The investigators thank all the volunteers in Zambia who participated in this study and all the staff at the Zambia Emory HIV Research Project in Lusaka who made this study possible. The investigators would like to thank Jon Allen, Smita Chavan, and Mackenzie Hurlston for technical assistance and sample management. We would also like to thank Dr. Mark Brockman for his discussions and generous donation of the GXR25 cells.
This study was funded by R01 AI64060 and R37 AI51231 (EH) and the International AIDS Vaccine Initiative. This work was made possible in part by the generous support of the American people through the United States Agency for International Development (USAID).&#160;The contents are the responsibility of the study authors and do not necessarily reflect the views of USAID or the United States Government. This work also was supported, in part, by the Virology Core at the Emory Center for AIDS Research (Grant P30 AI050409). DC and JP were supported in part by Action Cycling Fellowships. This work was supported in part by the Yerkes National Primate Research Center base grant (2P51RR000165-51). This project was also funded in part by the National Center for Research Resources P51RR165 and is currently supported by the Office of Research Infrastructure Programs/OD P51OD11132.

The authors have nothing to disclose.

인해 길이 및이 프로토콜의 기술적 특성상 키메라 개그-MJ4 플라스미드의 성공적인 구조 모두에 중요뿐만 아니라 바이러스 복제 용량의 정량 용으로 여러 가지 방법이 있습니다. 이 프로토콜에 설명 MJ4에 외국 개그 유전자의 도입에 대한 제한 효소 기반의 복제 전략은 이전에 사용 된 재조합 기반 방법에 비해 많은 장점을 가지고 있지만 중요한 단계가 정확하게 준수하지 않을 경우, 프로토...

