The investigators thank all the volunteers in Zambia who participated in this study and all the staff at the Zambia Emory HIV Research Project in Lusaka who made this study possible. The investigators would like to thank Jon Allen, Smita Chavan, and Mackenzie Hurlston for technical assistance and sample management. We would also like to thank Dr. Mark Brockman for his discussions and generous donation of the GXR25 cells.
This study was funded by R01 AI64060 and R37 AI51231 (EH) and the International AIDS Vaccine Initiative. This work was made possible in part by the generous support of the American people through the United States Agency for International Development (USAID).&#160;The contents are the responsibility of the study authors and do not necessarily reflect the views of USAID or the United States Government. This work also was supported, in part, by the Virology Core at the Emory Center for AIDS Research (Grant P30 AI050409). DC and JP were supported in part by Action Cycling Fellowships. This work was supported in part by the Yerkes National Primate Research Center base grant (2P51RR000165-51). This project was also funded in part by the National Center for Research Resources P51RR165 and is currently supported by the Office of Research Infrastructure Programs/OD P51OD11132.

The authors have nothing to disclose.

A causa della lunghezza e la natura tecnica di questo protocollo, ci sono diversi passaggi che sono fondamentali sia per la costruzione di successo di plasmidi chimerici Gag-MJ4 nonché per la quantificazione della capacità di replicazione virale. Anche se la strategia di clonazione basata enzima di restrizione per l&#39;introduzione di geni gag estera in MJ4 descritto in questo protocollo ha numerosi vantaggi rispetto ai metodi basati ricombinazione utilizzati in precedenza, il protocollo può essere tecnicam...

Determinare l&#39;host e le caratteristiche virali che influenzano HIV-1 patogenesi e nella progressione della malattia è fondamentale per la progettazione razionale di vaccini. La risposta immunitaria cellulare è un componente chiave della risposta immunitaria umana HIV-1. Linfociti T citotossici (CTL) sono necessari per il controllo iniziale della viremia acuta, e permettono l&#39;host di stabilire uno stato di equilibrio (set point) carica virale 1,2. Deplezione sperimentale di queste cellule effettrici si traduce in perdita di controllo virale 3,4. Nonostante questo, sfuggono le mutazioni sorgono all&#39;interno del genoma virale che sovvertire CTL riconoscimento delle cellule infettate da virus 5-9. Alcuni alleli HLA sono stati associati con una carica virale inferiore e la progressione della malattia più lenta tra cui B * 57, B * 27 e B * 81 10-15. Parte del beneficio protettivo di alleli HLA di classe I può essere attribuito al fatto che esse mirano regioni funzionalmente vincolati del genoma come Gage selezionare per le mutazioni di fuga che riducono la capacità del virus di replicarsi in vitro 16-21. Sebbene fuga dal sistema immunitario cellulare è vantaggioso per il virus nel contesto della classe I allele HLA selezione, l&#39;effetto di queste mutazioni può avere conseguenze differenziali per l&#39;host dopo la trasmissione a un HLA-non corrispondenti individuale 22,23. Pertanto, la comprensione degli effetti delle mutazioni trasmesse fuga HLA-associato sulla capacità di replicazione virale sarà importante per migliorare la nostra comprensione dei primi HIV-1 patogenesi. Sebbene siano stati compiuti molti progressi per identificare e caratterizzare i difetti di fitness di mutazioni di fuga individuali associati con particolare HLA di classe I alleli 24-29, naturalmente HIV-1 isolati sono impronte uniche e complesse di polimorfismi HLA-associato, probabilmente derivanti dalla HLA pressione immunitaria mediata di diversa provenienza immunogenetici 30. In apanalisi revious, Goepfert et al. ha dimostrato che un accumulo di mutazioni HLA-associati nelle sequenze Gag trasmessi derivate da 88 Zambians infezione acuta era associato ad una riduzione della carica virale set point 31. Questo suggerisce che la trasmissione di mutazioni deleterie di fuga, in particolare in Gag, ai destinatari HLA-non corrispondenti fornisce un beneficio clinico, e può essere dovuto ad attenuare la replicazione virale. Andando avanti, è imperativo studiare come