Moral desteği için güzel jeller ve Tobias Krause Ulla Kobalz için sürekli yardım için Janett Birkenfeld alanında coşkulu örnek toplama, Silke Kipper, Sarah Kiefer, Michael Weiss, Conny Bartsch ve Silke Voigt-Heucke çok teşekkürler.

Tüm işlemler hayvan koruma (TierSchG) için Alman yasalarına uygun olarak yapılmıştır. Reaktifler ve Sarf 1. Hazırlanması <ol><li> Moleküler sınıf su içinde% 5 (a / a) Chelex-100 çözeltisi hazırlayın. Standart 1.5 ml&#39;lik tepkime tüpleri içinde 200 ul alikotları hazırlayın. Chelex reçine süspansiyondan hızla çökelir olarak, alikotları hazırlanması sırasında sürekli olarak yeniden homojenize süspansiyon için gereklidir. Bu, bir toplu 50 ml ya da daha fazla hazırlamak ve manyetik bir karıştırıcı kullanılarak homojenize süspansiyon tutmak için tavsiye bulunuyor. Chelex Çözelti, ortam şartlarında yıl boyunca saklanabilir. </li><li> Test edilecek olan kuşun gaga genişliğinden daha küçük bir genişliğe sahip Whatman kağıt parçaları kesin. Kağıdın uzunluğu örnek almak için yönteme bağlıdır: <ol><li> Forseps kullanılarak, parça kuşun gaga sokulmaksızın forseps olmadan örnek toplama işlemini sağlamak için yeterince uzun olmalıdır. Askaba bir tahmin, 0.5 cm&#39;lik bir gaga uzunluğu boyunca 1 cm uzunluğundaki bir kağıt parçası ince olmalıdır. </li><li> Forseps kullanarak değil ise, parça daha uzun olması gerekir, ancak parçanın sertliği yine de epitel hücrelerinin örnekleme izin vermelidir. </li></ol></li><li> Analiz edilecek her bir örnek için PCR ön-karışımın bir kısım hazırlayın. 25 ul bir toplam hacim içinde bir PCR için, karışım 0.18 mM dNTP, 2 mM MgCl2, 70 mM Tris-HCI, 17.25 mM amonyum sülfat,% 0.1 Tween-20, 0.32 uM P2 primer (TCTGCATCGCTAAATCCTTT), 0.32 uM P8 içerir primer (CTCCCAAGGATGAGRAAYTG) 16 ve 2 birim Taq polimerazi. Ev yapımı Taq polimeraz 17 kullanılabilir. DNA-çözeltisi azami miktarının ilave edilmesini sağlamak için, bir ön-karışım, 6 ul birkaç hafta içinde hazırlanır ve -20 ° C&#39;de muhafaza edilebilir. </li></ol> 2.. Örnek Toplama Eldivenleri giyerek, PCR primerleri, insan DNA tavlanacak değil gibi kuş cinsiyet tespiti için gerekli değildir. IçinDiğer genotiplendirme amaçlar bu tavsiye olabilir. <ol><li> Ilgi kuş yakalama ve yavaşça &#39;ringer kavrama&#39; 18 ile bir yandan örneğin tutun. Kuş sıkmak için değil emin olun. </li><li> Forseps ile Whatman bir parça kağıt tutun ve yanaklar, dil ve kohananın iç çapında bunu birkaç kez kuvvetlice vurun. Genellikle numuneleri en az 30 saniye içinde elde edilir. <ol><li> Yetişkin hayvanlar: türe bağlı olarak bu gagasını açmak için kuş almak zor olabilir. Genellikle gaga yan dokunmadan ve nazik bir basınç uygulayarak çalışır. </li><li> Yavrusu: yavru veya nestlings gelen Örnekleme kendi yalvarıyor davranışları gaga iç kolay erişim sağladığı gibi, bu tekniği kullanarak özellikle kolaydır. Onların nestbox açıldığında onlar kolayca örneğin dilenmek gibi Hatta hiç ellemeden olmadan numunesi elde etmek mümkün olabilir. </li></ol></li><li> Hemen hazırlanmış bir