호스트와 HIV-1 병인과 병의 진행이 합리적인 백신 설계를위한 가장 중요하다 영향을 바이러스의 특성을 모두 결정. 세포 성 면역 반응은 HIV-1 감염에 대한 인간의 면역 반응의 핵심 구성 요소입니다. 세포 독성 T 림프구 (CTL)는 급성 바이러스 혈증의 초기 제어에 필요한, 및 호스트가 정상 상태 (설정치) 1,2 바이러스 부하를 확립 할 수있다. 이 이펙터 세포의 실험 고갈 바이러스 제어 3,4의 손실이 발생합니다. 그럼에도 불구하고, 돌연변이가 바이러스처럼 감염된 세포 5-9의 CTL 인식을 파괴하는 바이러스 게놈 내에서 발생 탈출. 특정 HLA 대립 유전자는 낮은 바이러스 부하와 B * 57, B * 27와 B * 81 ~ 15를 포함하여 느린 질병의 진행과 관련이있다. HLA 클래스 I 대립 유전자의 보호 효과의 부분들은 같은 개그 같은 게놈의 기능적 제한 지역을 대상으로한다는 사실에 기인 할 수있다체외 16-21에 복제하는 바이러스의 능력을 감소 탈출 돌연변이 선택합니다. 세포 면역 시스템으로부터의 탈출 내가 대립 선택 HLA 클래스의 맥락에서 바이러스에 유익하지만, 이러한 돌연변이의 효과는 HLA-일치하지 않는 22, 23 개인에게 전송시 호스트에 대한 차등 결과를 초래할 수 있습니다. 따라서, 바이러스 복제 능력에 전송 HLA 관련 탈출 돌연변이의 영향을 이해하는 것은 초기 HIV-1 병인에 대한 우리의 이해를 증진하는 것이 중요 할 것입니다. 많은 진전이 나는 24-29을 대립 유전자 특정 HLA 클래스와 연관된 개별 탈출 돌연변이의 피트니스 결함을 식별하고 특성화하기 위해 만든 하였지만, 자연적으로 HIV-1 균주는 HLA-관련 유전자 다형성의 독특하고 복잡한 발자국 가능성이 HLA에서 발생, 한 발생 다른 immunogenetic 배경 30 - 매개 면역 압력. AP에서revious 분석, Goepfert 등. 88 심하게 감염된 잠비아 유래의 개그 송신 시퀀스에서 HLA-관련 돌연변이의 축적이 설정치 바이러스 부하 (31)의 감소와 연관된 것으로 나타났다. 이 HLA-일치하지 않는받는 사람에게 특히 개그에 해로운 탈출 돌연변이의 전송, 임상 적 혜택을 제공하고, 바이러스 복제를 감쇠로 인해 수 있다는 것을 제안했다. 나아가, 이러한 복제 용량, 초기 복제가 차례로 HIV-1 임상 매개 변수와 마지막 단계에 영향을 미칠 수있는 방법으로 전송 된 바이러스의 특성을 정의하는 콘서트에서 작동하는 방법을 복잡 개그 다형성의 조합 자연적으로 발생하는 균주 내에서 공부하는 것이 필수적입니다 병인. 브록 등은. 첫번째 서브 타입 C와 B 모두에서 감염의 만성 감염 단계 및 바이러스 부하 중에 고립 개그 프로 서열의 복제 능력 사이의 링크를 입증32 ~ 35. 이 연구에서 제시하는 실험적인 접근 방식, 만성적으로 감염된 사람에서 파생 된 시퀀스의 체외 복제 능력을 조사하기위한 있지만 적절한은 심하게 감염된 개인 어려운 서브 타입 C에서 HIV-1 증식 및 용량을 공부 할 수있는 여러 가지 기술주의 사항 및 제한 사항이 있습니다. 이 방법은 LAV에서 일부 파생 된 서브 타입 B NL4-3의 프로 바이러스로 인구 기반의 PCR 증폭 시퀀스의 재결합에 의존 연구소는 바이러스 스톡 (36)을 적용. 바이러스의 생성은 PCR 증폭 산물과 CEM 기반 T 세포 라인 (37)의 공동 형질 감염에 의해 달성 및 델타 개그 프로 NL4-3 DNA를 소화시켰다. 