The investigators thank all the volunteers in Zambia who participated in this study and all the staff at the Zambia Emory HIV Research Project in Lusaka who made this study possible. The investigators would like to thank Jon Allen, Smita Chavan, and Mackenzie Hurlston for technical assistance and sample management. We would also like to thank Dr. Mark Brockman for his discussions and generous donation of the GXR25 cells.
This study was funded by R01 AI64060 and R37 AI51231 (EH) and the International AIDS Vaccine Initiative. This work was made possible in part by the generous support of the American people through the United States Agency for International Development (USAID).&#160;The contents are the responsibility of the study authors and do not necessarily reflect the views of USAID or the United States Government. This work also was supported, in part, by the Virology Core at the Emory Center for AIDS Research (Grant P30 AI050409). DC and JP were supported in part by Action Cycling Fellowships. This work was supported in part by the Yerkes National Primate Research Center base grant (2P51RR000165-51). This project was also funded in part by the National Center for Research Resources P51RR165 and is currently supported by the Office of Research Infrastructure Programs/OD P51OD11132.

1. Amplification of the HIV-1 gag Gene from Infected, Frozen Plasma
<ol>
	<li>Extract viral RNA from 140 &#181;l thawed HIV-1 infected plasma using an extraction kit.
	<ol>
		<li>When feasible, immediately proceed to cDNA synthesis after RNA extraction as unfrozen viral RNA yields the best amplification results. If possible, set up PCR master mix for first-round DNA amplification and store at 4 &#176;C prior to viral RNA extraction.</li>
	</ol>
	</li>
	<li>Reverse-transcribe cDNA from RNA and amplify first-rou...

The authors have nothing to disclose.

Due to the length and technical nature of this protocol, there are several steps that are critical for both the successful construction of chimeric Gag-MJ4 plasmids as well as for quantification of viral replication capacity. Although the restriction enzyme based cloning strategy for the introduction of foreign gag genes into MJ4 outlined in this protocol has numerous advantages over previously used recombination based methods, the protocol can be technically challenging if critical steps are not followed precis...