complesso combinazioni di polimorfismi Gag all&#39;interno isolati naturali lavorano in concerto per definire le caratteristiche del virus trasmesso come la capacità di replicazione, e come la replicazione precoce potrebbe a sua volta influenzare HIV-1 parametri clinici e di fase tardo- patogenesi. Brockman et al. Prima dimostrato un legame tra la capacità di replicazione di sequenze gag-pro isolato durante l&#39;infezione fase cronica e la carica virale sia nel sottotipo C e le infezioni B32-35. L&#39;approccio sperimentale presentato in questi studi, anche se adeguato per esaminare la capacità di replicazione in vitro di sequenze derivate da individui cronicamente infetti, ha diversi avvertimenti tecnici e limitazioni che rendere lo studio di HIV-1 capacità replicativa nel sottotipo C individui con infezione acuta difficile. Questo metodo si basa sulla ricombinazione di base di popolazione sequenze PCR-amplificate nel sottotipo B NL4-3 provirus, che è stato derivato in parte da LAV, un laboratorio adattato virus magazzino 36. Generazione di virus è stato realizzato da co-trasfezione di una base-CEM linea di cellule T 37 con ampliconi della PCR e digerito delta- NL4-3 DNA gag-pro. Questo metodo richiede l&#39;escrescenza di virus in un periodo di settimane o mesi, potenzialmente alterando la natura del virus magazzino recuperati rispetto ai quasispecie virale in vivo, e quindi alterare la misurazione della capacità di replicazione in vitro. Questo metodo is più appropriato per studiare gli individui cronicamente infette, dove seleziona efficacemente per virus con la più alta capacità replicativa, e dove clonazione numerose varianti virali differenti da un gran numero di individui cronicamente infette è piuttosto intenso lavoro e quindi non fattibile. Tuttavia, all&#39;interno di un individuo infetto acutamente, ci sono generalmente 01:59 varianti presenti, ed eliminando così il rischio di inclinazione della natura del virus magazzino recuperato, attraverso pressioni della selezione in vitro, consente una valutazione più accurata della capacità di replicazione in vitro. In secondo luogo, questo metodo richiede ricombinazione sottotipo C sequenze gag-pro in un sottotipo B dorsale derivato, e potrebbe introdurre distorsioni backbone incompatibilità nell&#39;analisi. A causa di queste limitazioni, un gran numero di sequenze devono essere analizzati al fine di superare eventuali distorsioni introdotte potenziali. Qui si descrive un appro sperimentale alternativaach appropriata per studiare le sequenze derivate dal sottotipo C individui con infezione acuta. Usiamo una strategia di clonazione basata enzima di restrizione per introdurre il gene gag derivato dal acuti momenti di infezione da HIV-1 sottotipo C individui infetti nella spina dorsale provirale sottotipo C, MJ4. L&#39;uso di MJ4 come una spina dorsale comune in cui clonare i geni gag è cruciale per l&#39;analisi di sottotipo C sequenze derivate. MJ4 è derivato da un isolato primario 38, e quindi sarebbe meno probabilità di introdurre bias dovuto al sottotipo incompatibilità tra la spina dorsale e il gene gag. Inoltre, l&#39;approccio di clonazione mediante restrizione basata enzima permette la provirale costruisce essere trasfettate direttamente nelle cellule 293T, e per il recupero di un virus magazzino clonale identica alla sequenza di gag clonata. Il metodo presentato qui di seguito è un metodo ad alta produttività per la valutazione della capacità di replicazione del sottotipo C derivato Gag-MJ4virus chimerici. Trasfezione in cellule 293T è semplice e il recupero di virus richiede solo tre giorni. In vitro la capacità di replica viene analizzato sulla stessa base linea di T-cellule CEM-CCR5 creato da Brockman et al. 37, ma con importanti modifiche di protocollo necessario per la replica di successo di sottotipo C MJ4 virus chimerici. L&#39;utilizzo di una linea di T-cella appropriata piuttosto che PBMC permette un gran numero di sottotipo C virus MJ4-chimerico per essere testati con alto dosaggio riproducibilità. Infine, utilizzando un radiomarcato test trascrittasi inversa per la quantificazione del virus nel surnatante è più conveniente rispetto all&#39;utilizzo di kit ELISA disponibile in commercio P24. Inoltre, dà una gamma dinamica superiore, che era importante per rilevare i virus male e altamente replicare all&#39;interno