이 방법은 잠재적으로 생체 내에서 바이러스 quasispecies 관련 회수 바이러스 스톡의 성격을 기울이기 때문에 생체 외에서 복제 능력의 측정을 변경, 주 개월의 기간에 걸쳐 바이러스의 파생물을 필요로한다. 이 방법의 난만성적으로 감염된 개인의 다수로부터 다수의 상이한 바이러스 변이체를 복제 효과적으로 증식 및 높은 용량 바이러스를 선택하는 경우, 만성적으로 감염된 개인을 연구하고, 여기서 더 적합한 s의 것은 가능하므로 상당히 노동 집약적이고 아니다. 그러나, 심하게 감염된 개인에서, 일반적으로 1-2 변형이 존재하며, 따라서, 생체 외 선택 압력을 통해 회수 된 바이러스 스톡의 성격을 기울일의 위험을 제거하는, 시험 관내 복제 능력의 더 정확한 평가를 허용한다. 둘째,이 방법은 하위 B 파생 백본으로 서브 타입 C 개그 프로 시퀀스를 재결합이 필요하며, 분석에 백본 호환성 편견을 소개 할 수있다. 이러한 한계로 인해, 다수 서열이 도입 잠재적 인 편견을 극복하기 위해 분석되어야한다. 여기에서 우리는 또 다른 실험 아프로을 설명서브 타입 C 심하게 감염된 개체로부터 유래 된 서열을 연구 적절한 ACH. 우리는 서브 타입 C의 프로 바이러스 백본, MJ4에 HIV-1 아형 C 감염된 개인의 급성 감염 시점에서 파생 된 개그 유전자를 도입하는 제한 효소 기반의 복제 전략을 사용합니다. 개그 유전자를 복제하는의 일반적인 백본 MJ4의 사용은 서브 타입 C 파생 시퀀스의 분석을 위해 매우 중요합니다. MJ4 인해 백본 및 개그 유전자 사이의 하위 호환성에 바이어스를 소개하는 거의 없을 것입니다 따라서 기본 분리 38에서 유래하고있다. 프로 바이러스를 293T 세포에 직접 형질 감염 될 구축하고, 클로닝 개그 서열 동일한 클론 바이러스 스톡의 복구를위한 또, 제한 효소 기반 복제를 사용하는 방법은 허용한다. 아래에 제시된 방법은 유도 개그-MJ4 서브 타입 C의 복제 능력을 평가하기위한 높은 처리 방법키메라 바이러스. 293T 세포로 형질 간단하고 바이러스의 회수는 단지 세 일이 걸린다. 관내 복제 용량. 브록 등에 의해 작성된 동일 CEM-CCR5 기반 T 세포 라인 (37)을 정량하지만, 성공적인 복제를 위해 필요한 중요한 프로토콜의 수정을 사용 서브 타입 C MJ4 키메라 바이러스. 오히려 PBMC를보다 적절한 T-세포주의 사용은 높은 분석 재현성 테스트되는 서브 타입 C-MJ4의 키메라 바이러스의 다수 허용한다. 마지막으로, 상청액에서 바이러스의 정량화를위한​​ 방사성 표지 된 역전사 효소 분석을 사용하여 시판 P24 ELISA 키트를 사용하는 것보다 더 비용 효율적이다. 또한 동일한 분석 내에서 모두 좋지 높은 복제 바이러스를 검출하고 분리 복제 사이에 미묘한 차이를 검출하기위한 중요한 높은 동적 범위를 제공한다. 결론적으로, 여기에 제시된 방법은 허용하고있다HIV-1 아형 C에서 파생 된 개그 시퀀스의 복제 능력에 대한 심층적 인 연구는 급성 잠비아에서 개인을 감염, 및 서면으로, 또한 C는 인구를 감염 다른 하위 유형을 연구하기 위해 확장 될 수있다. 다른 개그 균주 간의 복제 용량의 변화의 높은 수준이 관찰되었다. 또한, 우리는 3 년 동안 39 이상 CD4 + 하락 전송 개그의 복제 용량 및 설정치 바이러스 부하 사이뿐만 아니라와 통계적 연관성을 보여줄 수 있었다. 이러한 결과는 복제, 용량 등의 방법에 전송 된 바이러스의 특성을 공부의 중요성을 강조 초기 감염시 발병에 영향을 미칠 수있는 호스트의 면역 시스템과 상호 작용하고 효과적인 백신 개입뿐만 아니라 치료를 개발하기위한 통합 될 것입니다.