Determining both the host and viral characteristics that influence HIV-1 pathogenesis and disease progression is paramount for rational vaccine design. The cellular immune response is a key component of the human immune response to HIV-1 infection. Cytotoxic T lymphocytes (CTL) are necessary for the initial control of acute viremia, and allow the host to establish a steady state (set point) viral load1,2. Experimental depletion of these effector cells results in loss of viral control3,4. Despite this, escape mutations arise within the viral genome that subvert CTL recognition of virally infected cells5-9.
Certain HLA alleles have been associated with lower viral loads and slower disease progression including B*57, B*27 and B*8110-15. Part of the protective benefit of HLA class I alleles can be attributed to the fact that they target functionally constrained regions of the genome such as Gag and select for escape mutations that decrease the ability of the virus to replicate in vitro16-21. Although escape from the cellular immune system is beneficial to the virus in the context of the selecting HLA class I allele, the effect of these mutations may have differential consequences for the host upon transmission to an HLA-mismatched individual22,23. Therefore, understanding the effects of transmitted HLA-associated escape mutations on viral replication capacity will be important to further our understanding of early HIV-1 pathogenesis.
While much progress has been made to identify and characterize the fitness defects of individual escape mutations associated with specific HLA class I alleles24-29, naturally occurring HIV-1 isolates have unique and complex footprints of HLA-associated polymorphisms, likely arising from the HLA-mediated immune pressure of different immunogenetic backgrounds30. In a previous analysis, Goepfert et al. showed that an accumulation of HLA-associated mutations in the transmitted Gag sequences derived from 88 acutely infected Zambians was associated with a reduction in set point viral load31. This suggested that the transmission of deleterious escape mutations, specifically in Gag, to HLA-mismatched recipients provides a clinical benefit, and may be due to attenuated viral replication. Moving forward, it is imperative to study how complex combinations of Gag polymorphisms within naturally occurring isolates work in concert to define characteristics of the transmitted virus such as replication capacity, and how early replication might in turn affect HIV-1 clinical parameters and late-stage pathogenesis.
Brockman et al. first demonstrated a link between the replication capacity of gag-pro sequences isolated during chronic stage infection and viral load in both subtype C and B infections32-35. The experimental approach presented in these studies, although appropriate for examining the in vitro replication capacity of sequences derived from chronically infected individuals, has several technical caveats and limitations that make studying HIV-1 replicative capacity in subtype C acutely infected individuals difficult. This method relies on the recombination of population based PCR-amplified sequences into the subtype B NL4-3 provirus, which was derived in part from LAV, a laboratory adapted virus stock36. Virus generation was accomplished by co-transfection of a CEM-based T-cell line37 with PCR amplicons and digested delta-gag-pro NL4-3 DNA. This method requires the outgrowth of virus over a period of weeks to months, potentially skewing the nature of the recovered virus stock in relation to the viral quasispecies in vivo, and therefore altering the measurement of replication capacity in vitro. This method is more appropriate for studying chronically infected individuals, where it effectively selects for virus with the highest replicative capacity, and where cloning numerous different viral variants from a large number of chronically infected individuals is quite labor intensive and therefore not feasible. However, within an acutely infected individual, there are generally one to two variants present, and thus eliminating the risk of skewing the nature of the recovered virus stock, through in vitro selection pressures, allows for a more accurate assessment of in vitro replication capacity. Secondly, this method requires recombining subtype C gag-pro sequences into a subtype B derived backbone, and could introduce backbone incompatibility biases into the analysis. Due to these limitations, large numbers of sequences must be analyzed in order to overcome any potential biases introduced.
Here we describe an alternative experimental approach appropriate for studying sequences derived from subtype C acutely infected individuals. We use a restriction enzyme based cloning strategy to introduce the gag gene derived from acute infection time points of HIV-1 subtype C infected individuals into the subtype C proviral backbone, MJ4. The use of MJ4 as a common backbone in which to clone gag genes is crucial for the analysis of subtype C derived sequences. MJ4 is derived from a primary isolate38, and thus would be less likely to introduce bias due to subtype incompatibility between the backbone and gag gene. In addition, the approach of using enzyme based restriction cloning allows for the proviral constructs to be transfected directly into 293T cells, and for the recovery of a clonal virus stock identical to the cloned gag sequence.
The method presented below is a high throughput method for assessing the replication capacity of subtype C derived Gag-MJ4 chimeric viruses. Transfection into 293T cells is straightforward and recovery of virus takes only three days. In vitro replication capacity is assayed on the same CEM-CCR5 based T-cell line created by Brockman et al.37, but using important protocol modifications necessary for the successful replication of subtype C MJ4 chimeric viruses. The use of an appropriate T-cell line rather than PBMCs allows for large numbers of subtype C MJ4-chimeric viruses to be tested with high assay reproducibility. Finally, using a radiolabeled reverse transcriptase assay for quantification of virus in the supernatant is more cost effective than using commercially available p24 ELISA kits. It also gives a higher dynamic range, which was important for detecting both poorly and highly replicating viruses within the same assay and for detecting subtle differences in replication between isolates.
In conclusion, the method presented here has allowed for the in-depth study of the replication capacity of gag sequences derived from HIV-1 subtype C acutely infected individuals from Zambia, and as written, could also be expanded to study other subtype C infected populations. A high degree of variation in replication capacities between different Gag isolates was observed. In addition, we were able to show a statistical association between the replication capacity of the transmitted Gag and set point viral load as well as with CD4+ decline over a three-year period39. Such results highlight the importance of studying how transmitted viral characteristics, such as replication capacity, interact with the host immune system to influence pathogenesis during early infection and will be integral for developing effective vaccine interventions as well as treatment.

