rely upon organic solvents that are detrimental to large scale production of materials. Our group&#8217;s method forces the solvation of these recombinant spider silks into water. Remarkably, when these proteins are prepared using this method of heat and pressure, a wide range of material forms can be prepared from the same solution of recombinant spider silk proteins (rSSp) including: films, fibers, sponge, hydrogel, lyogel, and adhesives. This article demonstrates the production of the solvated rSSp and material forms in a manner that is more easily understood than from written materials and methods alone.

Here, we present a protocol to produce water soluble recombinant spider silk protein solutions and the material forms that can be formed from those solutions.

Formation matérielle de soies d’araignée recombinantes par solvatation aqueuse utilisant la chaleur et la pression

Many spiders produce seven types of silks. Six of the silks are fiber in form when produced by the spiders. These fibers are not water soluble. In order ...