Os experimentos realizados neste vídeo-artigo foram desenvolvidos para a competição internacional Máquina Genetically Engineered 9. Os autores gostariam de agradecer aos membros da equipe iGEM Lucas Bergwerff, Pieter van TM Boheemen, Jelmer Cnossen, Hugo F. Cueto Rojas e Ramon van der Valk para a assistência na pesquisa. Agradecemos Han de Winde, Stefan de Kok e Esengül Yıldırım para discussões úteis e hospedagem desta pesquisa. Este trabalho foi financiado pela TU Delft University Departamento de Biotecnologia, a Delft Bioinformática laboratório, TU Delft Departamento de Bionanoscience, areias petrolíferas Leadership Initiative (OSLI), Stud studentenuitzendbureau, Iniciativa Holanda Genomics, Centro Kluyver, Biotechnologische Nederlandse Vereniging (Stichting Biotecnologia Nederland) , DSM, Geneart, Greiner Bio-One e Genencor.

1. Biotijolo Assembléia <ol><li> BioBricks do Registro de Standard partes biológicas são fornecidos pela sede iGEM. Para construir um novo a partir de biotijolo BioBricks existentes, digerir o doador biotijolo (até 1,0 ug) com as enzimas EcoRI e SpeI para posicionar os doadores jusante parte da parte de aceitador. Digest com Xbal e PstI para colocar a parte do doador a montante da parte aceitador. Adicionar uma enzima de restrição apropriada terceiro que corta na espinha dorsal do doador. Realizar as digestões num volume total de 20-25 ml com o tampão apropriado, de acordo com o fornecedor (concentração final de 1 x). Use 5 unidades / ug de ADN para as enzimas de restrição. </li><li> Digerir o biotijolo aceitador com um EcoRI e XbaI ou SpeI e PstI. </li><li> Incubar as digestões de (pelo menos) uma hora a 37 ° C. Inactivar as endonucleases de restrição por calor, a incubação a 80 ° C durante 10 min e centrifuga-se brevemente. </li><li> Ligar o biotijolo digeridopartes (dador e do aceitador) em conjunto. Desde XbaI e SpeI gerar extremidades de ADN compatíveis, um site misto é criado que não pode ser cortado com qualquer enzima de restrição resultando num novo biotijolo &quot;combinado&quot;, que flanqueado por os 4 sítios de restrição padrão. Na mistura de ligação à concentração final de ADN é de preferência ~ 100 ng / uL. Realizar a reacção de ligação num volume total de 10-15 ml com o tampão de ligação T4 (concentração final de 1 x) e ligase de T4 (1 unidade / ug de ADN). </li><li> Incubar a mistura de ligação a 16 ° C durante pelo menos 3 horas. </li><li> Realizar a reacção de transformação de cerca de meia da mistura de ligação. </li><li> Confirme o biotijolo ser correto com o sequenciamento. </li><li> Para construir um novo biotijolo de ADN sintetizado, modificar os genes para a síntese para a expressão óptima em E. coli, por meio da ferramenta de website JCat ( <a href="http://www.jcat.de/" target="_blank">http://www.jcat.de/</a> ). Fazer modificações adicionais, em conformidade com os requisitos da B<html> ioBrick padrão. Esta padronização implica que cada biotijolo é composta de uma sequência de ADN de interesse precedido por um prefixo e seguido por um sufixo. O prefixo e sufixo são seqüências que contêm sítios de restrição predefinidos, que estão ausentes na sequência restante plasmídeo. Estes sítios de restrição padrão tornam possível trocar e estender as inserções biotijolo flexível 9. O prefixo e sufixo têm as seguintes seqüências: </li></ol><table border="1"><tbody><tr><td> Nome </td><td> Seqüência </td><td> Comentário </td></tr><tr><td> Prefixo </td><td> 5 &#39;GAATTCGCGGCCGCTTCTAG3&#39; </td><td></td></tr><tr><td></td><td> 5 &#39;GAATTCGCGGCCGCTTCTAGAG 3&#39; </td><td> Se a parte que se segue é uma sequência de codificação ou de qualquer parte que começa com &quot;ATG&quot; </td></tr><tr><td> Sufixo </td><td> 5 &#39;TACTAGTAGCGGCCGCTGCAG 3&#39; </td><td></td></tr></tbody></table>ove_title &quot;&gt; 2. Conversão Alkane ensaio de células em repouso, In Vivo Este ensaio foi realizado com base no método descrito por Fujii et al. (2004). <ol><li> Cultura E. As células de E. coli que expressam o sistema Hidroxilase alcano ( <a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_K398014</a> ) e células transportando um vector vazio ( <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> ) em 5 ml de meio LB com antibióticos apropriados durante a noite. </li><li> Transferir 500 uL da cultura durante a noite em 50 ml de LB fresco (com antibiótico) e incubar até a turbidez celular atingiu uma DO (densidade óptica) de 0,3 a 600 nm. </li><li> Centrifugar durante 10 minutos a 4.000 rpm e ressuspender o sedimento em 5 ml de tampão de fosfato 0,1 M (pH 7,4). </li><li> Centrifugar novamente durante 10 min a 4.000 rpm e ressuspender o sedimento em 5 ml de tampão fosfato 0,1 M contendo agora sais de E2 e 0,66% de glicerol v / v (azoto-defit médio). </li><li> Medir a turbidez da célula (OD 600). </li><li> Prepare célula mistura-se alíquotas de 6 ml em frascos de 25 ml fechado de tampão de vidro e não de células controles (sais de E2 + 0,66% de glicerol v / v). </li><li> Adicionar 100 nmol de alcano a cada frasco. </li><li> Incubar as misturas a 37 ° C durante 24 horas (quando diminuir as taxas mais elevadas obtêm-se). </li><li> Medir a OD 600 após incubação. </li><li> Extrair os hidrocarbonetos no meio de cultura com acetato de etilo e determinar a concentração de hidrocarboneto em cultura celular por cromatografia gasosa (ver protocolo 3). </li><li> Calcula-se a degradação por unidade de biomassa através da divisão da quantidade total de alcano convertido pela biomassa total presente em cada frasco (converter OD 600 de peso seco). Dividindo o resultado pela duração experimental produz a actividade de degradação por unidade de biomassa por unidade de tempo. A média é calculada a partir de três experiências individuais. </li></ol> 3. Alcano Ensaio Enzima de conversão, emVitro Este ensaio foi efectuado essencialmente de acordo com o método descrito por Li et al. (2008). <ol><li> Cultura E. As células de E. coli que expressam o gene Lada ( <a href="http://partsregistry.org/Part:BBa_K398017" target="_blank">BBa_K398017</a> ) e células portadoras de um vector vazio ( <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> ) em 50 ml de meio LB com antibióticos apropriados durante a noite. </li><li> Transferir 500 uL da cultura durante a noite em 50 ml de LB fresco (com antibiótico) e incubar até a turbidez celular atingiu uma densidade óptica de 0,6 a 600 nm. </li><li> Centrifugar 10 min a 4000 rpm (4 ° C) e ressuspender o sedimento em 5 ml de tampão Tris 50 mM. </li><li> Sonicado (disruptor celular, LA Biosystems), as células no ciclo de trabalho de 40%, com um controlo de saída de 4, manter a solução em gelo durante todo o período. </li><li> Centrifugar a mistura resultante durante 5 min a 4000 rpm a 4 &amp; dpor exemplo, C para remover os restos celulares. Transferir o sobrenadante para um tubo fresco. </li><li> Determinar a concentração de proteína total dos extractos de células por ensaio de Bradford. Nota: Utilizar frascos de vidro para evitar o crescimento de fundo e / ou a perda de proteínas. </li><li> Prepara-se uma mistura de 100 ml contendo 0,1% v / v de alcano e 50 mM de tampão Tris-HCl. </li><li> Aquecer a mistura a 100 ° C durante 5 min. Nota: Realize esta etapa apenas para alcanos médio de cadeia longa, com alto ponto de ebulição. (Por exemplo, C 16: 287 ° C). </li><li> Para alcançar uma solubilidade óptima do alcano, sonicar durante 1 min, enquanto ainda quente, até uma mistura viscosa homogénea é obtida. </li><li> Adicionar 1 mM de NADH, 1 mM de FMN, 1 mM de MgSO 4 e 0,01 v / v de Triton X-100. </li><li> Prepare 6 alíquotas ml em 25 ml-tampão fechado frascos. </li><li> Adicionar a quantidade adequada de extracto de células (dependendo do ensaio de Bradford, à concentração final de 5 mg de proteína / l). Prepare um controle não-proteína. </li><li> Incubar a 60 ° C (para e óptimanzymatic actividade) durante 24 h. </li><li> Extrair os hidrocarbonetos no meio de cultura com acetato de etilo e determinar a concentração de hidrocarboneto em cultura celular por cromatografia gasosa (ver protocolo 3). </li><li> Calcula-se a degradação por unidade de biomassa através da divisão da quantidade total de alcano convertido por proteína total adicionado a cada frasco (por Bradford curva de calibração). Além disso dividindo por a duração da experiência produz a actividade de degradação por unidade de proteína celular por unidade de tempo. A média é calculada a partir de três experiências individuais. </li></ol> 4. Extração de hidrocarbonetos e acetato de medições de concentração <ol><li> Alcanos são extraídos a partir da solução aquosa por adição de 2,5 ml de acetato de etilo (Solvant apolar) a 6 ml de solução experimental. Um padrão interno é adicionado ao solvente, a uma concentração de 0,1% (v / v). O padrão (por exemplo, ciclo-decan) pode variar dependendo da gama esperada dos picos de