<table border="0" cellpadding="0" cellspacing="0" width="1024">
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:444px;">Name of the Reagent</td>
			<td style="width:195px;">Company</td>
			<td style="width:133px;">Catalogue number</td>
			<td style="width:252px;">Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GOF: 5&#39; ATTTGACTAGCGGAGGCTAGAA 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VifOR: 5&#39; TTCTACGGAGACTCCATGACCC 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GagInnerF1: 
			5&#39; AGGCTAGAAGGAGAGAGATG 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BclIDegRev2: 
			5&#39; AGTATTTGATCATAYTGYYTYACTTTR 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MJ4For1b: 5&#39; CGAAATCGGCAAAATCCC 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MJ4Rev: 5&#39; CCCATCTCTCTCCTTCTAGC 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BclIRev: 5&#39; TCTATAAGTATTTGATCATACTGTCTT 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GagF2: 5&#39; GGGACATCAAGCAGCCAT 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">For3: 5&#39; CTAGGAAAAAGGGCTGTTGGAAATG 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GagR6: 5&#39; CTGTATCATCTGCTCCTG 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rev3: 5&#39; GACAGGGCTATACATTCTTACTAT 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rev1: 5&#39; AATTTTTCCAGCTCCCTGCTTGCCCA 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CoolRack PCR 96 XT</td>
			<td>Biocision</td>
			<td>BCS-529</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CoolRack M15</td>
			<td>Biocision</td>
			<td>BCS-125</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nuclease free water</td>
			<td>Fisher</td>
			<td>SH30538FS</td>
			<td>Manufactured by Hyclone</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAamp Viral RNA Mini Kit</td>
			<td>Qiagen</td>
			<td style="width:133px;">52906</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Simport PCR 8 Strip Tubes, Blue (Flat Cap)</td>
			<td>Daigger</td>
			<td>EF3647BX</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SuperScript III one-step RT-PCR system</td>
			<td>Life Technologies/Invitrogen</td>
			<td>12574035</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phusion Hot-start II DNA polymerase</td>
			<td>Fisher</td>
			<td>F-549L&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR Nucleotide Mix</td>
			<td>Roche</td>
			<td>4638956001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agarose, high gel strength</td>
			<td>Fisher</td>
			<td>50-213-128</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TAE 10X</td>
			<td>Life Technologies/Invitrogen</td>
			<td>AM9869</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Promega 1kb DNA ladder</td>
			<td>Fisher</td>
			<td>PRG5711</td>
			<td>Manufactured by Promega</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sybr Safe DNA Gel Stain, 10000x</td>
			<td>Life Technologies/Invitrogen</td>
			<td>S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Wizard SV Gel and PCR Clean-Up System</td>
			<td>Promega</td>
			<td>A9282</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Razor blades, single-edged</td>
			<td>Fisher</td>
			<td>12-640</td>
			<td>Manufactured by Surgical Design</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Thermocycler, PTC-200</td>
			<td>MJ Research</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Microbiology &#38; Cloning reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LB Agar, Miller</td>
			<td>Fisher</td>
			<td>BP1425-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LB Broth, Lennox</td>
			<td>Fisher</td>
			<td>BP1427-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 100mm x 15mm polystyrene petri dishes</td>
			<td>Fisher</td>
			<td>08-757-12</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ampicillin sodium salt</td>
			<td>Sigma-Aldrich</td>
			<td>A9518-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Falcon 14ml Polypropylene round-bottom tubes</td>
			<td>BD Biosciences</td>
			<td>352059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NgoMIV restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0564L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BclI restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0160L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HpaI restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0105L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T4 DNA Ligase, 5U/&#956;L</td>
			<td>Roche</td>
			<td>10799009001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">JM109 competent cells, &#62;10^8 cfu/&#956;g&#160;</td>
			<td>Promega</td>
			<td>L2001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PureYield plasmid miniprep system</td>
			<td>Promega&#160;</td>
			<td>A1222</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Safe Imager 2.0 Blue Light Transilluminator</td>
			<td>Invitrogen</td>
			<td>G6600</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Microfuge 18 centrifuge</td>
			<td>Beckman Coulter</td>
			<td>367160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell culture reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Amphyl cleaner/disinfectant</td>
			<td>Fisher</td>
			<td>22-030-394</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fugene HD, 1 mL</td>
			<td>VWR</td>
			<td>PAE2311</td>
			<td>Manufactured by Promega</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hexadimethrine bromide (Polybrene)</td>
			<td>Sigma-Aldrich</td>
			<td>H9268-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Costar Plates, 6-well, flat</td>
			<td>Fisher</td>
			<td>07-200-83</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Costar Plates, 24-well, flat</td>
			<td>Fisher</td>
			<td>07-200-84</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Costar Plates, 96-well, round</td>
			<td>Fisher</td>
			<td>07-200-95</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flasks, Corning filter top/canted neck, 75 cm^2</td>
			<td>Fisher</td>
			<td>10-126-37</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flasks, Corning filter top/canted neck, 150 cm^2</td>
			<td>Fisher</td>
			<td>10-126-34</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Conical Tubes, 50ml, blue cap</td>
			<td>Fisher</td>
			<td>14-432-22</td>
			<td>Manufactured by BD Biosciences</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Conical Tubes, 15ml, blue cap</td>