dello stesso test e per la rilevazione di sottili differenze nella replica tra gli isolati. In conclusione, il metodo qui presentato ha permessolo studio approfondito della capacità di replicazione di sequenze gag derivati ​​da HIV-1 sottotipo C acutamente infettato individui dallo Zambia, e come scritto, potrebbe anche essere esteso a studiare altri sottotipo C popolazioni infettato. È stato osservato un alto grado di variazione capacità di replica tra i diversi isolati Gag. Inoltre, siamo stati in grado di dimostrare un&#39;associazione statistica tra la capacità di replicazione del Gag trasmessi e set point carica virale così come con CD4 + declino nel corso di un periodo di tre anni 39. Tali risultati sottolineano l&#39;importanza di studiare le caratteristiche virali come trasmesso, come la capacità di replica, interagiscono con il sistema immunitario ospite di influenzare patogenesi durante l&#39;infezione precoce e saranno parte integrante per lo sviluppo di interventi di vaccini efficaci e trattamento.

<table border="0" cellpadding="0" cellspacing="0" width="1024">
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:444px;">Name of the Reagent</td>
			<td style="width:195px;">Company</td>
			<td style="width:133px;">Catalogue number</td>
			<td style="width:252px;">Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GOF: 5&#39; ATTTGACTAGCGGAGGCTAGAA 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VifOR: 5&#39; TTCTACGGAGACTCCATGACCC 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GagInnerF1: 
			5&#39; AGGCTAGAAGGAGAGAGATG 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BclIDegRev2: 
			5&#39; AGTATTTGATCATAYTGYYTYACTTTR 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MJ4For1b: 5&#39; CGAAATCGGCAAAATCCC 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MJ4Rev: 5&#39; CCCATCTCTCTCCTTCTAGC 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BclIRev: 5&#39; TCTATAAGTATTTGATCATACTGTCTT 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GagF2: 5&#39; GGGACATCAAGCAGCCAT 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">For3: 5&#39; CTAGGAAAAAGGGCTGTTGGAAATG 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GagR6: 5&#39; CTGTATCATCTGCTCCTG 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rev3: 5&#39; GACAGGGCTATACATTCTTACTAT 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rev1: 5&#39; AATTTTTCCAGCTCCCTGCTTGCCCA 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CoolRack PCR 96 XT</td>
			<td>Biocision</td>
			<td>BCS-529</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CoolRack M15</td>
			<td>Biocision</td>
			<td>BCS-125</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nuclease free water</td>
			<td>Fisher</td>
			<td>SH30538FS</td>
			<td>Manufactured by Hyclone</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAamp Viral RNA Mini Kit</td>
			<td>Qiagen</td>
			<td style="width:133px;">52906</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Simport PCR 8 Strip Tubes, Blue (Flat Cap)</td>
			<td>Daigger</td>
			<td>EF3647BX</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SuperScript III one-step RT-PCR system</td>
			<td>Life Technologies/Invitrogen</td>
			<td>12574035</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phusion Hot-start II DNA polymerase</td>
			<td>Fisher</td>
			<td>F-549L&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR Nucleotide Mix</td>
			<td>Roche</td>
			<td>4638956001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agarose, high gel strength</td>
			<td>Fisher</td>
			<td>50-213-128</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TAE 10X</td>
			<td>Life Technologies/Invitrogen</td>
			<td>AM9869</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Promega 1kb DNA ladder</td>
			<td>Fisher</td>
			<td>PRG5711</td>
			<td>Manufactured by Promega</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sybr Safe DNA Gel Stain, 10000x</td>
			<td>Life Technologies/Invitrogen</td>
			<td>S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Wizard SV Gel and PCR Clean-Up System</td>
			<td>Promega</td>
			<td>A9282</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Razor blades, single-edged</td>
			<td>Fisher</td>
			<td>12-640</td>
			<td>Manufactured by Surgical Design</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Thermocycler, PTC-200</td>