<table border="0" cellpadding="0" cellspacing="0" width="1024">
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:444px;">Name of the Reagent</td>
			<td style="width:195px;">Company</td>
			<td style="width:133px;">Catalogue number</td>
			<td style="width:252px;">Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GOF: 5&#39; ATTTGACTAGCGGAGGCTAGAA 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VifOR: 5&#39; TTCTACGGAGACTCCATGACCC 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GagInnerF1: 
			5&#39; AGGCTAGAAGGAGAGAGATG 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BclIDegRev2: 
			5&#39; AGTATTTGATCATAYTGYYTYACTTTR 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MJ4For1b: 5&#39; CGAAATCGGCAAAATCCC 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MJ4Rev: 5&#39; CCCATCTCTCTCCTTCTAGC 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BclIRev: 5&#39; TCTATAAGTATTTGATCATACTGTCTT 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GagF2: 5&#39; GGGACATCAAGCAGCCAT 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">For3: 5&#39; CTAGGAAAAAGGGCTGTTGGAAATG 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GagR6: 5&#39; CTGTATCATCTGCTCCTG 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rev3: 5&#39; GACAGGGCTATACATTCTTACTAT 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rev1: 5&#39; AATTTTTCCAGCTCCCTGCTTGCCCA 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CoolRack PCR 96 XT</td>
			<td>Biocision</td>
			<td>BCS-529</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CoolRack M15</td>
			<td>Biocision</td>
			<td>BCS-125</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nuclease free water</td>
			<td>Fisher</td>
			<td>SH30538FS</td>
			<td>Manufactured by Hyclone</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAamp Viral RNA Mini Kit</td>
			<td>Qiagen</td>
			<td style="width:133px;">52906</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Simport PCR 8 Strip Tubes, Blue (Flat Cap)</td>
			<td>Daigger</td>
			<td>EF3647BX</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SuperScript III one-step RT-PCR system</td>
			<td>Life Technologies/Invitrogen</td>
			<td>12574035</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phusion Hot-start II DNA polymerase</td>
			<td>Fisher</td>
			<td>F-549L&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR Nucleotide Mix</td>
			<td>Roche</td>
			<td>4638956001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agarose, high gel strength</td>
			<td>Fisher</td>
			<td>50-213-128</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TAE 10X</td>
			<td>Life Technologies/Invitrogen</td>
			<td>AM9869</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Promega 1kb DNA ladder</td>
			<td>Fisher</td>
			<td>PRG5711</td>
			<td>Manufactured by Promega</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sybr Safe DNA Gel Stain, 10000x</td>
			<td>Life Technologies/Invitrogen</td>
			<td>S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Wizard SV Gel and PCR Clean-Up System</td>
			<td>Promega</td>
			<td>A9282</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Razor blades, single-edged</td>
			<td>Fisher</td>
			<td>12-640</td>
			<td>Manufactured by Surgical Design</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Thermocycler, PTC-200</td>
			<td>MJ Research</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Microbiology &#38; Cloning reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LB Agar, Miller</td>
			<td>Fisher</td>
			<td>BP1425-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LB Broth, Lennox</td>
			<td>Fisher</td>
			<td>BP1427-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 100mm x 15mm polystyrene petri dishes</td>
			<td>Fisher</td>
			<td>08-757-12</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ampicillin sodium salt</td>
			<td>Sigma-Aldrich</td>
			<td>A9518-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Falcon 14ml Polypropylene round-bottom tubes</td>
			<td>BD Biosciences</td>
			<td>352059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NgoMIV restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0564L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BclI restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0160L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HpaI restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0105L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T4 DNA Ligase, 5U/&#956;L</td>
			<td>Roche</td>
			<td>10799009001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">JM109 competent cells, &#62;10^8 cfu/&#956;g&#160;</td>
			<td>Promega</td>
			<td>L2001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PureYield plasmid miniprep system</td>
			<td>Promega&#160;</td>
			<td>A1222</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Safe Imager 2.0 Blue Light Transilluminator</td>
			<td>Invitrogen</td>
			<td>G6600</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Microfuge 18 centrifuge</td>
			<td>Beckman Coulter</td>
			<td>367160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell culture reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Amphyl cleaner/disinfectant</td>
			<td>Fisher</td>
			<td>22-030-394</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fugene HD, 1 mL</td>
			<td>VWR</td>
			<td>PAE2311</td>
			<td>Manufactured by Promega</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hexadimethrine bromide (Polybrene)</td>
			<td>Sigma-Aldrich</td>
			<td>H9268-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Costar Plates, 6-well, flat</td>
			<td>Fisher</td>
			<td>07-200-83</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Costar Plates, 24-well, flat</td>
			<td>Fisher</td>
			<td>07-200-84</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Costar Plates, 96-well, round</td>
