Name: a restriction enzyme based cloning method to assess the in vitro replication capacity of hiv-1 subtype c gag-mj4 chimeric viruses
Uploaded: 2014-08-31T14:00:00
Description: Watch this Scientific Journal Video about A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses at JoVE.com

The investigators thank all the volunteers in Zambia who participated in this study and all the staff at the Zambia Emory HIV Research Project in Lusaka who made this study possible. The investigators would like to thank Jon Allen, Smita Chavan, and Mackenzie Hurlston for technical assistance and sample management. We would also like to thank Dr. Mark Brockman for his discussions and generous donation of the GXR25 cells.
This study was funded by R01 AI64060 and R37 AI51231 (EH) and the International AIDS Vaccine Initiative. This work was made possible in part by the generous support of the American people through the United States Agency for International Development (USAID).&#160;The contents are the responsibility of the study authors and do not necessarily reflect the views of USAID or the United States Government. This work also was supported, in part, by the Virology Core at the Emory Center for AIDS Research (Grant P30 AI050409). DC and JP were supported in part by Action Cycling Fellowships. This work was supported in part by the Yerkes National Primate Research Center base grant (2P51RR000165-51). This project was also funded in part by the National Center for Research Resources P51RR165 and is currently supported by the Office of Research Infrastructure Programs/OD P51OD11132.

1. Amplification of the HIV-1 gag Gene from Infected, Frozen Plasma
<ol>
	<li>Extract viral RNA from 140 &#181;l thawed HIV-1 infected plasma using an extraction kit.
	<ol>
		<li>When feasible, immediately proceed to cDNA synthesis after RNA extraction as unfrozen viral RNA yields the best amplification results. If possible, set up PCR master mix for first-round DNA amplification and store at 4 &#176;C prior to viral RNA extraction.</li>
	</ol>
	</li>
	<li>Reverse-transcribe cDNA from RNA and amplify first-rou...

Due to the length and technical nature of this protocol, there are several steps that are critical for both the successful construction of chimeric Gag-MJ4 plasmids as well as for quantification of viral replication capacity. Although the restriction enzyme based cloning strategy for the introduction of foreign gag genes into MJ4 outlined in this protocol has numerous advantages over previously used recombination based methods, the protocol can be technically challenging if critical steps are not followed precis...