interesse. </li><li> Opcional: Adicionar TritonX-100 à mistura aquosa e centrifugar as amostras durante 10 min a 4000 rpm a fim de obter um sistema bi-fásico adequado. </li><li> Vortex a mistura durante 5 seg (1.500 rpm) e incuba-se à temperatura ambiente até as duas fases separadas. </li><li> Remover uma quantidade máxima da camada orgânica (superior) e secar-se o solvente sobre sulfato de magnésio anidro. </li><li> Remover MgSO4 por filtração (0,2 um) e transferir o filtrado para frascos cromatógrafo de gás para as medições, ou armazenar a -20 ° C. </li><li> Determinar a concentração por meio de cromatografia gasosa utilizando uma coluna CP-SIL 5CB (comprimento = 5 m). Injectam-se 10 ul de amostra no modo de divisão (1:10, 230 ° C). Definir o fluxo de gás de coluna a 1 ml / min (hélio). O seguinte programa de temperaturas do forno é usado: <table border="1"><tbody><tr><td> Taxa </td><td> Temperatura [° C] </td><td> Tempo [min] </td></tr><tr><td> 0 </td><td> 50 </td><td> 7,5 </td></tr><tr><td> 50 </td><td> 90 </td><td> 1,0 </td></tr><tr><td> 50 </td><td> 110 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 130 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 145 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 160 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 170 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 185 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 210 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 250 </td><td> 2,0 </td></tr><tr><td> 50 </td><td> 320 </td><td> 2,0 </td></tr></tbody></table></li><li> Integrar os picos e corrigir as concentrações em relação ao padrão interno. </li></ol> 5. Álcool / aldeído desidrogenase Ensaio Este ensaio foi efectuado essencialmente de acordo com o método descrito por Kato et al.(2010). <ol><li> Cultura E. As células de E. coli que expressam o ADH ( <a href="http://partsregistry.org/Part:BBa_K398018" target="_blank">BBa_K398018</a> ) ou ALDH ( <a href="http://partsregistry.org/Part:BBa_K398030" target="_blank">BBa_K398030</a> gene) e células portadoras de um vector vazio ( <a href="http://partsregistry.org/Part:BBa_J13002" target="_blank">BBa_J13002</a> ) em 50 ml de meio LB com antibióticos apropriados durante a noite. </li><li> Transferir 500 uL da cultura durante a noite em 50 ml de LB fresco (com antibiótico) e incubar até a turbidez celular atingiu uma densidade óptica de 0,6 a 600 nm. </li><li> Centrifugar 10 min a 4.000 rpm a 4 ° C e ressuspender o sedimento em 5 ml de 50 mM de tampão Tris. </li><li> Sonicar a solução de células no ciclo de trabalho de 40% com um controlo de saída de 4 (manter a solução em gelo durante a sonicação). </li><li> Centrifugar a mistura resultante durante 5 min a 4000 rpm a 4 ° C para remover os restos celulares. </li><li> Para determinar oconcentração de proteína tal dos extractos celulares pelo ensaio de Bradford (Nota: utilizar um frasco de vidro para prevenir a ligação da proteína). </li><li> Carregar uma placa de 96 poços com 180 ul de 57 mM de tampão de glicina contendo NAD (concentração final 1 mM, pH 9,5) em cada poço. </li><li> Adicionam-se 5 ul de álcool (aldeído) a ser testado para os poços. Nota: os álcoois de cadeia longa de calor antes do início do ensaio, para ter um líquido. Para cada álcool (aldeído) um controlo sem substrato deve ser adicionado (controlo negativo). Além disso, preparar um branco contendo uma mistura de solução tampão e do substrato, sem extracto celular. </li><li> Pré-aqueça o prato de o leitor de placas (Tecan Magellan v7.0) durante 15 min a 37 ° C para permitir o equilíbrio do sistema. </li><li> Adicionar a quantidade adequada de extracto de células (dependendo do ensaio de Bradford, à concentração final de 5 mg de proteína / l). Prepare um controle não-proteína. </li><li> Medir a produção de NADH utilizando um espectrofotómetro a um comprimento de onda de 340 nm a cada 2-3 min durante 1 hora a 37 ° C. &lt;/ Li&gt; <li> Calcula-se a taxa de produção de NADH a partir do declive da DO (340 nm). Leve em conta o comprimento do caminho de luz e coeficiente de extinção do NADH de 6220 M -1 cm -1. Dividir a taxa de produção de NADH com a quantidade total de proteína adicionada para expressar a actividade da reacção de desidrogenase no extracto celular (U / mg de proteína celular total). Calcula-se a média e o desvio padrão de três experiências independentes. </li></ol> 6. Caracterização pCaiF <ol><li> Cultura E. As células de E. coli que expressam a construção pCaiF-GFP ( <a href="http://partsregistry.org/Part:BBa_K398331" target="_blank">BBa_K398331</a> ) e as células que transportam o promotor sozinho ( <a href="http://partsregistry.org/Part:BBa_K398326" target="_blank">BBa_K398326</a> ) durante a noite em 5 ml de meio LB durante a noite os antibióticos apropriados. </li><li> Inocular 5 ml M9 contendo glicose a 10 g / l e os antibióticos, com 50 uL da cultura durante a noite e crescer durante a noite. </li&gt; <li> Ul subcultura 50 da excrescência durante a noite em 5 ml de fresco M9 with10 g / l e incubado até a turbidez celular atingiu uma densidade óptica de 0,2 a 600 nm. </li><li> Carregar uma placa de 96 poços com 100 ul de meio M9 fresco contendo a quantidade desejada de fonte de carbono para testar em cada poço. Realizar ensaios em triplicado para a avaliação estatística e adicionar os respectivos controlos negativos (de tipo selvagem de E. coli K12). </li><li> Adicionam-se 5 ul da cultura durante a noite para os poços contendo meio. </li><li> Medir a curva de crescimento (DO 600) e GFP de fluorescência (485 nm de excitação e de emissão de 520), utilizando um leitor de placas a cada 10 min durante 18 horas a 37 ° C com agitação constante. </li><li> Calcula-se a taxa de crescimento e o teor de GFP específica a partir das medições respectivas e comparar com o controlo. Calcula-se a média e o desvio padrão de pelo menos três experiências independentes. </li></ol> 7. Ensaio de tolerância <ol><li> CulturaE. coli expressando o gene PhPFDα e β ( <a href="http://partsregistry.org/Part:BBa_K398406" target="_blank">BBa_K398406</a> ) durante a noite em 5 ml de meio LB e os antibióticos apropriados. E. coli que expressam Lada gene ( <a href="http://partsregistry.org/Part:BBa_K398017" target="_blank">BBa_K398017</a> ) é utilizado como controlo negativo. </li><li> Ul subcultura 10 da excrescência durante a noite em 5 ml de LB fresco (com antibiótico) e incuba-se até que a turbidez celular atingiu uma densidade óptica de 0,3 a 0,4 a 600 nm. </li><li> Diluir as culturas com meio fresco até uma OD 600 de 0,1 seja alcançado. </li><li> Carregar uma placa de 96 poços com 180 ul de meio M9 contendo os antibióticos adequados e a concentração final apropriada do composto tóxico (por exemplo, 0, 4, 8, 10% de n-hexano), em triplicado. Porque alcano-misturas de água pode levar a sistemas de duas fases é essencial ter controlos apropriados na placa (por exemplo, dcepas iferentes e as experiências respectivas em branco). </li><li> Adicionar 20 ul da cultura (controlo) nos poços. </li><li> Medir a concentração da biomassa (OD 600), utilizando um leitor de placas a cada 10 min durante 24 h, a 37 ° C com agitação constante. </li><li> Calcular as taxas de crescimento a partir das medições para as respectivas concentrações de agentes diferentes e comparar com o controlo negativo. Calcula-se a média e o desvio padrão de pelo menos três experiências independentes. </li></ol> 8. Mapeamento de Interação homólogo <ol><li> O aplicativo foi desenvolvido ELE para realizar consultas de proteína em um servidor de banco de dados PostgreSQL executando a STRING (grátis para uso acadêmico) 20. O homólogo aplicativo de mapeamento interação identifica proteínas interagem no organismo hospedeiro original, usando o banco de dados STRING. As sequências dos genes respectivos que interagem são utilizadas numa pesquisa BLAST para encontrar genes homólogos no organismo alvo. Cytoscape 4 </sse&gt; é usada para visualizar o resultado do mapeamento. A ferramenta de software ele pode ser baixado em: <a href="https://github.com/jcnossen/InteractionHomologMapping" target="_blank">https://github.com/jcnossen/InteractionHomologMapping.</a> </li><li> Para realizar um mapeamento, (1) inserir a ID biotijolo ea aplicação irá baixar automaticamente os dados das peças de seqüência do registro de Standard Partes Biológicas 9, ou (2) entrar (colar) os dados de seqüência na aplicação. </li><li> Use o site banco de dados STRING para encontrar o ID de proteínas STRING para a seqüência de ácido amino entrou. </li><li> Uma proteína com alta homologia é determinada utilizando BLAST. Subsequentemente, a aplicação relaciona cada proteína interagindo conhecida no organismo fonte e procura por homólogos no organismo hospedeiro (por exemplo, E. coli). </li><li> Exportar lista interação resultante putativo de texto ou Cytoscape. </li></ol>