			<td>Fisher</td>
			<td>07-200-95</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flasks, Corning filter top/canted neck, 75 cm^2</td>
			<td>Fisher</td>
			<td>10-126-37</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flasks, Corning filter top/canted neck, 150 cm^2</td>
			<td>Fisher</td>
			<td>10-126-34</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Conical Tubes, 50ml, blue cap</td>
			<td>Fisher</td>
			<td>14-432-22</td>
			<td>Manufactured by BD Biosciences</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Conical Tubes, 15ml, blue cap</td>
			<td>Fisher</td>
			<td>14-959-70C&#160;&#160;</td>
			<td>Manufactured by BD Biosciences</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trypsin-EDTA</td>
			<td>Fisher</td>
			<td>MT25052CI</td>
			<td>Manufactured by Mediatech</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RPMI, 500 ml</td>
			<td>Life Technologies/Invitrogen</td>
			<td>11875-119</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DMEM, 500 ml</td>
			<td>Life Technologies/Invitrogen</td>
			<td>11965-118</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/Streptomycin/Glutamine, 100X</td>
			<td>Life Technologies/Invitrogen</td>
			<td>10378-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS with magnesium and calcium, 500ml</td>
			<td>Life Technologies/Invitrogen</td>
			<td>14040-133</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS without magnesium and calcium</td>
			<td>Life Technologies/Invitrogen</td>
			<td>20012-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sarstedt tubes, assorted colors</td>
			<td>Sarstedt</td>
			<td>72.694.996</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Reservoir Trays for Multichannel, 55ml</td>
			<td>Fisher</td>
			<td>13-681-501</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DEAE-Dextran</td>
			<td>Fisher</td>
			<td>NC9691007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning 96 well clear V bottom tissue culture treated microplate</td>
			<td>Fisher</td>
			<td>07-200-96</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HEPES, 1M Buffer Solution</td>
			<td>Life Technologies/Invitrogen</td>
			<td>15630-080</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FBS, Defined, 500 ml</td>
			<td>Fisher</td>
			<td>SH30070 03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">X-gal</td>
			<td>VWR</td>
			<td>PAV3941</td>
			<td>Manufactured by Promega</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glutaraldehyde, Grade II, 25% in H2O</td>
			<td>Sigma-Aldrich</td>
			<td>G6257-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1M Magnesium chloride solution</td>
			<td>Sigma-Aldrich</td>
			<td>M1028-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Formaldehyde solution, for molecular biology, 36.5%</td>
			<td>Sigma-Aldrich</td>
			<td>F8775-500ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Potassium hexacyanoferrate(II) trihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>P9387-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Potassium hexacyanoferrate(III)</td>
			<td>Sigma-Aldrich</td>
			<td>P8131-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Allegra X15-R centrifuge</td>
			<td>Beckman Coulter</td>
			<td>392932</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TC10 automated cell counter</td>
			<td>Bio-Rad</td>
			<td>1450001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VistaVision inverted microscope</td>
			<td>VWR</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Reverse-Transcriptase Quantification Assay reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">dTTP, [&#945;-33P]- 3000Ci/mmol, 10mCi/ml, 1 mCi</td>
			<td>Perkin-Elmer</td>
			<td>NEG605H001MC</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1M Tris-Cl, pH 8.0</td>
			<td>Life Technologies/Invitrogen</td>
			<td>15568025</td>
			<td>Must be adjusted to pH 7.8 with KOH</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2M potassium chloride (KCl)</td>
			<td>Life Technologies/Invitrogen</td>
			<td>AM9640G</td>
			<td>Adjust to 1M solution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.5M EDTA</td>
			<td>Life Technologies/Invitrogen</td>
			<td>15575-020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nonidet P40</td>
			<td>Roche</td>
			<td style="width:133px;">11333941103</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Polyadenylic acid (Poly rA) potassium salt&#160;</td>
			<td>Midland Reagent Co.</td>
			<td>P-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo d(T) primer&#160;</td>
			<td>Life Technologies/Invitrogen</td>
			<td>18418-012</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dithiothreitol (DTT)</td>
			<td>Sigma-Aldrich</td>
			<td>43815-1G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SR, Super Resolution Phosphor Screen, Small</td>
			<td>Perkin-Elmer</td>
			<td>7001485</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning Costar Thermowell 96 well plate model (M) Polycarbonate</td>
			<td>Fisher</td>
			<td>07-200-245</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning 96 Well Microplate Aluminum Sealing Tape, Nonsterile</td>
			<td>Fisher</td>
			<td>07-200-684</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DE-81 anion exchange paper</td>
			<td>Whatman</td>
			<td>3658-915</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trisodium citrate dihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>S1804-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium Chloride</td>
			<td>Fisher</td>
			<td>S671-3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Autoradiography cassette</td>
			<td>Fisher</td>
			<td>FB-CA-810</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cyclone storage phoshpor screen</td>
			<td>Packard</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