reaksiyon tüpü contai kağıdı saklayın% 5 lama 200 ul (a / a) Chelex-100 çözeltisi. </li></ol> Ayrıca / düşünüyorsanız 6. bölümde anlatıldığı gibi şimdi bunu yapmak, civciv işaretlemek gerekir. DNA Ekstraksiyon önce Örnekleri 3. Depolama <ol><li> -20 ° C&#39;de laboratuvarda çalışan, mağaza örnekleri Bu ortam sıcaklıklarında mağaza örnekleri mümkün veya (alanında) örneğin zor değilse. </li><li> Numuneler, oda sıcaklığı ila 20 ° C arasında değişen bir sıcaklıkta en fazla 3 yıl boyunca saklanabilir </li></ol> 4. DNA Ekstraksiyon <ol><li> Numune donmuş ise, oda sıcaklığında çözdürün. </li><li> Kağıt parçası Chelex-100 çözeltisine batırılmış tüp alt olduğundan emin olun. </li><li> 56 ° C&#39;de 15 dakika boyunca inkübe edin </li><li> Vortex kısaca ve tüpün içeriğini aşağı doğru döndürün. </li><li> 100 ° C&#39;de 8 dakika boyunca inkübe edin </li><li> 3 dakika boyunca 15,000 xg&#39;de örnekleri Spin. </li><li> S kullanındaha sonra genotipleme için upernatant. </li></ol> 5.. Moleküler Seks Tayini <ol><li> Numune başına 6 ul premiks artı negatif (zorunlu) ve pozitif kontrol (opsiyonel) için iki ek tüpleri ile bir PCR tüpü hazırlayın. Rutin cinsiyet tayini için bir pozitif kontrol olarak son başarılı cinsiyet tayini bir örnek sayılabilir. </li><li> PCR ön-karışıma DNA ekstraksiyon gelen süpernatan 19 ul ekle. Chelex boncuk taşınmasını önlemek için bir çözüm yüzeyinden pipetle emin olun. Chelex bir katyon değiştirici olduğunu ve bu yüzden ciddi bir şekilde tüm enzimatik reaksiyonları inhibe eder, bu durum çok önemlidir. </li><li> 3 dakika, 72 ° C de 45 saniye uzama adımı ve ardından 55 ° C de 30 saniye tavlama adımı, ardından 30 saniye erime aşama 94 ° C, 45 döngü her biri için 94 ° C &#39;de inkübasyon: Aşağıdaki PCR programı çalıştır C. Bir son aşama takip kapalı olarak, reaksiyonlar, 72 ° C&#39;de 5 dakika boyunca kuluçkalanır </li><li> % 2 standart TBE veya TAE Agaro hazırlayın<html> PCR ürünleri ayırmak için jel se. </li><li> Uygun voltaj ayarları ile agaroz jel çalıştırın. </li><li> UV ışık altında bantları görselleştirmek ve bir resim çekin. Kadınlarda kaynaklı örneklerde iki bant iyi ayrılmış olduğundan emin olun. </li><li> Bir (erkek) ya da iki (kadın) bantların varlığı ile kadın örnekleri erkek ayırt. </li></ol> 6.. Yavrumuz İşaretleme <ol><li> Türler / çalışma için bir zamanlama uygun üzerinde yeni yumurtadan civciv için yuvalarını kontrol edin (en civcivler sonra yumurtadan gibi sabahları örneğin günlük kontroller tavsiye edilir). </li><li> Farklı karakteristik bir yerde bir yuva içinde her civciv aşağı tüyleri kesin. Zebra ispinoz içinde çıkışlar püskülleri yavru vücut (Şekil 4A) genelinde dört karakteristik ve farklı alanlarda büyür. Her civciv için bir alan (Şekil 4B) kesti. Bir yuvanın içinde dörtten fazla civciv varsa, benzersiz dört &#39;kesimi&#39; kombine edilebilir. </li></ol>zebra ispinoz için&gt; &quot;ove_content: aşağı tüyleri algılamak ve yavru boyutu zil verir zor olunca, aşılamadan on gün de bacak bantları uygulayın.