<ol>
	<li>Allen, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Process+water+treatment+in+Canada's+oil+sands+industry:+I:+Target+pollutants+and+treatment+objectives.">Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives.</a> J. Environ. Eng. Sci. 7, 123-138 (2008).</li><li>Alon, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> An Introduction to Systems Biology: Design Principles of Biological Circuits. , (2007).</li><li>Center, O. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Understanding Oil Spills and Oil Spill Response. , (1999).</li><li>Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+the+caiF+gene+encoding+a+potential+transcriptional+activator+of+carnitine+metabolism+in+Escherichia+coli.">Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli.</a> J. Bacteriol. 178, 1248-1257 (1995).</li><li>Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+and+proteome+of+long-chain+alkane+degrading+Geobacillus+thermodenitrificans+NG80-2+isolated+from+a+deep-subsurface+oil+reservoir.">Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir.</a> Proc. Natl. Acad. Sci. U.S.A. 104 (13), 5602-5607 (2007).</li><li>Fujii, T., Narikawa, T., Takeda, K., Kato, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotransformation+of+various+alkanes+using+the+Escherichia+coli+expressing+an+alkane+hydroxylase+system+from+Gordonia+sp.+TF6.">Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6.</a> Biosci. Biotechnol. Biochem. 68 (10), 2171-2177 (2004).</li><li>Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cloning+of+an+alcohol+dehydrogenase+from+thermophilic+alkane-degrading+Bacillus+thermoleovorans+B23.">cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23.</a> J. Biosci. Bioeng. 91 (1), 100-102 (2001).</li><li>Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+cloning+and+characterization+of+an+aldehyde+dehydrogenase+from+long-chain+alkane-degrading+Geobacillus+thermoleovorans+B23.">Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23.</a> Extremophiles. 14, 33-39 (2010).</li><li>Kieboom, J., De Bont, J. a. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Bacterial Stress Responses. , (2000).</li><li>Kotte, O., Zaugg, J. B., Heinemann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+adaptation+through+distributed+sensing+of+metabolic+fluxes.">Bacterial adaptation through distributed sensing of metabolic fluxes.</a> Mol Syst Biol. 6, 355 (2010).</li><li>Kremling, A., Bettenbrock, K., Gilles, E. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+global+control+of+Escherichia+coli+carbohydrate+uptake.">Analysis of global control of Escherichia coli carbohydrate uptake.</a> BMC Syst. Biol. 1, (2007).</li><li>Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+long-chain+alkane+monooxygenase+(LadA)+in+complex+with+coenzyme+FMN:+unveiling+the+long-chain+alkane+hydroxylase.">Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase.</a> J. Mol. Biol. 376 (2), 453-465 (2008).</li><li>Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+the+maximum+specific+uptake+capacities+for+glucose+and+oxygen+in+glucose-limited+fed-batch+cultivations+of+Escherichia+coli.">Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli.</a> Biotechnol. Bioeng. 73 (5), 347-357 (2001).</li><li>Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overexpression+of+prefoldin+from+the+hyperthermophilic+archaeum+Pyrococcus+horikoshii+OT3+endowed+Escherichia+coli+with+organic+solvent+tolerance.">Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance.</a> Appl. Microbiol. Biotechnol. 79 (3), 443-449 (2008).</li><li>Rehm, H. J., Reiff, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+and+occurrence+of+microbial+oxidation+of+long-chain+alkanes.">Mechanisms and occurrence of microbial oxidation of long-chain alkanes.</a> Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).</li><li>Rojo, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Degradation+of+alkanes+by+bacteria.">Degradation of alkanes by bacteria.</a> Environ. Microbiol. 11 (10), 2477-2490 (2009).</li><li>Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Pseudomonas+putida+alkane-degradation+gene+clusters+and+flanking+insertion+sequences:+evolution+and+regulation+of+the+alk+genes.">Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes.</a> Microbiology. 147, 1621-1630 (2001).</li><li>Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+a+novel+thermophilic+Bacillus+strain+degrading+long-chain+n-alkanes.">Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes.</a> Extremophiles. 10 (4), 347-356 (2006).</li></ol>