Determining both the host and viral characteristics that influence HIV-1 pathogenesis and disease progression is paramount for rational vaccine design. The cellular immune response is a key component of the human immune response to HIV-1 infection. Cytotoxic T lymphocytes (CTL) are necessary for the initial control of acute viremia, and allow the host to establish a steady state (set point) viral load1,2. Experimental depletion of these effector cells results in loss of viral control3,4. Despite this, escape mutations arise within the viral genome that subvert CTL recognition of virally infected cells5-9.
Certain HLA alleles have been associated with lower viral loads and slower disease progression including B*57, B*27 and B*8110-15. Part of the protective benefit of HLA class I alleles can be attributed to the fact that they target functionally constrained regions of the genome such as Gag and select for escape mutations that decrease the ability of the virus to replicate in vitro16-21. Although escape from the cellular immune system is beneficial to the virus in the context of the selecting HLA class I allele, the effect of these mutations may have differential consequences for the host upon transmission to an HLA-mismatched individual22,23. Therefore, understanding the effects of transmitted HLA-associated escape mutations on viral replication capacity will be important to further our understanding of early HIV-1 pathogenesis.
While much progress has been made to identify and characterize the fitness defects of individual escape mutations associated with specific HLA class I alleles24-29, naturally occurring HIV-1 isolates have unique and complex footprints of HLA-associated polymorphisms, likely arising from the HLA-mediated immune pressure of different immunogenetic backgrounds30. In a previous analysis, Goepfert et al. showed that an accumulation of HLA-associated mutations in the transmitted Gag sequences derived from 88 acutely infected Zambians was associated with a reduction in set point viral load31. This suggested that the transmission of deleterious escape mutations, specifically in Gag, to HLA-mismatched recipients provides a clinical benefit, and may be due to attenuated viral replication. Moving forward, it is imperative to study how complex combinations of Gag polymorphisms within naturally occurring isolates work in concert to define characteristics of the transmitted virus such as replication capacity, and how early replication might in turn affect HIV-1 clinical parameters and late-stage pathogenesis.
Brockman et al. first demonstrated a link between the replication capacity of gag-pro sequences isolated during chronic stage infection and viral load in both subtype C and B infections32-35. The experimental approach presented in these studies, although appropriate for examining the in vitro replication capacity of sequences derived from chronically infected individuals, has several technical caveats and limitations that make studying HIV-1 replicative capacity in subtype C acutely infected individuals difficult. This method relies on the recombination of population based PCR-amplified sequences into the subtype B NL4-3 provirus, which was derived in part from LAV, a laboratory adapted virus stock36. Virus generation was accomplished by co-transfection of a CEM-based T-cell line37 with PCR amplicons and digested delta-gag-pro NL4-3 DNA. This method requires the outgrowth of virus over a period of weeks to months, potentially skewing the nature of the recovered virus stock in relation to the viral quasispecies in vivo, and therefore altering the measurement of replication capacity in vitro. This method is more appropriate for studying chronically infected individuals, where it effectively selects for virus with the highest replicative capacity, and where cloning numerous different viral variants from a large number of chronically infected individuals is quite labor intensive and therefore not feasible. However, within an acutely infected individual, there are generally one to two variants present, and thus eliminating the risk of skewing the nature of the recovered virus stock, through in vitro selection pressures, allows for a more accurate assessment of in vitro replication capacity. Secondly, this method requires recombining subtype C gag-pro sequences into a subtype B derived backbone, and could introduce backbone incompatibility biases into the analysis. Due to these limitations, large numbers of sequences must be analyzed in order to overcome any potential biases introduced.
Here we describe an alternative experimental approach appropriate for studying sequences derived from subtype C acutely infected individuals. We use a restriction enzyme based cloning strategy to introduce the gag gene derived from acute infection time points of HIV-1 subtype C infected individuals into the subtype C proviral backbone, MJ4. The use of MJ4 as a common backbone in which to clone gag genes is crucial for the analysis of subtype C derived sequences. MJ4 is derived from a primary isolate38, and thus would be less likely to introduce bias due to subtype incompatibility between the backbone and gag gene. In addition, the approach of using enzyme based restriction cloning allows for the proviral constructs to be transfected directly into 293T cells, and for the recovery of a clonal virus stock identical to the cloned gag sequence.
The method presented below is a high throughput method for assessing the replication capacity of subtype C derived Gag-MJ4 chimeric viruses. Transfection into 293T cells is straightforward and recovery of virus takes only three days. In vitro replication capacity is assayed on the same CEM-CCR5 based T-cell line created by Brockman et al.37, but using important protocol modifications necessary for the successful replication of subtype C MJ4 chimeric viruses. The use of an appropriate T-cell line rather than PBMCs allows for large numbers of subtype C MJ4-chimeric viruses to be tested with high assay reproducibility. Finally, using a radiolabeled reverse transcriptase assay for quantification of virus in the supernatant is more cost effective than using commercially available p24 ELISA kits. It also gives a higher dynamic range, which was important for detecting both poorly and highly replicating viruses within the same assay and for detecting subtle differences in replication between isolates.
In conclusion, the method presented here has allowed for the in-depth study of the replication capacity of gag sequences derived from HIV-1 subtype C acutely infected individuals from Zambia, and as written, could also be expanded to study other subtype C infected populations. A high degree of variation in replication capacities between different Gag isolates was observed. In addition, we were able to show a statistical association between the replication capacity of the transmitted Gag and set point viral load as well as with CD4+ decline over a three-year period39. Such results highlight the importance of studying how transmitted viral characteristics, such as replication capacity, interact with the host immune system to influence pathogenesis during early infection and will be integral for developing effective vaccine interventions as well as treatment.