			<td>MJ Research</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Microbiology &#38; Cloning reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LB Agar, Miller</td>
			<td>Fisher</td>
			<td>BP1425-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LB Broth, Lennox</td>
			<td>Fisher</td>
			<td>BP1427-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 100mm x 15mm polystyrene petri dishes</td>
			<td>Fisher</td>
			<td>08-757-12</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ampicillin sodium salt</td>
			<td>Sigma-Aldrich</td>
			<td>A9518-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Falcon 14ml Polypropylene round-bottom tubes</td>
			<td>BD Biosciences</td>
			<td>352059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NgoMIV restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0564L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BclI restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0160L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HpaI restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0105L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T4 DNA Ligase, 5U/&#956;L</td>
			<td>Roche</td>
			<td>10799009001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">JM109 competent cells, &#62;10^8 cfu/&#956;g&#160;</td>
			<td>Promega</td>
			<td>L2001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PureYield plasmid miniprep system</td>
			<td>Promega&#160;</td>
			<td>A1222</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Safe Imager 2.0 Blue Light Transilluminator</td>
			<td>Invitrogen</td>
			<td>G6600</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Microfuge 18 centrifuge</td>
			<td>Beckman Coulter</td>
			<td>367160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell culture reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Amphyl cleaner/disinfectant</td>
			<td>Fisher</td>
			<td>22-030-394</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fugene HD, 1 mL</td>
			<td>VWR</td>
			<td>PAE2311</td>
			<td>Manufactured by Promega</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hexadimethrine bromide (Polybrene)</td>
			<td>Sigma-Aldrich</td>
			<td>H9268-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Costar Plates, 6-well, flat</td>
			<td>Fisher</td>
			<td>07-200-83</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Costar Plates, 24-well, flat</td>
			<td>Fisher</td>
			<td>07-200-84</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Costar Plates, 96-well, round</td>
			<td>Fisher</td>
			<td>07-200-95</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flasks, Corning filter top/canted neck, 75 cm^2</td>
			<td>Fisher</td>
			<td>10-126-37</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flasks, Corning filter top/canted neck, 150 cm^2</td>
			<td>Fisher</td>
			<td>10-126-34</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Conical Tubes, 50ml, blue cap</td>
			<td>Fisher</td>
			<td>14-432-22</td>
			<td>Manufactured by BD Biosciences</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Conical Tubes, 15ml, blue cap</td>
			<td>Fisher</td>
			<td>14-959-70C&#160;&#160;</td>
			<td>Manufactured by BD Biosciences</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trypsin-EDTA</td>
			<td>Fisher</td>
			<td>MT25052CI</td>
			<td>Manufactured by Mediatech</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RPMI, 500 ml</td>
			<td>Life Technologies/Invitrogen</td>
			<td>11875-119</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DMEM, 500 ml</td>
			<td>Life Technologies/Invitrogen</td>
			<td>11965-118</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/Streptomycin/Glutamine, 100X</td>
			<td>Life Technologies/Invitrogen</td>
			<td>10378-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS with magnesium and calcium, 500ml</td>
			<td>Life Technologies/Invitrogen</td>
			<td>14040-133</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS without magnesium and calcium</td>
			<td>Life Technologies/Invitrogen</td>
			<td>20012-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sarstedt tubes, assorted colors</td>
			<td>Sarstedt</td>
			<td>72.694.996</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Reservoir Trays for Multichannel, 55ml</td>
			<td>Fisher</td>
			<td>13-681-501</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DEAE-Dextran</td>