<ol>
	<li>Russell, W. M. S., Burch, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+principles+of+humane+experimental+technique.">The principles of humane experimental technique.</a> , (1959).</li><li>Robertson, B. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+kakapo,+Strigops+habroptilus+Aves,+from+feces.">Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces.</a> Mol. Ecol. 8, 1349-1350 (1999).</li><li>Yannic, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Description+of+microsatellite+markers+and+genotyping+performances+using+feathers+and+buccal+swabs+for+the+Ivory+gull+(Pagophila+eburnea).">Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea).</a> Mol. Ecol. Resour. 11, 877-889 (2011).</li><li>Bello, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+feathers.">Isolation of genomic DNA from feathers.</a> J. Vet. Diagn. Invest. 13, 162-164 (2001).</li><li>Handel, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+buccal+swabs+for+sampling+DNA+from+nestling+and+adult+birds.">Use of buccal swabs for sampling DNA from nestling and adult birds.</a> Wildl. Soc. Bull. 34, 1094-1100 (2006).</li><li>Brubaker, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+noninvasive,+direct+real-time+PCR+method+for+sex+determination+in+multiple+avian+species.">A noninvasive, direct real-time PCR method for sex determination in multiple avian species.</a> Mol. Ecol. Resour. 11, 415-417 (2011).</li><li>Arima, H., Ohnishi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Usefulness+of+avian+buccal+cells+for+molecular+sexing.">Usefulness of avian buccal cells for molecular sexing.</a> Ornithological Science. 5, 139-143 (2006).</li><li>Seki, S. -. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+Ryukyu+Robins+Erithacus+komadori+using+buccal+cells+as+a+non-invasive+source+of+DNA.">Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA.</a> Ornithological Science. 2, 135-137 (2003).</li><li>Wellbrock, A. H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Buccal+swabs+as+a+reliable+source+of+DNA+for+sexing+young+and+adult+Common+Swifts+(Apus+apus).">Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus).</a> J. Ornithol. 153, 991-994 (2012).</li><li>Marion, W. R., Shamis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Annotated-Bibliography+of+Bird+Marking+Techniques.">Annotated-Bibliography of Bird Marking Techniques.</a> Bird Banding. 48, 42-61 (1977).</li><li>Scharff, C., Adam, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurogenetics+of+birdsong.">Neurogenetics of birdsong.</a> Curr. Opin. Neurobiol. , (2012).</li><li>Griffith, S. C., Buchanan, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Zebra+Finch:+the+ultimate+Australian+supermodel.">The Zebra Finch: the ultimate Australian supermodel.</a> Emu. 110, 5-12 (2010).</li><li>Fee, M. S., Scharff, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+songbird+as+a+model+for+the+generation+and+learning+of+complex+sequential+behaviors.">The songbird as a model for the generation and learning of complex sequential behaviors.</a> Ilar J. 51, 362-377 (2010).</li><li>Honarmand, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stressful+dieting:+nutritional+conditions+but+not+compensatory+growth+elevate+corticosterone+levels+in+zebra+finch+nestlings+and+fledglings.">Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings.</a> PLoS On. 5, (1371).</li><li>Krause, E. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebra+finch+nestlings+beg+more+under+better+nutritional+conditions.">Zebra finch nestlings beg more under better nutritional conditions.</a> Behaviour. 148, 1239-1255 (2011).</li><li>Griffiths, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+DNA+test+to+sex+most+birds.">A DNA test to sex most birds.</a> Mol. Ecol. 7, 1071-1075 (1998).</li><li>Pluthero, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+purification+of+high-activity+Taq+DNA+polymerase.">Rapid purification of high-activity Taq DNA polymerase.</a> Nucleic Acids Res. 21, 4850-4851 (1993).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Joint+Working+Group+on+Refinement.+Laboratory+birds:+refinements+in+husbandry+and+procedures.+Fifth+report+of+BVAAWF/FRAME/RSPCA/UFAW+Joint+Working+Group+on+Refinement.">Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement.</a> Lab Anim. 35, 1-163 (2001).</li></ol>