<table border="0" cellpadding="0" cellspacing="0" width="1024">
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:444px;">Name of the Reagent</td>
			<td style="width:195px;">Company</td>
			<td style="width:133px;">Catalogue number</td>
			<td style="width:252px;">Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GOF: 5&#39; ATTTGACTAGCGGAGGCTAGAA 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VifOR: 5&#39; TTCTACGGAGACTCCATGACCC 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GagInnerF1: 
			5&#39; AGGCTAGAAGGAGAGAGATG 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BclIDegRev2: 
			5&#39; AGTATTTGATCATAYTGYYTYACTTTR 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MJ4For1b: 5&#39; CGAAATCGGCAAAATCCC 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MJ4Rev: 5&#39; CCCATCTCTCTCCTTCTAGC 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BclIRev: 5&#39; TCTATAAGTATTTGATCATACTGTCTT 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GagF2: 5&#39; GGGACATCAAGCAGCCAT 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">For3: 5&#39; CTAGGAAAAAGGGCTGTTGGAAATG 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GagR6: 5&#39; CTGTATCATCTGCTCCTG 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rev3: 5&#39; GACAGGGCTATACATTCTTACTAT 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rev1: 5&#39; AATTTTTCCAGCTCCCTGCTTGCCCA 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CoolRack PCR 96 XT</td>
			<td>Biocision</td>
			<td>BCS-529</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CoolRack M15</td>
			<td>Biocision</td>
			<td>BCS-125</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nuclease free water</td>
			<td>Fisher</td>
			<td>SH30538FS</td>
			<td>Manufactured by Hyclone</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAamp Viral RNA Mini Kit</td>
			<td>Qiagen</td>
			<td style="width:133px;">52906</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Simport PCR 8 Strip Tubes, Blue (Flat Cap)</td>
			<td>Daigger</td>
			<td>EF3647BX</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SuperScript III one-step RT-PCR system</td>
			<td>Life Technologies/Invitrogen</td>
			<td>12574035</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phusion Hot-start II DNA polymerase</td>
			<td>Fisher</td>
			<td>F-549L&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR Nucleotide Mix</td>
			<td>Roche</td>
			<td>4638956001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agarose, high gel strength</td>
			<td>Fisher</td>
			<td>50-213-128</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TAE 10X</td>
			<td>Life Technologies/Invitrogen</td>
			<td>AM9869</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Promega 1kb DNA ladder</td>
			<td>Fisher</td>
			<td>PRG5711</td>
			<td>Manufactured by Promega</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sybr Safe DNA Gel Stain, 10000x</td>
			<td>Life Technologies/Invitrogen</td>
			<td>S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Wizard SV Gel and PCR Clean-Up System</td>
			<td>Promega</td>
			<td>A9282</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Razor blades, single-edged</td>
			<td>Fisher</td>
			<td>12-640</td>
			<td>Manufactured by Surgical Design</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Thermocycler, PTC-200</td>
			<td>MJ Research</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Microbiology &#38; Cloning reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LB Agar, Miller</td>
			<td>Fisher</td>
			<td>BP1425-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LB Broth, Lennox</td>
			<td>Fisher</td>
			<td>BP1427-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 100mm x 15mm polystyrene petri dishes</td>
			<td>Fisher</td>
			<td>08-757-12</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ampicillin sodium salt</td>
			<td>Sigma-Aldrich</td>
			<td>A9518-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Falcon 14ml Polypropylene round-bottom tubes</td>
			<td>BD Biosciences</td>
			<td>352059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NgoMIV restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0564L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BclI restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0160L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HpaI restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0105L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T4 DNA Ligase, 5U/&#956;L</td>
			<td>Roche</td>
			<td>10799009001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">JM109 competent cells, &#62;10^8 cfu/&#956;g&#160;</td>
			<td>Promega</td>
			<td>L2001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PureYield plasmid miniprep system</td>
			<td>Promega&#160;</td>
			<td>A1222</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Safe Imager 2.0 Blue Light Transilluminator</td>
			<td>Invitrogen</td>
			<td>G6600</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Microfuge 18 centrifuge</td>
			<td>Beckman Coulter</td>
			<td>367160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell culture reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Amphyl cleaner/disinfectant</td>
			<td>Fisher</td>
			<td>22-030-394</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fugene HD, 1 mL</td>
			<td>VWR</td>
			<td>PAE2311</td>
			<td>Manufactured by Promega</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hexadimethrine bromide (Polybrene)</td>
			<td>Sigma-Aldrich</td>
			<td>H9268-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Costar Plates, 6-well, flat</td>
			<td>Fisher</td>
			<td>07-200-83</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Costar Plates, 24-well, flat</td>
			<td>Fisher</td>
			<td>07-200-84</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Costar Plates, 96-well, round</td>