Não há conflitos de interesse declarados.

O princípio biotijolo é utilizado para construir um chassis para a degradação dos alcanos e uma prova de princípio para os componentes individuais da caixa de ferramentas foi obtido. Os ensaios são propostas diversas para medir a in vivo e in vitro a actividade de enzimas da via de alcano degradantes. O trabalho apresentado demonstra com sucesso um número de métodos que podem ser usados ​​para determinar as actividades enzimáticas e de expressão do organismo hospedeiro E. coli ap...

Oil pollution is among the most serious causes of environmental contamination, and greatly affects ecosystems, businesses and communities 3. Solutions are for example required to battle the continuous oil pollution originating from the oil sands tailing waters in Alberta, Canada. During the process of oil extraction from oil sands, bitumen, a semi-solid oxidized form of oil, is removed using thermal recovery techniques that consume about 3.1 barrels of water per single barrel of oil 1. Oil contaminated process water, mainly originating from a local river, is stored in tailing ponds after bitumen extraction. A more effective recycling of process water in order to reduce the need for freshwater uptake is needed. To facilitate the bitumen extraction and to ensure that downstream sites meet water quality guidelines for the protection of aquatic ecosystems, process water treatments are rapidly evolving 3.
To treat pollution of organic compounds, bioremediation technologies employing microorganisms are presently encouraged 1. Alkanes are the most abundant family of hydrocarbons in crude oil, containing 5 to 40 carbon atoms per molecule 7, 21. Many bacteria are known to degrade alkanes of various lengths via sequential oxidation of the terminal methyl group forming first alcohols, then aldehydes and finally fatty acids 8. Within this iGEM project several enzymes from different organisms were expressed and characterized, and made available via the BioBrick standard and Registry of Standard Biological Parts.
The well-studied alkane hydroxylase system of Gordonia sp. TF6 facilitates the initial oxidation step of C5-C13 alkanes along with that of C5-C8 cycloalkanes using a minimum of four components: alkB2 (alkane 1-monooxygenase), rubA3, rubA4 (two rubredoxins) and RubB (rubredoxin reductase) 8, 21. Oxidation of long-chain alkanes (ranging from C15 up to C36) is reported to be performed by ladA, a flavoprotein alkane monooxygenase from Geobacillus thermodinitrificans NG-80-2 7, 15, 18, 22. LadA forms a catalytic complex with flavin mononucleotide (FMN) that utilizes atomic oxygen for oxidation. This results in the conversion of alkanes into the corresponding primary alkanol. The alcohols are further oxidized by alcohol and aldehyde dehydrogenases to fatty acids, which readily enter the &beta;-oxidation pathway 7, 21. A zinc-independent alcohol dehydrogenase from the thermophillic bacterium Geobacillus thermoleovorans B23 oxidizes medium-chain alkanols into their respective alkanals, using NAD+ as a cofactor 10. Aldehyde dehydrogenase from the same bacterium is able to catalyze the NAD+-dependent final step in the medium-chain oxidation 11.
In order to reduce induction costs and to maintain optimal proliferation of the bacterial system, the promoter pCaiF from E.coli was characterized. This promoter can regulate expression of the hydrocarbon degradation pathway components, and is regulated by cAMP-Crp levels, which in turn depend on glucose levels 6. At high extracellular glucose concentrations in the environment the cellular cAMP (cyclic Adenosine Mononucleotide Phosphate) level was low through the inhibition of adenylyl cyclase as a side effect of PTS mediated glucose transport. Conversely, during limitation (low glucose concentrations) the cAMP level increased and Crp bound to cAMP forming the complex, cAMP-Crp, which bound pCaiF and activated transcription of the downstream components 6, 14.
Wildtype E. coli can only tolerate moderate concentrations of hydrocarbons. To complete the toolkit, tolerance to hydrocarbons had to be addressed. Several organic solvent-tolerant bacteria are known to survive in water-solvent two-phase systems 12. Molecular components known to increase tolerance are chaperones that facilitate the correct folding of proteins. The prefoldin system from Pyrococcus horikoshii OT3, consisting of the proteins phPFD&alpha; and phPFD&beta;, was shown to increase hydrocarbon-tolerance 17.
The alkane conversion toolkit was constructed following the BioBrick principle, which is documented at the Registry of Standard Biological Parts 9. BioBricks are plasmids containing a specific functional insert that is flanked by 4 predefined restriction sites. The BioBrick inserts can be extended flexibly, allowing the construction of biological systems with new functions.