Yazarlar ifşa hiçbir şey yok.

Chelex kullanarak bukkal sürüntü sexing son derece yüksek bir başarı oranı gösterdi. Bacak bantlama mümkün oldu kadar kesme yavru aşağı tüyleri nestlings arasındaki farklılaşmayı sağladı. Bukkal sürüntü Chelex-DNA ekstraksiyon başarıyla moleküler cinsiyet tayini yapmak için yeterli DNA vermiştir. Cinsiyet tayini dimorfik tüyleri tarafından doğrulandığı gibi% 100 doğru idi. Burada bildirilen başarı oranı iki önceki çalışmalarda 7,9 tarafın...

Bireysel tanıma, cinsiyet tayini ve genotiplendirme deneysel çalışmaların çeşitli temel şartlardır. DNA taşıyan malzemenin elde edilmesi ve (hatta erken yaşta) açıkça konular işaretleme fizyoloji, davranış ve yaşam üzerinde çok az etkiye sahip olmalıdır. Mümkün olduğunda, invazif prosedürler RRR prensibine 1 &#39;e göre kaçınılmalıdır. Non-invazif yöntemler sadece hayvan için faydalı değil, aynı zamanda daha az hayvan tedavi etkilenen olarak elde edilen verileri geliştirmek olabilir. Kuşlarda, DNA cinsiyet tayini pisliği 2, tüy 3,4 veya bukkal bezlerden 3,5,9 non-invazif elde edilebilen malzemeler bir dizi üzerinde gerçekleştirilebilir. Onlar yapmak kolay, çünkü ne olursa olsun kişinin durumu ve yaşı yanak bezlerden kuş cinsiyet tayini için tercih edilen yöntem nadiren başarısız ve işleme kısa, vardır. Bukkal sürüntü Şimdiye kadar, DNAya da ticari olarak temin edilebilir kitler 3,6 veya zaman, standart DNA ekstre etme protokolleri 3,6-8 alıcı ile ekstre edilmiştir. Kitler sadece oldukça pahalı, ancak bunların protokolleri alan çalışması için zorluklar getirebilir. Bazı usul bilgilerini, örneğin kurutma ve numune inkübasyonu, alanında pratik değildir. Özellikle deneysel protokolleri gibi erken bir kaç dakika sonrası kuluçka gibi seks bağımlı tedavi gerektiren bir ortamda, sonuçlar elde etmek için hızlı, non-invaziv, güvenilir ve kolay bir yöntem için teşvik var. Kuş takson karşısında işaretleme kişiler için önemli bir araç 10 geliştirilmiştir. Mevcut tekniklerin geniş bir dizi araştırma hedefleri, türlerin ve bütçelerin çeşitli hesapları. Ancak, küçük yavrumuz işaretleme ek zorluklar araştırmacıların karşı karşıya gelmiştir. Bazı türlerde (örneğin ötücü) Civcivler bacak bantları uygulamak için çok küçük ve alternatif yöntemler, gerektirenebeveyn-çocuk davranışını değiştirmez. Bilinci ve hayvan refahı ve saha ve laboratuvar çalışmalarında tekniklerini geliştirmeye ilgi büyüyor gibi, non-invaziv tekniklerin kullanımı önemle teşvik ve tercih edilmektedir. Bu protokol tek bacak bantları uygulamadan önce çok genç yavrumuz işaretlemek için bir non-invaziv, hızlı kolayca tanınabilir ve kalıcı yöntem sağlar mümkündür. Bu işaretleme yöntemi en önemli kuş laboratuar model türlerinden biri, Zebra Finch (canlıdır Taeniopygia guttata) 11-13 tanıtıldı. Bu protokol tek işaretleme teknikleri 10 için daha önce yayınlanan hedefleri her uygundur ve daha önce başarılı bir şekilde 14,15 uygulanmıştır.

<table border="0" cellpadding="0" cellspacing="0" width="702">
	<tbody>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">Whatman 3MM Chromatography paper</td>
			<td style="width:163px;">e.g. Fisher Scientific</td>
			<td style="width:269px;">No.:3030-153</td>
			<td style="width:80px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:191px;">Chelex 100 Resin</td>
			<td style="width:163px;">Biorad</td>
			<td style="width:269px;">#143-2832</td>
			<td></td>
		</tr>
		<tr height="50">
			<td height="50" style="height:50px;width:191px;">Taq polymerase</td>
			<td style="width:163px;">addgene</td>
			<td style="width:269px;">http://www.addgene.org/25712/</td>
			<td></td>
		</tr>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">leg band (Flexi number rings for birds, diameter 2,5 mm)</td>
			<td style="width:163px;">Horst Stengel &#38; Sohn</td>
			<td style="width:269px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