a restriction enzyme based cloning method to assess the in vitro replication capacity of hiv-1 subtype c gag-mj4 chimeric viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

제대로 완전한 기능, 전염성 개그 - MJ4의 키메라를 조립 할 수있는 프로 바이러스 플라스미드를 생성이 프로토콜을 실행하기 위해 큰 관심은 적절한 PCR 증폭 산물을 생성하기 위해주의해야합니다. PCR은 적절한 크기의 개그 앰플 리콘을 생성 여부를 결정하는 것은 매우 중요합니다. 제품도 1a에 도시 된 약 1,700 bp의 증폭 물 100 염기쌍 (bp의) 내에 있어야합니다. 이 조각의 정확한 ...

Watch this Scientific Journal Video about A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses at JoVE.com

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

제한 효소 기반의 복제 방법을 평가하기 위해<em&gt; 시험관</em&gt; HIV-1 서브 타입 C 개그 - MJ4 키메라 바이러스의 복제 능력

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target ...

a-restriction-enzyme-based-cloning-method-to-assess-vitro-replication

Research

JoVE Journal

Immunology and Infection

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

15.5K 조회수.  Emory University. HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

비디오: A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

V3의 HIV - 1 Tropism의 Genotypic 추론 사용 인구를 기반 시퀀싱

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

연구

면역학 및 감염병학

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

HIV - 1 코어의 시험 관내 Uncoating에서

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

<em&gt; 체외에서</em공부하기&gt; 공동 감염 모델<em&gt; Plasmodium falciparum</em인간의 기본 단핵구 파생 면역 세포에서&gt; - HIV-1 상호 작용

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

양극화 인간기도 액체 덮인 문화를 구축 호흡기 병원균에 대한 숙주 세포 응답을 공부하는 상피 Calu-3 전지<em&gt; 체외에서</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

셀 기반의 ELISA 분석을 사용하여 HIV-1 삼량 봉투 당 단백질의 구조적 평가

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses

In vitro fitness assays are essential tools for determining viral replication fitness for viruses such as HIV-1. Various measurements have been used to extrapolate viral replication fitness, ranging from the number of viral particles per infectious unit, growth rate in cell culture, and relative fitness derived from multiple-cycle growth competition assays. Growth competition assays provide a particularly sensitive measurement of fitness since the viruses are competing for cellular targets under identical growth conditions. There are several experimental factors to consider when conducting growth competition assays, including the multiplicity of infection (MOI), sampling times, and viral detection and fitness calculation methods. Each factor can affect the end result and hence must be considered carefully during the experimental design. The protocol presented here includes steps from constructing a new recombinant HIV-1 clone to performing growth competition assays and analyzing the experimental results. This protocol utilizes experimental parameter values previously shown to yield consistent and robust results. Alternatives are discussed, as some parameters need to be adjusted according to the cell type and viruses being studied. The protocol contains two alternative viral detection methods to provide flexibility as the availability of instruments, reagents and expertise varies between laboratories.

Growth competition between nearly isogenic viruses provides a sensitive measurement for determining relative replication fitness. The protocols described here include the construction of recombinant HIV-1 clones, virus propagation and growth competition and analysis methods optimized to yield sensitive and consistent results.

인간 면역 결핍 바이러스의 복제 피트니스를 결정하기위한 인접 쌍 성장 경쟁 분석

In vitro fitness assays are essential tools for determining viral replication fitness for viruses such as HIV-1. Various measurements have been used to ...

Intranasal Administration of Recombinant Influenza Vaccines in Chimeric Mouse Models to Study Mucosal Immunity

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the physiological mechanisms that mediate immune responses to vaccines perhaps due to the overall success of vaccination, which has reduced interest into the molecular and physiological mechanisms of vaccine immunity. However, several important human pathogens including influenza virus still pose a challenge for vaccination, and may benefit from immune-based strategies. 
Although influenza reverse genetics has been successfully applied to the generation of live-attenuated influenza vaccines (LAIVs), the addition of molecular tools in vaccine preparations such as tracer components to follow up the kinetics of vaccination in vivo, has not been addressed. In addition, the recent generation of mouse models that allow specific depletion of leukocytes during kinetic studies has opened a window of opportunity to understand the basic immune mechanisms underlying vaccine-elicited protection. Here, we describe how the combination of reverse genetics and chimeric mouse models may help to provide new insights into how vaccines work at physiological and molecular levels, using as example a recombinant, cold-adapted, live-attenuated influenza vaccine (LAIV). We utilized laboratory-generated LAIVs harboring cell tracers as well as competitive bone marrow chimeras (BMCs) to determine the early kinetics of vaccine immunity and the main physiological mechanisms responsible for the initiation of vaccine-specific adaptive immunity. In addition, we show how this technique may facilitate gene function studies in single animals during immune responses to vaccines. We propose that this technique can be applied to improve current prophylactic strategies against pathogens for which urgent medical countermeasures are needed, for example influenza, HIV, Plasmodium, and hemorrhagic fever viruses such as Ebola virus.

There is an overall lack of knowledge about how vaccines work. Here we propose the combined use of reverse genetics and bone marrow chimeric mice to gain insight into the early host immune responses to vaccines with a special focus on dendritic cells and T cell immunity.

키메라 마우스 모델에서 재조합 인플루엔자 백신의 비강 관리는 점막 면역을 연구하기 위해

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the ...