			<td>Fisher</td>
			<td>14-959-70C&#160;&#160;</td>
			<td>Manufactured by BD Biosciences</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trypsin-EDTA</td>
			<td>Fisher</td>
			<td>MT25052CI</td>
			<td>Manufactured by Mediatech</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RPMI, 500 ml</td>
			<td>Life Technologies/Invitrogen</td>
			<td>11875-119</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DMEM, 500 ml</td>
			<td>Life Technologies/Invitrogen</td>
			<td>11965-118</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/Streptomycin/Glutamine, 100X</td>
			<td>Life Technologies/Invitrogen</td>
			<td>10378-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS with magnesium and calcium, 500ml</td>
			<td>Life Technologies/Invitrogen</td>
			<td>14040-133</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS without magnesium and calcium</td>
			<td>Life Technologies/Invitrogen</td>
			<td>20012-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sarstedt tubes, assorted colors</td>
			<td>Sarstedt</td>
			<td>72.694.996</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Reservoir Trays for Multichannel, 55ml</td>
			<td>Fisher</td>
			<td>13-681-501</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DEAE-Dextran</td>
			<td>Fisher</td>
			<td>NC9691007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning 96 well clear V bottom tissue culture treated microplate</td>
			<td>Fisher</td>
			<td>07-200-96</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HEPES, 1M Buffer Solution</td>
			<td>Life Technologies/Invitrogen</td>
			<td>15630-080</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FBS, Defined, 500 ml</td>
			<td>Fisher</td>
			<td>SH30070 03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">X-gal</td>
			<td>VWR</td>
			<td>PAV3941</td>
			<td>Manufactured by Promega</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glutaraldehyde, Grade II, 25% in H2O</td>
			<td>Sigma-Aldrich</td>
			<td>G6257-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1M Magnesium chloride solution</td>
			<td>Sigma-Aldrich</td>
			<td>M1028-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Formaldehyde solution, for molecular biology, 36.5%</td>
			<td>Sigma-Aldrich</td>
			<td>F8775-500ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Potassium hexacyanoferrate(II) trihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>P9387-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Potassium hexacyanoferrate(III)</td>
			<td>Sigma-Aldrich</td>
			<td>P8131-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Allegra X15-R centrifuge</td>
			<td>Beckman Coulter</td>
			<td>392932</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TC10 automated cell counter</td>
			<td>Bio-Rad</td>
			<td>1450001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VistaVision inverted microscope</td>
			<td>VWR</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Reverse-Transcriptase Quantification Assay reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">dTTP, [&#945;-33P]- 3000Ci/mmol, 10mCi/ml, 1 mCi</td>
			<td>Perkin-Elmer</td>
			<td>NEG605H001MC</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1M Tris-Cl, pH 8.0</td>
			<td>Life Technologies/Invitrogen</td>
			<td>15568025</td>
			<td>Must be adjusted to pH 7.8 with KOH</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2M potassium chloride (KCl)</td>
			<td>Life Technologies/Invitrogen</td>
			<td>AM9640G</td>
			<td>Adjust to 1M solution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.5M EDTA</td>
			<td>Life Technologies/Invitrogen</td>
			<td>15575-020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nonidet P40</td>
			<td>Roche</td>
			<td style="width:133px;">11333941103</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Polyadenylic acid (Poly rA) potassium salt&#160;</td>
			<td>Midland Reagent Co.</td>
			<td>P-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo d(T) primer&#160;</td>
			<td>Life Technologies/Invitrogen</td>
			<td>18418-012</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dithiothreitol (DTT)</td>
			<td>Sigma-Aldrich</td>
			<td>43815-1G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SR, Super Resolution Phosphor Screen, Small</td>
			<td>Perkin-Elmer</td>
			<td>7001485</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning Costar Thermowell 96 well plate model (M) Polycarbonate</td>
			<td>Fisher</td>
			<td>07-200-245</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning 96 Well Microplate Aluminum Sealing Tape, Nonsterile</td>
			<td>Fisher</td>
			<td>07-200-684</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DE-81 anion exchange paper</td>
			<td>Whatman</td>
			<td>3658-915</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trisodium citrate dihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>S1804-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium Chloride</td>
			<td>Fisher</td>
			<td>S671-3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Autoradiography cassette</td>
			<td>Fisher</td>
			<td>FB-CA-810</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cyclone storage phoshpor screen</td>
			<td>Packard</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

a restriction enzyme based cloning method to assess the in vitro replication capacity of hiv-1 subtype c gag-mj4 chimeric viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

In order to properly execute this protocol, which creates a proviral plasmid capable of assembling fully functional, infectious Gag-MJ4 chimeras, great care must be taken to generate the appropriate PCR amplicons. Determining whether the PCR has generated the appropriately sized gag amplicon is crucial. Products should be within 100 base pairs (bp) of the approximately 1,700 bp amplicon depicted in Figure 1A. The exact length of this fragment will vary depending on the gag gene under st...

Watch this Scientific Journal Video about A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses at JoVE.com

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target ...

a-restriction-enzyme-based-cloning-method-to-assess-vitro-replication

Research

JoVE Journal

Immunology and Infection

15.5K Görüntüleme.  Emory University. HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.