who is who? non-invasive methods to individually sex and mark altricial chicks

Birçok deneyler erken yavrusunun seks belirlenmesi yanı sıra erken bireysel tanınması için yenidoğanların işaretleme gerektirir. Uygulanabilir olduğunda hayvan refahı kurallarına göre, non-invaziv teknikler tercih edilmelidir. Bizim grupta, biz laboratuvarda ve alanda şarkı kuşların farklı türler üzerinde çalışmak ve başarılı seks için non-invaziv yöntemler uygulanır ve ayrı ayrı civciv işaretleyin. Bu kağıt kapsamlı bir non-invaziv alet kutusu sunar. Kuş cinsiyet tayini önce ikincil cinsel özelliklerinin ifadesi için PCR için DNA-içeren malzemenin toplanmasını gerektirir. Biz bukkal sürüntü DNA ayıklamak herhangi bir yaşta (sonrası kuluçka) cinsiyeti kuşlar için hızlı ve kolay bir yöntem kurmuştur. Sonuçlar, 3 saat içinde elde edilebilir. Bireysel işaretleme civcivin aşağı tüyleri kuluçka düzen içinde hızlı tanımlanmasına izin veren özel desenler kesilmiş için. Yöntemler Bu set, standart donanımlı bir laboratuvarda kolaylıkla uygulanabilir ve çalışıyorsun için uygundurözel bir donanım olarak alanında g numune alma ve depolama için gereklidir. Civcivlerin taşınması minimize ve işaretleme ve sexing teknikleri böylece hayvan refahı kurallar RRR-prensibini destekleyen non-invaziv olmasıdır.

<html> Bukkal çubuklar küçük kuş çeşitli seks belirlenmesi için DNA elde etmek için kullanılabilir , Kanaryalar (Serinus Canaria), Bengalese Finches (Lonchura striatalar), Bülbüller (Luscinia megarhynchos), Büyük Göğüsler (Parus major) ve Karatavuk (Turdus - Numuneler Zebra Finches (5 yıl canlıdır Taeniopygia guttata, 99 bireyler, yaş 0 gün) toplandı merula) (diğer tüm türler için: örneklem büyüklüğü ...

Watch this Scientific Journal Video about Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks at JoVE.com

Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

Bu protokol son derece hızlı, kolay, non-invaziv, güvenilir ve düşük maliyetli sağlayan yöntemlerin uygun bir dizi, kuşların moleküler cinsiyet tayini ve non-invaziv, hızlı, güvenli ve kolayca tanınabilir kısa yumurtadan çıktıktan sonra işaretleme sağlar. Civcivlerin sadece sınırlı bir işleme gerek yoktur. Yöntemlerden Bu kullanışlı araç RRR-kurallarına tamamen uygundur.

Kim kimdir? Non-invaziv yöntemler Bireysel Seks ve Mark altricial Civcivler

Many experiments require early determination of offspring's sex as well as early marking of newborns for individual recognition. According to animal ...

who-is-who-non-invasive-methods-to-individually-sex-mark-altricial

Research

JoVE Journal

Biology

18.2K Görüntüleme.  Freie Universität Berlin.  Bu protokol son derece hızlı, kolay, non-invaziv, güvenilir ve düşük maliyetli sağlayan yöntemlerin uygun bir dizi, kuşların moleküler cinsiyet tayini ve non-invaziv, hızlı, güvenli ve kolayca tanınabilir kısa yumurtadan çıktıktan sonra işaretleme sağlar. Civcivlerin sadece sınırlı bir işleme gerek yoktur. Yöntemlerden Bu kullanışlı araç RRR-kurallarına tamamen uygundur. 

Video: Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

Labeling hESCs and hMSCs with Iron Oxide Nanoparticles for Non-Invasive in vivo Tracking with MR Imaging

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative medicine. A non-invasive method to monitor the transplanted stem cells repeatedly in vivo would greatly enhance our ability to understand the mechanisms that control stem cell death and identify trophic factors and signaling pathways that improve stem cell engraftment. MR imaging has been proven to be an effective tool for the in vivo depiction of stem cells with near microscopic anatomical resolution. In order to detect stem cells with MR, the cells have to be labeled with cell specific MR contrast agents. For this purpose, iron oxide nanoparticles, such as superparamagnetic iron oxide particles (SPIO), are applied, because of their high sensitivity for cell detection and their excellent biocompatibility. SPIO particles are composed of an iron oxide core and a dextran, carboxydextran or starch coat, and function by creating local field inhomogeneities, that cause a decreased signal on T2-weighted MR images. This presentation will demonstrate techniques for labeling of stem cells with clinically applicable MR contrast agents for subsequent non-invasive in vivo tracking of the labeled cells with MR imaging.