<table border="1">
	<tbody>
		<tr>
			<td>Name of the reagent</td>
			<td>Company</td>
			<td>Catalogue number</td>
			<td>Comments (optional)</td>
		</tr>
		<tr>
			<td>E. coli K12</td>
			<td>New England Biolabs</td>
			<td>C2523H</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Octane</td>
			<td>Fluka</td>
			<td>74822</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Hexadecane</td>
			<td>Fluka</td>
			<td>52209</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>octanol-1</td>
			<td>Fluka</td>
			<td>95446</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>dodecanol-1</td>
			<td>Sigma-Aldrich</td>
			<td>126799</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Hexane</td>
			<td>Sigma-Aldrich</td>
			<td>296090</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>NADH</td>
			<td>Sigma</td>
			<td>N4505</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>FMN</td>
			<td>Sigma</td>
			<td>F2253</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>J.T. Baker Casno</td>
			<td>7487 889</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T8787</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>T4 ligase</td>
			<td>New England Biolabs</td>
			<td>M0202L</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Gas chromatograph</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Cell disrupter</td>
			<td>LA Biosystems</td>
			<td>CD-019</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Amersham pharmacia</td>
			<td>spec 2000</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Plate reader</td>
			<td>Tecan</td>
			<td>Magellan v7.0</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>Innova, 44</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>BioBrick K398014: 
			BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_K398014</a></td>
			<td>Alkane Hydroxylase System 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398027: BBa_R0040-BBa_B0034-ladA</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398027" target="_blank">BBa_K398027</a></td>
			<td>ladA Protein Generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398018: BBa_J23100-BBa_J61101-ADH</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398018" target="_blank">BBa_K398018</a></td>
			<td>ADH generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398030: BBa_R0040-BBa_B0034-ALDH</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398030" target="_blank">BBa_K398030</a></td>
			<td>ALDH generator 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398326: pCaiF</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398326" target="_blank">BBa_K398326</a></td>
			<td>pCaiF promoter 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398331: pCaiF-BBa_B0032-BBa_I13401</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398331" target="_blank">BBa_K398331</a></td>
			<td>pCaiF measurement device 
			Resistance: Chloramphenicol</td>
		</tr>
		<tr>
			<td>BioBrick K398406: BBa_J23002-BBa_J61107-phPFD&alpha;-BBa_J61107-</td>
			<td>Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts</td>
			<td><a href="http://partsregistry.org/Part:BBa_K398406" target="_blank">BBa_K398406</a></td>
			<td>Solvent tolerance cluster 
			Resistance: Chloramphenicol</td>
		</tr>
	</tbody>
</table>

a toolkit to enable hydrocarbon conversion in aqueous environments

Este trabalho apresenta um conjunto de ferramentas que permite a conversão de alcanos por Escherichia coli e apresenta uma prova de princípio de sua aplicabilidade. O kit de ferramentas padrão consiste em várias peças intercambiáveis ​​(BioBricks) 9 abordando a conversão de alcanos, a regulação da expressão gênica e de sobrevivência em tóxicos hidrocarbonetos ambientes ricos. Um percurso de três passos para a degradação alcano foi implementada em E. coli para permitir a conversão de alcanos de média e de cadeia longa para as suas respectivas alcanois, e, finalmente, alkanals alcanóico-ácidos. Este último foi metabolizada pela via β-oxidação nativa. Para facilitar a oxidação de alcanos de cadeia média (C5-C13) e os cicloalcanos (C5-C8), quatro genes (alkB2, rubA3, rubA4 e Rubb) do sistema de alcano-hidroxilase a partir de Gordonia sp. TF6 8,21 foram transformados em E. coli. Para a conversão dealcanos de cadeia longa (C15-C36), o gene a partir de Lada Geobacillus thermodenitrificans foi implementada. Para os passos necessários adicionais do processo de degradação, ADH e ALDH (proveniente G. thermodenitrificans) foram introduzidos 10,11. A actividade foi medida por ensaios de células em repouso. Para cada passo de oxidação, a actividade da enzima foi observada. Para optimizar a eficiência do processo, a expressão foi induzida somente em condições de glucose baixa: um promotor de substrato-regulado, pCaiF, foi usado. pCaiF está presente em E. coli K12 e regula a expressão dos genes envolvidos na degradação de fontes não-glicose de carbono. A última parte do kit de ferramentas - visando a sobrevivência - foi implementado usando genes de tolerância de solventes, PhPFDα e β, ambos da Pyrococcus horikoshii OT3. Os solventes orgânicos podem induzir stress celular e diminuição da capacidade de sobrevivência por negativamente affecting enovelamento de proteínas. Como chaperones, PhPFDα e β melhorar o processo de dobragem de proteínas, por exemplo sob a presença de alcanos. A expressão destes genes conduziu a uma tolerância de hidrocarboneto melhorado mostrado por um aumento da taxa de crescimento (até 50%) na presença de 10% de n-hexano no meio de cultura foram observados. Resumindo, os resultados indicam que o kit de ferramentas permite E. coli para converter e tolerar hidrocarbonetos em ambientes aquosos. Como tal, representa um primeiro passo para uma solução sustentável para o óleo-remediação utilizando uma abordagem de biologia sintética.