			<td>Fisher</td>
			<td>07-200-95</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flasks, Corning filter top/canted neck, 75 cm^2</td>
			<td>Fisher</td>
			<td>10-126-37</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flasks, Corning filter top/canted neck, 150 cm^2</td>
			<td>Fisher</td>
			<td>10-126-34</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Conical Tubes, 50ml, blue cap</td>
			<td>Fisher</td>
			<td>14-432-22</td>
			<td>Manufactured by BD Biosciences</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Conical Tubes, 15ml, blue cap</td>
			<td>Fisher</td>
			<td>14-959-70C&#160;&#160;</td>
			<td>Manufactured by BD Biosciences</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trypsin-EDTA</td>
			<td>Fisher</td>
			<td>MT25052CI</td>
			<td>Manufactured by Mediatech</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RPMI, 500 ml</td>
			<td>Life Technologies/Invitrogen</td>
			<td>11875-119</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DMEM, 500 ml</td>
			<td>Life Technologies/Invitrogen</td>
			<td>11965-118</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/Streptomycin/Glutamine, 100X</td>
			<td>Life Technologies/Invitrogen</td>
			<td>10378-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS with magnesium and calcium, 500ml</td>
			<td>Life Technologies/Invitrogen</td>
			<td>14040-133</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS without magnesium and calcium</td>
			<td>Life Technologies/Invitrogen</td>
			<td>20012-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sarstedt tubes, assorted colors</td>
			<td>Sarstedt</td>
			<td>72.694.996</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Reservoir Trays for Multichannel, 55ml</td>
			<td>Fisher</td>
			<td>13-681-501</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DEAE-Dextran</td>
			<td>Fisher</td>
			<td>NC9691007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning 96 well clear V bottom tissue culture treated microplate</td>
			<td>Fisher</td>
			<td>07-200-96</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HEPES, 1M Buffer Solution</td>
			<td>Life Technologies/Invitrogen</td>
			<td>15630-080</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FBS, Defined, 500 ml</td>
			<td>Fisher</td>
			<td>SH30070 03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">X-gal</td>
			<td>VWR</td>
			<td>PAV3941</td>
			<td>Manufactured by Promega</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glutaraldehyde, Grade II, 25% in H2O</td>
			<td>Sigma-Aldrich</td>
			<td>G6257-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1M Magnesium chloride solution</td>
			<td>Sigma-Aldrich</td>
			<td>M1028-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Formaldehyde solution, for molecular biology, 36.5%</td>
			<td>Sigma-Aldrich</td>
			<td>F8775-500ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Potassium hexacyanoferrate(II) trihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>P9387-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Potassium hexacyanoferrate(III)</td>
			<td>Sigma-Aldrich</td>
			<td>P8131-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Allegra X15-R centrifuge</td>
			<td>Beckman Coulter</td>
			<td>392932</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TC10 automated cell counter</td>
			<td>Bio-Rad</td>
			<td>1450001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VistaVision inverted microscope</td>
			<td>VWR</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Reverse-Transcriptase Quantification Assay reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">dTTP, [&#945;-33P]- 3000Ci/mmol, 10mCi/ml, 1 mCi</td>
			<td>Perkin-Elmer</td>
			<td>NEG605H001MC</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1M Tris-Cl, pH 8.0</td>
			<td>Life Technologies/Invitrogen</td>
			<td>15568025</td>
			<td>Must be adjusted to pH 7.8 with KOH</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2M potassium chloride (KCl)</td>
			<td>Life Technologies/Invitrogen</td>
			<td>AM9640G</td>
			<td>Adjust to 1M solution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.5M EDTA</td>
			<td>Life Technologies/Invitrogen</td>
			<td>15575-020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nonidet P40</td>
			<td>Roche</td>
			<td style="width:133px;">11333941103</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Polyadenylic acid (Poly rA) potassium salt&#160;</td>
			<td>Midland Reagent Co.</td>
			<td>P-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo d(T) primer&#160;</td>
			<td>Life Technologies/Invitrogen</td>
			<td>18418-012</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dithiothreitol (DTT)</td>
			<td>Sigma-Aldrich</td>
			<td>43815-1G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SR, Super Resolution Phosphor Screen, Small</td>
			<td>Perkin-Elmer</td>
			<td>7001485</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning Costar Thermowell 96 well plate model (M) Polycarbonate</td>
			<td>Fisher</td>
			<td>07-200-245</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning 96 Well Microplate Aluminum Sealing Tape, Nonsterile</td>
			<td>Fisher</td>
			<td>07-200-684</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DE-81 anion exchange paper</td>
			<td>Whatman</td>
			<td>3658-915</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trisodium citrate dihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>S1804-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium Chloride</td>
			<td>Fisher</td>
			<td>S671-3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Autoradiography cassette</td>
			<td>Fisher</td>
			<td>FB-CA-810</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cyclone storage phoshpor screen</td>
			<td>Packard</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