For the evaluation of new stem cell therapies it is important to non-invasively track the injected cells in vivo. This video will show you how to label human mesenchymal and embryonic stem cells with iron oxide based contrast agents in vivo for subsequent MR imaging in vivo.

Demir Oksit hESC ve hMSCs Etiketleme MR Görüntüleme in vivo Takip Non-Invasive Nanopartiküller

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative ...

Biyoloji

Labeling Stem Cells with Fluorescent Dyes for non-invasive Detection with Optical Imaging

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo labeling of stem cells with a fluorescent dye, subsequent intravenous injection of the labeled cells and visualization of their accumulation in specific target organs or pathologies. The presented technique demonstrates how we label human mesenchymal stem cells (hMSC) by simple incubation with the lipophilic fluorescent dye DiD (C67H103CIN2O3S) and how we label human embryonic stem cells (hESC) with the FDA approved fluorescent dye Indocyanine Green (ICG). The uptake mechanism is via adherence and diffusion of the lypophilic dye across the phospholipid cell membrane bilayer. The labeling efficiency is usually improved if the cells are incubated with the dye in serum-free media as opposed to incubation in serum-containing media. Furthermore, the addition of the transfection agent Protamine Sulfate significantly improves contrast agent uptake.

This video shows techniques for labeling of human embryonic stem cells and mesenchymal stem cells with fluorescent dyes. This technique can be used for an in vivo tracking of transplanted stem cells with optical imaging and for histopathological correlations with fluorescence microscopy.

Optik Görüntüleme ile non-invaziv Algılama için Floresan Boyalar Kök Hücreler Etiketleme

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo ...

Non-invasive 3D-Visualization with Sub-micron Resolution Using Synchrotron-X-ray-tomography

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard cuticle which makes it difficult to use protocols of classical histology. In addition, histological sectioning destroys the sample and can therefore not be used for unique material. Hence, a non-destructive method is desirable which allows to view inside small samples without the need of sectioning.
We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) in Grenoble (France) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows us to reconstruct the internal organization in its natural state without the artefacts produced by histological sectioning. These date can be used for quantitative morphology, landmarks, or for the visualization of animated movies to understand the structure of hidden body parts and to follow complete organ systems or tissues through the samples.

We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows the reconstruction of internal structures in their natural state without the artefacts produced by histological sectioning.

Sinkrotron-X-ray tomografi Sub-mikron Çözünürlük ile Non-invaziv 3D Görselleştirme

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard ...

A Magnetic Tether System to Investigate Visual and Olfactory Mediated Flight Control in Drosophila

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. As such, visual stabilization of upwind tracking directly aids in odor tracking. But do olfactory signals directly influence visual tracking behavior independently from wind cues? Also, the recent deluge of research on the neurophysiology and neurobehavioral genetics of olfaction in Drosophila has motivated ever more technically sophisticated and quantitative behavioral assays. Here, we modified a magnetic tether system originally devised for vision experiments by equipping the arena with narrow laminar flow odor plumes. A fly is glued to a small steel pin and suspended in a magnetic field that enables it to yaw freely. Small diameter food odor plumes are directed downward over the fly s head, eliciting stable tracking by a hungry fly. Here we focus on the critical mechanics of tethering, aligning the magnets, devising the odor plume, and confirming stable odor tracking.

Here we describe how to tether a fly in an olfactory magnetic-tether (OMT) apparatus. We describe how to align the rare-earth magnets and odor ports, and how to set mass flow rates for both the stimulus delivery and vacuum suction to achieve optimal odor tracking.

Drosophila Görsel ve Koku aracılığı ile Uçuş Kontrol Araştırma Manyetik Tether Sistemi

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. ...