Alkane conversion
The activity of the three oxidation steps from the alkane to the respective fatty acid was evaluated using resting cell assays and enzyme activity measurements. The results are presented following the pathway reactions (1) alkane hydroxylase, (2) alcohol dehydrogenase and (3) aldehyde dehydrogenase. 
For the first step, different plasmids were constructed for medium and long-chain alkanes. The plasmid <a href="http://partsregistry.org/Part:BBa_K398014" target="_blank">BBa_...

Watch this Scientific Journal Video about A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments at JoVE.com

Um kit de ferramentas para permitir a conversão de hidrocarbonetos em ambientes aquosos | Bioengenharia | Vídeo

A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

A auto sustentável regulação sistema bacteriano para a remediação de contaminações de óleo foi desenhado usando o padrão partes do DNA intercambiáveis ​​(BioBricks). Uma engenharia<em&gt; E. coli</emEstirpe&gt; foi usada para degradar a alcanos via β-oxidação em ambientes aquosos tóxicos. As enzimas respectivos de diferentes espécies mostraram atividade de degradação alcano. Além disso, um aumento da tolerância ao<em&gt; N</em&gt;-Hexano foi conseguida através da introdução de genes a partir de alcano-tolerantes bactérias.

Um kit de ferramentas para permitir a conversão de hidrocarbonetos em ambientes aquosos

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The ...

a-toolkit-to-enable-hydrocarbon-conversion-in-aqueous-environments

Education

Research

JoVE Core

JoVE Journal

Organic Chemistry

Biology

Bioengineering

Ecology

Unit 1

Ecosystems

Alkanes and Cycloalkanes

SCIENTISTS IN ACTION

14.0K visualizações.  Delft University of Technology. A auto sustentável regulação sistema bacteriano para a remediação de contaminações de óleo foi desenhado usando o padrão partes do DNA intercambiáveis ​​(BioBricks). Uma engenharia E. coli foi usada para degradar a alcanos via β-oxidação em ambientes aquosos tóxicos. As enzimas respectivos de diferentes espécies mostraram atividade de degradação alcano. Além disso, um aumento da tolerância ao N-Hexano foi consegu...

Vídeo: A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

Creating Two-Dimensional Patterned Substrates for Protein and Cell Confinement

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1 While microcontact printing can be employed to directly print a large number of molecules, including proteins,2 DNA,3 and silanes,4 the formation of self-assembled monolayers (SAMs) from long chain alkane thiols on gold provides a simple way to confine proteins and cells to specific patterns containing adhesive and resistant regions. This confinement can be used to control cell morphology and is useful for examining a variety of questions in protein and cell biology. Here, we describe a general method for the creation of well-defined protein patterns for cellular studies.5 This process involves three steps: the production of a patterned master using photolithography, the creation of a PDMS stamp, and microcontact printing of a gold-coated substrate. Once patterned, these cell culture substrates are capable of confining proteins and/or cells (primary cells or cell lines) to the pattern.
The use of self-assembled monolayer chemistry allows for precise control over the patterned protein/cell adhesive regions and non-adhesive regions; this cannot be achieved using direct protein stamping. Hexadecanethiol, the long chain alkane thiol used in the microcontact printing step, produces a hydrophobic surface that readily adsorbs protein from solution. The glycol-terminated thiol, used for backfilling the non-printed regions of the substrate, creates a monolayer that is resistant to protein adsorption and therefore cell growth.6 These thiol monomers produce highly structured monolayers that precisely define regions of the substrate that can support protein adsorption and cell growth. As a result, these substrates are useful for a wide variety of applications from the study of intercellular behavior7 to the creation of microelectronics.8
While other types of monolayer chemistry have been used for cell culture studies, including work from our group using trichlorosilanes to create patterns directly on glass substrates,9 patterned monolayers formed from alkane thiols on gold are straight-forward to prepare. Moreover, the monomers used for monolayer preparation are commercially available, stable, and do not require storage or handling under inert atmosphere. Patterned substrates prepared from alkane thiols can also be recycled and reused several times, maintaining cell confinement.10

Self-assembled monolayers (SAMs) formed from long chain alkane thiols on gold provide well-defined substrates for the formation of protein patterns and cell confinement. Microcontact printing of hexadecanethiol using a polydimethylsiloxane (PDMS) stamp followed by backfilling with a glycol-terminated alkane thiol monomer produces a pattern where protein and cells adsorb only to the stamped hexadecanethiol region.

Criando Two-Dimensional Substratos modelado para Confinamento de proteína e celular

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1  While microcontact printing ...

Bioengenharia

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic valve leaflets are composed of interstitial cells suspended within an extracellular matrix (ECM) and are lined with an endothelial cell monolayer. The valve withstands a harsh, dynamic environment and is constantly exposed to shear, flexion, tension, and compression. Research has shown calcific lesions in diseased valves occur in areas of high mechanical stress as a result of endothelial disruption or interstitial matrix damage1-3. Hence, it is not surprising that epidemiological studies have shown high blood pressure to be a leading risk factor in the onset of aortic valve disease4. 
The only treatment option currently available for valve disease is surgical replacement of the diseased valve with a bioprosthetic or mechanical valve5. Improved understanding of valve biology in response to physical stresses would help elucidate the mechanisms of valve pathogenesis. In turn, this could help in the development of non-invasive therapies such as pharmaceutical intervention or prevention. Several bioreactors have been previously developed to study the mechanobiology of native or engineered heart valves6-9. Pulsatile bioreactors have also been developed to study a range of tissues including cartilage10, bone11 and bladder12. The aim of this work was to develop a cyclic pressure system that could be used to elucidate the biological response of aortic valve leaflets to increased pressure loads. 
The system consisted of an acrylic chamber in which to place samples and produce cyclic pressure, viton diaphragm solenoid valves to control the timing of the pressure cycle, and a computer to control electrical devices. The pressure was monitored using a pressure transducer, and the signal was conditioned using a load cell conditioner. A LabVIEW program regulated the pressure using an analog device to pump compressed air into the system at the appropriate rate. The system mimicked the dynamic transvalvular pressure levels associated with the aortic valve; a saw tooth wave produced a gradual increase in pressure, typical of the transvalvular pressure gradient that is present across the valve during diastole, followed by a sharp pressure drop depicting valve opening in systole. The LabVIEW program allowed users to control the magnitude and frequency of cyclic pressure. The system was able to subject tissue samples to physiological and pathological pressure conditions. This device can be used to increase our understanding of how heart valves respond to changes in the local mechanical environment.