a restriction enzyme based cloning method to assess the in vitro replication capacity of hiv-1 subtype c gag-mj4 chimeric viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

In order to properly execute this protocol, which creates a proviral plasmid capable of assembling fully functional, infectious Gag-MJ4 chimeras, great care must be taken to generate the appropriate PCR amplicons. Determining whether the PCR has generated the appropriately sized gag amplicon is crucial. Products should be within 100 base pairs (bp) of the approximately 1,700 bp amplicon depicted in Figure 1A. The exact length of this fragment will vary depending on the gag gene under st...

Watch this Scientific Journal Video about A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses at JoVE.com

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target ...

a-restriction-enzyme-based-cloning-method-to-assess-vitro-replication

Research

JoVE Journal

Immunology and Infection

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses

In vitro fitness assays are essential tools for determining viral replication fitness for viruses such as HIV-1. Various measurements have been used to extrapolate viral replication fitness, ranging from the number of viral particles per infectious unit, growth rate in cell culture, and relative fitness derived from multiple-cycle growth competition assays. Growth competition assays provide a particularly sensitive measurement of fitness since the viruses are competing for cellular targets under identical growth conditions. There are several experimental factors to consider when conducting growth competition assays, including the multiplicity of infection (MOI), sampling times, and viral detection and fitness calculation methods. Each factor can affect the end result and hence must be considered carefully during the experimental design. The protocol presented here includes steps from constructing a new recombinant HIV-1 clone to performing growth competition assays and analyzing the experimental results. This protocol utilizes experimental parameter values previously shown to yield consistent and robust results. Alternatives are discussed, as some parameters need to be adjusted according to the cell type and viruses being studied. The protocol contains two alternative viral detection methods to provide flexibility as the availability of instruments, reagents and expertise varies between laboratories.

Growth competition between nearly isogenic viruses provides a sensitive measurement for determining relative replication fitness. The protocols described here include the construction of recombinant HIV-1 clones, virus propagation and growth competition and analysis methods optimized to yield sensitive and consistent results.

In vitro fitness assays are essential tools for determining viral replication fitness for viruses such as HIV-1. Various measurements have been used to ...

Intranasal Administration of Recombinant Influenza Vaccines in Chimeric Mouse Models to Study Mucosal Immunity

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the physiological mechanisms that mediate immune responses to vaccines perhaps due to the overall success of vaccination, which has reduced interest into the molecular and physiological mechanisms of vaccine immunity. However, several important human pathogens including influenza virus still pose a challenge for vaccination, and may benefit from immune-based strategies. 
Although influenza reverse genetics has been successfully applied to the generation of live-attenuated influenza vaccines (LAIVs), the addition of molecular tools in vaccine preparations such as tracer components to follow up the kinetics of vaccination in vivo, has not been addressed. In addition, the recent generation of mouse models that allow specific depletion of leukocytes during kinetic studies has opened a window of opportunity to understand the basic immune mechanisms underlying vaccine-elicited protection. Here, we describe how the combination of reverse genetics and chimeric mouse models may help to provide new insights into how vaccines work at physiological and molecular levels, using as example a recombinant, cold-adapted, live-attenuated influenza vaccine (LAIV). We utilized laboratory-generated LAIVs harboring cell tracers as well as competitive bone marrow chimeras (BMCs) to determine the early kinetics of vaccine immunity and the main physiological mechanisms responsible for the initiation of vaccine-specific adaptive immunity. In addition, we show how this technique may facilitate gene function studies in single animals during immune responses to vaccines. We propose that this technique can be applied to improve current prophylactic strategies against pathogens for which urgent medical countermeasures are needed, for example influenza, HIV, Plasmodium, and hemorrhagic fever viruses such as Ebola virus.