Cell Block Preparation from Cytology Specimen with Predominance of Individually Scattered Cells

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually scattered cells and small cell groups. This technique uses HistoGel (Thermo Scientific) with conventional laboratory equipment.
The use of cell block sections is a valuable ancillary tool for evaluation of non-gynecologic cytology. They enable the cytopathologist to study additional morphologic specimen detail including the architecture of the lesion. Most importantly, they allow for the evaluation of ancillary studies such as immunocytochemistry, in-situ hybridization tests (FISH/CISH) and in-situ polymerase chain reaction (PCR). Traditional cell block preparation techniques have mostly been applied to non-gynecologic cytology specimens, typically for body fluid effusions and fine needle aspiration biopsies.
Liquid based cervicovaginal specimens are relatively less cellular than their non-gynecologic counterparts with many individual scattered cells. Because of this, adequate cellularity within the cell block sections is difficult to achieve. In addition, the histotechnologist sectioning the block cannot visualize the level at which the cells are at the highest concentration. Therefore, it is difficult to monitor the appropriate level at which sections can be selected to be transferred to the glass slides for testing. As a result, the area of the cell block with the cells of interest may be missed, either by cutting past or not cutting deep enough. Current protocol for Shidham's method addresses these issues. Although this protocol is standardized and reported for gynecologic liquid based cytology specimens, it can also be applied to non-gynecologic specimens such as effusion fluids, FNA, brushings, cyst contents etc for improved quality of diagnostic material in cell block sections.

Shidham's method for preparation of cell blocks with AV-marker from cytology specimens containing individually scattered cells and small cell groups.

Bireysel Az hücreler baskın Sitoloji Numune Cell Block Hazırlama

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually ...

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing and adult tissue. An advance in this concept is Genetic Inducible Fate Mapping (GIFM), linking gene expression, cell fate, and cell behaviors in vivo, to create fate maps based on genetic lineage.
GIFM exploits X-CreER lines where X is a gene or set of gene regulatory elements that confers spatial expression of a modified bacteriophage protein, Cre recombinase (CreERT). CreERT contains a modified estrogen receptor ligand binding domain which renders CreERT sequestered in the cytoplasm in the absence of the drug tamoxifen. The binding of tamoxifen releases CreERT, which translocates to the nucleus and mediates recombination between DNA sequences flanked by loxP sites. In GIFM, recombination typically occurs between a loxP flanked Stop cassette preceding a reporter gene such as GFP.
Mice are bred to contain either a region- or cell type-specific CreER and a conditional reporter allele. Untreated mice will not have marking because the Stop cassette in the reporter prevents further transcription of the reporter gene. We administer tamoxifen by oral gavage to timed-pregnant females, which provides temporal control of CreERT release and subsequent translocation to the nucleus removing the Stop cassette from the reporter. Following recombination, the reporter allele is constitutively and heritably expressed. This series of events marks cells such that their genetic history is indelibly recorded. The recombined reporter thus serves as a high fidelity genetic lineage tracer that, once on, is uncoupled from the gene expression initially used to drive CreERT.
We apply GIFM in mouse to study normal development and ascertain the contribution of genetic lineages to adult cell types and tissues. We also use GIFM to follow cells on mutant genetic backgrounds to better understand complex phenotypes that mimic salient features of human genetic disorders.
This video article guides researchers through experimental methods to successfully apply GIFM. We demonstrate the method using our well characterized Wnt1-CreERT;mGFP mice by administering tamoxifen at embryonic day (E)8.5 via oral gavage followed by dissection at E12.5 and analysis by epifluorescence stereomicroscopy. We also demonstrate how to micro-dissect fate mapped domains for explant preparation or FACS analysis and dissect adult fate-mapped brains for whole mount fluorescent imaging. Collectively, these procedures allow researchers to address critical questions in developmental biology and disease models.

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Genetic Inducible Fate Mapping (GIFM) marks and tracks cells with fine spatial and temporal control in vivo and elucidates how cells from a specific genetic lineage contribute to developing and adult tissues. Demonstrated here are the techniques required to fate map E12.5 mouse embryos for epifluorescent and explant analysis.

Genetik Đndüklenebilir Kader Haritalama Pratik Bir Yaklaşım: Hücreler Mark ve Track Görsel Bir Rehberi In Vivo</em

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing ...