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

A cyclic pressure bioreactor capable of subjecting heart valve tissue to physiological and pathological pressure conditions has been designed. A LabVIEW program allows users to control pressure magnitude, amplitude and frequency. This device can be used to study the mechanobiology of heart valve tissue or isolated cells.

Projeto de um biorreator de pressão cíclica para o Ex Vivo Estudo de válvulas cardíacas Aórtica

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic ...

Electric Field-controlled Directed Migration of Neural Progenitor Cells in 2D and 3D Environments

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the central nervous system1,2. These endogenous EFs are generated by cellular regulation of ionic transport combined with the electrical resistance of cells and tissues. It has been reported that applied EF treatment can promote functional repair of spinal cord injuries in animals and humans3,4. In particular, EF-directed cell migration has been demonstrated in a wide variety of cell types5,6, including neural progenitor cells (NPCs)7,8. Application of direct current (DC) EFs is not a commonly available technique in most laboratories. We have described detailed protocols for the application of DC EFs to cell and tissue cultures previously5,11. Here we present a video demonstration of standard methods based on a calculated field strength to set up 2D and 3D environments for NPCs, and to investigate cellular responses to EF stimulation in both single cell growth conditions in 2D, and the organotypic spinal cord slice in 3D. The spinal cordslice is an ideal recipient tissue for studying NPC ex vivo behaviours, post-transplantation, because the cytoarchitectonic tissue organization is well preserved within these cultures9,10. Additionally, this ex vivo model also allows procedures that are not technically feasible to track cells in vivo using time-lapse recording at the single cell level. It is critically essential to evaluate cell behaviours in not only a 2D environment, but also in a 3D organotypic condition which mimicks the in vivo environment. This system will allow high-resolution imaging using cover glass-based dishes in tissue or organ culture with 3D tracking of single cell migration in vitro and ex vivo and can be an intermediate step before moving onto in vivo paradigms.

This protocol demonstrates methods used to establish 2D and 3D environments in custom-designed electrotactic chambers, which can track cells in vivo/ex vivo using time-lapse recording at the single cell level, in order to investigate galvanotaxis/electrotaxis and other cellular responses to direct current (DC) electric fields (EFs).

Campo elétrico controlado de migração dirigida de células progenitoras neurais em ambientes 2D e 3D

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the ...

Cell Co-culture Patterning Using Aqueous Two-phase Systems

Cell patterning technologies that are fast, easy to use and affordable will be required for the future development of high throughput cell assays, platforms for studying cell-cell interactions and tissue engineered systems. This detailed protocol describes a method for generating co-cultures of cells using biocompatible solutions of dextran (DEX) and polyethylene glycol (PEG) that phase-separate when combined above threshold concentrations. Cells can be patterned in a variety of configurations using this method. Cell exclusion patterning can be performed by printing droplets of DEX on a substrate and covering them with a solution of PEG containing cells. The interfacial tension formed between the two polymer solutions causes cells to fall around the outside of the DEX droplet and form a circular clearing that can be used for migration assays. Cell islands can be patterned by dispensing a cell-rich DEX phase into a PEG solution or by covering the DEX droplet with a solution of PEG. Co-cultures can be formed directly by combining cell exclusion with DEX island patterning. These methods are compatible with a variety of liquid handling approaches, including manual micropipetting, and can be used with virtually any adherent cell type.

Aqueous two-phase systems were used to simultaneously pattern multiple populations of cells. This fast and easy method for cell patterning takes advantage of the phase separation of aqueous solutions of dextran and polyethylene glycol and the interfacial tension that exists between the two polymer solutions.

Padronização de células co-cultura Usando duas fases aquosas Sistemas

Cell patterning  technologies that are fast, easy to use and affordable will be required for the  future development of high throughput cell assays, ...

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to intrinsic parameters within the process allow a high degree of control over scaffold characteristics including fiber diameter, alignment and porosity. By developing scaffolds with similar dimensions and topographies to organ- or tissue-specific extracellular matrices (ECM), micro-environments representative to those that cells are exposed to in situ can be created. 
The airway bronchiole wall, comprised of three main micro-environments, was selected as a model tissue. Using decellularized airway ECM as a guide, we electrospun the non-degradable polymer, polyethylene terephthalate (PET), by three different protocols to produce three individual electrospun scaffolds optimized for epithelial, fibroblast or smooth muscle cell-culture. Using a commercially available bioreactor system, we stably co-cultured the three cell-types to provide an in vitro model of the airway wall over an extended time period.
This model highlights the potential for such methods being employed in in vitro diagnostic studies investigating important inter-cellular cross-talk mechanisms or assessing novel pharmaceutical targets, by providing a relevant platform to allow the culture of fully differentiated adult cells within 3D, tissue-specific environments.

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Advancements in biomaterial technologies enable the development of three-dimensional multi-cell-type constructs. We have developed electrospinning protocols to produce three individual scaffolds to culture the main structural cells of the airway to provide a 3D in vitro model of the airway bronchiole wall.

Adaptação do Processo Electrospinning para fornecer três ambientes únicos para um Tri-camadas<em&gt; In Vitro</em&gt; Modelo da parede das vias aéreas

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to ...

Photopatterning Proteins and Cells in Aqueous Environment Using TiO2 Photocatalysis

Organic contaminants adsorbed on the surface of titanium dioxide (TiO2) can be decomposed by photocatalysis under ultraviolet (UV) light. Here we describe a novel protocol employing the TiO2 photocatalysis to locally alter cell affinity of the substrate surface. For this experiment, a thin TiO2 film was sputter-coated on a glass coverslip, and the TiO2 surface was subsequently modified with an organosilane monolayer derived from octadecyltrichlorosilane (OTS), which inhibits cell adhesion. The sample was immersed in a cell culture medium, and focused UV light was irradiated to an octagonal region. When a neuronal cell line PC12 cells were plated on the sample, cells adhered only on the UV-irradiated area. We further show that this surface modification can also be performed in situ, i.e., even when cells are growing on the substrate. Proper modification of the surface required an extracellular matrix protein collagen to be present in the medium at the time of UV irradiation. The technique presented here can potentially be employed in patterning multiple cell types for constructing coculture systems or to arbitrarily manipulate cells under culture.

Photopatterning Proteins and Cells in Aqueous Environment Using TiO2 Photocatalysis

We describe a protocol for modifying cell affinity of a scaffold surface in aqueous environment. The method takes advantage of titanium dioxide photocatalysis to decompose organic film in the photo-irradiated region. We show that it can be used to create microdomains of scaffolding proteins, both ex situ and in situ.