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the viral capsid (CA) core into the cytoplasm. Subsequently, the viral Reverse Transcriptase (RT), as part of a namesake nucleoprotein complex termed the Reverse Transcription Complex (RTC), converts the viral single-stranded RNA genome into a double-stranded DNA copy (vDNA). This leads to the biogenesis of another nucleoprotein complex, termed the pre-integration complex (PIC), composed of the vDNA and associated virus proteins and host factors. The PIC-associated viral integrase (IN) orchestrates the integration of the vDNA into the host chromosomal DNA in a temporally and spatially regulated two-step process. First, the IN processes the 3&#39; ends of the vDNA in the cytoplasm and, second, after the PIC traffics to the nucleus, it mediates integration of the processed vDNA into the chromosomal DNA. The PICs isolated from target cells acutely infected with HIV-1 are functional in vitro, as they are competent to integrate the associated vDNA into an exogenously added heterologous target DNA. Such PIC-based in vitro integration assays have significantly contributed to delineating the mechanistic details of retroviral integration and to discovering IN inhibitors. In this report, we elaborate upon an updated HIV-1 PIC assay that employs a nested real-time quantitative Polymerase Chain Reaction (qPCR)-based strategy for measuring the in vitro integration activity of isolated native PICs.

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

측정<em&gt; 체외</em&gt; HIV-1 사전 통합 단지의 통합 활동

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can characterize thousands of proteins at a time. These powerful techniques allow us to have a systemic understanding of cellular changes, especially when cells are subjected to various stimuli, such as infections, stresses, and specific test conditions. Even with recent developments, analyzing the exosomal proteome is time-consuming and often involves complex methodologies. In addition, the resultant large dataset often needs robust and streamlined analysis in order for researchers to perform further downstream studies. Here, we describe a SILAC-based protocol for characterizing the exosomal proteome when cells are infected with HIV-1. The method is based on simple isotope labeling, isolation of exosomes from differentially labeled cells, and mass spectrometry analysis. This is followed by detailed data mining and bioinformatics analysis of the proteomic hits. The resultant datasets and candidates are easy to understand and often offer a wealth of information that is useful for downstream analysis. This protocol is applicable to other subcellular compartments and a wide range of test conditions.

Here, we describe a quantitative proteomics method using the technique of stable isotope labeling by amino acids in cell culture (SILAC) to analyze the effects of HIV-1 infection on host exosomal proteomes. This protocol can be easily adapted to cells under different stress or infection conditions.

HIV-1에 감염된 세포에서 엑소 좀의 SILAC 기반 단백체 특성

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can ...

Fluorescence-based Neuraminidase Inhibition Assay to Assess the Susceptibility of Influenza Viruses to The Neuraminidase Inhibitor Class of Antivirals

The neuraminidase (NA) inhibitors are the only class of antivirals approved for the treatment and prophylaxis of influenza that are effective against currently circulating strains. In addition to their use in treating seasonal influenza, the NA inhibitors have been stockpiled by a number of countries for use in the event of a pandemic. It is therefore important to monitor the susceptibility of circulating influenza viruses to this class of antivirals. There are different types of assays that can be used to assess the susceptibility of influenza viruses to the NA inhibitors, but the enzyme inhibition assays using either a fluorescent substrate or a chemiluminescent substrate are the most widely used and recommended. This protocol describes the use of a fluorescence-based assay to assess influenza virus susceptibility to NA inhibitors. The assay is based on the NA enzyme cleaving the 2&#8242;-(4-Methylumbelliferyl)-&#945;-D-N-acetylneuraminic acid (MUNANA) substrate to release the fluorescent product 4-methylumbelliferone (4-MU). Therefore, the inhibitory effect of an NA inhibitor on the influenza virus NA is determined based on the concentration of the NA inhibitor that is required to reduce 50% of the NA activity, given as an IC50 value.

We describe the use of a phenotypic fluorescence-based neuraminidase inhibition assay to assess the susceptibility of influenza A and B viruses to the neuraminidase inhibitor class of antivirals.

형광 기반의 뉴 라미니다 아제 억제 분석은 항 바이러스제의 뉴 라미니다 아제 억제제 클래스에 인플루엔자 바이러스의 감수성을 평가하기 위해

The neuraminidase (NA) inhibitors are the only class of antivirals approved for the treatment and prophylaxis of influenza that are effective against ...