There is an overall lack of knowledge about how vaccines work. Here we propose the combined use of reverse genetics and bone marrow chimeric mice to gain insight into the early host immune responses to vaccines with a special focus on dendritic cells and T cell immunity.

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the ...

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the viral capsid (CA) core into the cytoplasm. Subsequently, the viral Reverse Transcriptase (RT), as part of a namesake nucleoprotein complex termed the Reverse Transcription Complex (RTC), converts the viral single-stranded RNA genome into a double-stranded DNA copy (vDNA). This leads to the biogenesis of another nucleoprotein complex, termed the pre-integration complex (PIC), composed of the vDNA and associated virus proteins and host factors. The PIC-associated viral integrase (IN) orchestrates the integration of the vDNA into the host chromosomal DNA in a temporally and spatially regulated two-step process. First, the IN processes the 3&#39; ends of the vDNA in the cytoplasm and, second, after the PIC traffics to the nucleus, it mediates integration of the processed vDNA into the chromosomal DNA. The PICs isolated from target cells acutely infected with HIV-1 are functional in vitro, as they are competent to integrate the associated vDNA into an exogenously added heterologous target DNA. Such PIC-based in vitro integration assays have significantly contributed to delineating the mechanistic details of retroviral integration and to discovering IN inhibitors. In this report, we elaborate upon an updated HIV-1 PIC assay that employs a nested real-time quantitative Polymerase Chain Reaction (qPCR)-based strategy for measuring the in vitro integration activity of isolated native PICs.

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can characterize thousands of proteins at a time. These powerful techniques allow us to have a systemic understanding of cellular changes, especially when cells are subjected to various stimuli, such as infections, stresses, and specific test conditions. Even with recent developments, analyzing the exosomal proteome is time-consuming and often involves complex methodologies. In addition, the resultant large dataset often needs robust and streamlined analysis in order for researchers to perform further downstream studies. Here, we describe a SILAC-based protocol for characterizing the exosomal proteome when cells are infected with HIV-1. The method is based on simple isotope labeling, isolation of exosomes from differentially labeled cells, and mass spectrometry analysis. This is followed by detailed data mining and bioinformatics analysis of the proteomic hits. The resultant datasets and candidates are easy to understand and often offer a wealth of information that is useful for downstream analysis. This protocol is applicable to other subcellular compartments and a wide range of test conditions.

Here, we describe a quantitative proteomics method using the technique of stable isotope labeling by amino acids in cell culture (SILAC) to analyze the effects of HIV-1 infection on host exosomal proteomes. This protocol can be easily adapted to cells under different stress or infection conditions.

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can ...

Fluorescence-based Neuraminidase Inhibition Assay to Assess the Susceptibility of Influenza Viruses to The Neuraminidase Inhibitor Class of Antivirals

The neuraminidase (NA) inhibitors are the only class of antivirals approved for the treatment and prophylaxis of influenza that are effective against currently circulating strains. In addition to their use in treating seasonal influenza, the NA inhibitors have been stockpiled by a number of countries for use in the event of a pandemic. It is therefore important to monitor the susceptibility of circulating influenza viruses to this class of antivirals. There are different types of assays that can be used to assess the susceptibility of influenza viruses to the NA inhibitors, but the enzyme inhibition assays using either a fluorescent substrate or a chemiluminescent substrate are the most widely used and recommended. This protocol describes the use of a fluorescence-based assay to assess influenza virus susceptibility to NA inhibitors. The assay is based on the NA enzyme cleaving the 2&#8242;-(4-Methylumbelliferyl)-&#945;-D-N-acetylneuraminic acid (MUNANA) substrate to release the fluorescent product 4-methylumbelliferone (4-MU). Therefore, the inhibitory effect of an NA inhibitor on the influenza virus NA is determined based on the concentration of the NA inhibitor that is required to reduce 50% of the NA activity, given as an IC50 value.

We describe the use of a phenotypic fluorescence-based neuraminidase inhibition assay to assess the susceptibility of influenza A and B viruses to the neuraminidase inhibitor class of antivirals.

The neuraminidase (NA) inhibitors are the only class of antivirals approved for the treatment and prophylaxis of influenza that are effective against ...