Photopatterning proteínas e células em Aqueous Ambiente Usando TiO<sub&gt; 2</sub&gt; Photocatalysis

Organic contaminants adsorbed on the surface of titanium dioxide (TiO2) can be decomposed by photocatalysis under ultraviolet (UV) light. Here we describe ...

Aqueous Droplets Used as Enzymatic Microreactors and Their Electromagnetic Actuation

For the successful implementation of microfluidic reaction systems, such as PCR and electrophoresis, the movement of small liquid volumes is essential. In conventional lab-on-a-chip-platforms, solvents and samples are passed through defined microfluidic channels with complex flow control installations. The droplet actuation platform presented here is a promising alternative. With it, it is possible to move a liquid drop (microreactor) on a planar surface of a reaction platform (lab-in-a-drop). The actuation of microreactors on the hydrophobic surface of the platform is based on the use of magnetic forces acting on the outer shell of the liquid drops which is made of a thin layer of superhydrophobic magnetite particles. The hydrophobic surface of the platform is needed to avoid any contact between the liquid core and the surface to allow a smooth movement of the microreactor. On the platform, one or more microreactors with volumes of 10 &#181;L can be positioned and moved simultaneously. The platform itself consists of a 3 x 3 matrix of electrical double coils which accommodate either neodymium or iron cores. The magnetic field gradients are automatically controlled. By variation of the magnetic field gradients, the microreactors' magnetic hydrophobic shell can be manipulated automatically to move the microreactor or open the shell reversibly. Reactions of substrates and corresponding enzymes can be initiated by merging the microreactors or bringing them into contact with surface immobilized catalysts.

Lab-in-a-drop reaction systems allow the versatile implementation of complex reactions in a microfluidic scale. An automated actuation platform consisting of a 3 x 3 matrix of electromagnetic coils was developed and successfully used to merge two 10 &#181;L microreactors and thereby initiate an enzymatic reaction in the resulting liquid marbles.

Aquosas gotículas usadas como Microreactors enzimática e sua atuação eletromagnética

For the successful implementation of microfluidic reaction systems, such as PCR and electrophoresis, the movement of small liquid volumes is essential. In ...

Characterizing Cell Migration Within Three-dimensional In Vitro Wound Environments

Currently, most in vitro models of wound healing, such as well-established scratch assays, involve studying cell migration and wound closure on two-dimensional surfaces. However, the physiological environment in which in vivo wound healing takes place is three-dimensional rather than two-dimensional. It is becoming increasingly clear that cell behavior differs greatly in two-dimensional vs. three-dimensional environments; therefore, there is a need for more physiologically relevant in vitro models for studying cell migration behaviors in wound closure. The method described herein allows for the study of cell migration in a three-dimensional model that better reflects physiological conditions than previously established two-dimensional scratch assays. The purpose of this model is to evaluate cell outgrowth via the examination of cell migration away from a spheroid body embedded within a fibrin matrix in the presence of pro- or anti-migratory factors. Using this method, cell outgrowth from the spheroid body in a three-dimensional matrix can be observed and is easily quantifiable over time via brightfield microscopy and analysis of spheroid body area. The effect of pro-migratory and/or inhibitory factors on cell migration can also be evaluated in this system. This method provides researchers with a simple method of analyzing cell migration in three-dimensional wound associated matrices in vitro, thus increasing the relevance of in vitro cell studies prior to the use of in vivo animal models.

Characterizing Cell Migration Within Three-dimensional In Vitro Wound Environments

The goal of this protocol is to evaluate the effect of pro- and anti-migratory factors on cell migration within a three-dimensional fibrin matrix.

Caracterizando a migração celular no tridimensional em Vitro ferida ambientes

Currently, most in vitro models of wound healing, such as well-established scratch assays, involve studying cell migration and wound closure on ...

Protocol for MicroRNA Transfer into Adult Bone Marrow-derived Hematopoietic Stem Cells to Enable Cell Engineering Combined with Magnetic Targeting

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates after injection into injured tissues as well as the observed massive cell death rates lead to very restricted therapeutic effects. To overcome these limitations, we sought to establish a non-viral based protocol for suitable cell engineering prior to their administration. The modification of human CD133+ expressing SCs using microRNA (miR) loaded magnetic polyplexes was addressed with respect to uptake efficiency and safety as well as the targeting potential of the cells. Relying on our protocol, we can achieve high miR uptake rates of 80&#8211;90% while the CD133+ stem cell properties remain unaffected. Moreover, these modified cells offer the option of magnetic targeting. We describe here a safe and highly efficient procedure for the modification of CD133+ SCs. We expect this approach to provide a standard technology for optimization of therapeutic stem cell effects and for monitoring of the administered cell product via magnetic resonance imaging (MRI).

This protocol illustrates a safe and efficient procedure to modify CD133+ hematopoietic stem cells. The presented non-viral, magnetic polyplex-based approach may provide a basis for the optimization of therapeutic stem cell effects as well as for monitoring the administered cell product via magnetic resonance imaging.

Protocolo para transferência de MicroRNA na medula óssea-derivado hematopoiéticas células-tronco adultas para habilitar celular engenharia combinada com alvo magnético

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates ...

Material Formation of Recombinant Spider Silks through Aqueous Solvation using Heat and Pressure

Many spiders produce seven types of silks. Six of the silks are fiber in form when produced by the spiders. These fibers are not water soluble. In order to reproduce the remarkable mechanical properties of spider silks, they must be produced in heterologous hosts as spiders are both territorial and cannibalistic. The synthetic analogs of spider silk also tend to be insoluble in aqueous solutions. Thus, a large percentage of research in recombinant spider silks rely upon organic solvents that are detrimental to large scale production of materials. Our group&#8217;s method forces the solvation of these recombinant spider silks into water. Remarkably, when these proteins are prepared using this method of heat and pressure, a wide range of material forms can be prepared from the same solution of recombinant spider silk proteins (rSSp) including: films, fibers, sponge, hydrogel, lyogel, and adhesives. This article demonstrates the production of the solvated rSSp and material forms in a manner that is more easily understood than from written materials and methods alone.

Here, we present a protocol to produce water soluble recombinant spider silk protein solutions and the material forms that can be formed from those solutions.

Formação de Material de Seda de Aranha Recombinante por Solvatação Aquosa Usando Calor e Pressão

Many spiders produce seven types of silks. Six of the silks are fiber in form when produced by the spiders. These fibers are not water soluble. In order ...