A Reversible, Non-invasive Method for Airway Resistance Measurements and Bronchoalveolar Lavage Fluid Sampling in Mice

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated procedures to obtain such measurements in the same animal are generally not feasible.  Here, we demonstrate protocols for obtaining from mice repeated measurements of AHR and bronchoalveolar lavage fluid samples.  Mice were challenged intranasally seven times over 14 days with a potent allergen or sham treated.  Prior to the initial challenge, and within 24 hours following each intranasal challenge, the same animals were anesthetized, orally intubated and mechanically ventilated.  AHR, assessed by comparing dose response curves of respiratory system resistance (RRS) induced by increasing intravenous doses of acetylcholine (Ach) chloride between sham and allergen-challenged animals, were determined.  Afterwards, and via the same intubation, the left lung was lavaged so that differential enumeration of airway cells could be performed.  These studies reveal that repeated measurements of AHR and BAL fluid collection are possible from the same animals and that maximal airway hyperresponsiveness and airway eosinophilia are achieved within 7-10 days of initiating allergen challenge.  This novel technique significantly reduces the number of mice required for longitudinal experimentation and is applicable to diverse rodent species, disease models and airway physiology instruments.  

Repeated measurements of rodent respiratory physiology and sampling of airway inflammatory cells are desirable, but generally not feasible. Here we describe a repeatable method for orally intubating mice that permits repeated measurements of airway hyperreactivity and sampling of airway inflammatory cells.

Havayolu Direnci Ölçümleri ve Fare Bronkoalveolar Lavaj Sıvısı Örnekleme için, geri dönüşümlü, Non-invaziv Yöntemi

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

Fekal Glukokortikoid Analizi: Tek tırnaklılarda in Non-invaziv Adrenal İzleme

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

Methods to Discover Alternative Promoter Usage and Transcriptional Regulation of Murine Bcrp1

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually untranslated &#8212; first exons. Bcrp1 (Abcg2), the murine orthologue of the ABC transporter Breast Cancer Resistance Protein (BCRP, ABCG2), has at least four alternative promoters that are designated by the corresponding four alternative first exons produced: E1U, E1A, E1B, and E1C. Herein, in-silico protocols are presented to predict alternative promoter usage for Bcrp1. Furthermore, reporter assay methods are described to produce reporter constructs for alternative promoters and to determine the functionality of putative promoters upstream of the alternative first exons that are identified.

With the murine ABC transporter Bcrp1 (Abcg2) as an example, in-silico protocols are presented to detect alternative promoter usage in genes expressed in mouse tissues, and to evaluate the functionality of the alternative promoters identified using reporter assays.

Yöntemler Fare Bcrp1 Alternatif Promoter Kullanımı ve Transkripsiyonal Yönetmeliği Discover

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually ...

Methods to Classify Cytoplasmic Foci as Mammalian Stress Granules

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to stress conditions, are implicated in various aspects of cell metabolism and survival. SGs modulate cellular signaling pathways, post-transcriptional gene expression, and stress response programs. The formation of these mRNA-containing granules is directly connected to cellular translation. SG assembly is triggered by inhibited translation initiation, and SG disassembly is promoted by translation activation or by inhibited translation elongation. This relationship is further highlighted by SG composition. Core SG components are stalled translation pre-initiation complexes, mRNA, and selected RNA-binding Proteins (RBPs). The purpose of SG assembly is to conserve cellular energy by sequestering translationally stalled housekeeping mRNAs, allowing for the enhanced translation of stress-responsive proteins. In addition to the core constituents, such as stalled translation preinitiation complexes, SGs contain a plethora of other proteins and signaling molecules. Defects in SG formation can impair cellular adaptation to stress and can thus promote cell death. SGs and similar RNA-containing granules have been linked to a number of human diseases, including neurodegenerative disorders and cancer, leading to the recent interest in classifying and defining RNA granule subtypes. This protocol describes assays to characterize and quantify mammalian SGs.

Stress Granules (SGs) are nonmembranous cytoplasmic structures that form in cells exposed to a variety of stresses. SGs contain mRNAs, RNA-binding proteins, small ribosomal subunits, translation-related factors, and various cell signaling proteins. This protocol describes a workflow that uses several experimental approaches to detect, characterize, and quantify bona fide SGs.

Sitoplazmik Odakları Memeli Stres Granülleri Olarak Sınıflandırma Yöntemleri

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to ...