			<td>Fisher</td>
			<td>NC9691007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning 96 well clear V bottom tissue culture treated microplate</td>
			<td>Fisher</td>
			<td>07-200-96</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HEPES, 1M Buffer Solution</td>
			<td>Life Technologies/Invitrogen</td>
			<td>15630-080</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FBS, Defined, 500 ml</td>
			<td>Fisher</td>
			<td>SH30070 03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">X-gal</td>
			<td>VWR</td>
			<td>PAV3941</td>
			<td>Manufactured by Promega</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glutaraldehyde, Grade II, 25% in H2O</td>
			<td>Sigma-Aldrich</td>
			<td>G6257-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1M Magnesium chloride solution</td>
			<td>Sigma-Aldrich</td>
			<td>M1028-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Formaldehyde solution, for molecular biology, 36.5%</td>
			<td>Sigma-Aldrich</td>
			<td>F8775-500ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Potassium hexacyanoferrate(II) trihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>P9387-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Potassium hexacyanoferrate(III)</td>
			<td>Sigma-Aldrich</td>
			<td>P8131-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Allegra X15-R centrifuge</td>
			<td>Beckman Coulter</td>
			<td>392932</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TC10 automated cell counter</td>
			<td>Bio-Rad</td>
			<td>1450001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VistaVision inverted microscope</td>
			<td>VWR</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Reverse-Transcriptase Quantification Assay reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">dTTP, [&#945;-33P]- 3000Ci/mmol, 10mCi/ml, 1 mCi</td>
			<td>Perkin-Elmer</td>
			<td>NEG605H001MC</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1M Tris-Cl, pH 8.0</td>
			<td>Life Technologies/Invitrogen</td>
			<td>15568025</td>
			<td>Must be adjusted to pH 7.8 with KOH</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2M potassium chloride (KCl)</td>
			<td>Life Technologies/Invitrogen</td>
			<td>AM9640G</td>
			<td>Adjust to 1M solution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.5M EDTA</td>
			<td>Life Technologies/Invitrogen</td>
			<td>15575-020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nonidet P40</td>
			<td>Roche</td>
			<td style="width:133px;">11333941103</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Polyadenylic acid (Poly rA) potassium salt&#160;</td>
			<td>Midland Reagent Co.</td>
			<td>P-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo d(T) primer&#160;</td>
			<td>Life Technologies/Invitrogen</td>
			<td>18418-012</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dithiothreitol (DTT)</td>
			<td>Sigma-Aldrich</td>
			<td>43815-1G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SR, Super Resolution Phosphor Screen, Small</td>
			<td>Perkin-Elmer</td>
			<td>7001485</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning Costar Thermowell 96 well plate model (M) Polycarbonate</td>
			<td>Fisher</td>
			<td>07-200-245</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning 96 Well Microplate Aluminum Sealing Tape, Nonsterile</td>
			<td>Fisher</td>
			<td>07-200-684</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DE-81 anion exchange paper</td>
			<td>Whatman</td>
			<td>3658-915</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trisodium citrate dihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>S1804-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium Chloride</td>
			<td>Fisher</td>
			<td>S671-3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Autoradiography cassette</td>
			<td>Fisher</td>
			<td>FB-CA-810</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cyclone storage phoshpor screen</td>
			<td>Packard</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

a restriction enzyme based cloning method to assess the in vitro replication capacity of hiv-1 subtype c gag-mj4 chimeric viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

Per eseguire correttamente questo protocollo, che crea un plasmide provirale in grado di assemblare completamente funzionale, infettive chimere Gag-MJ4, grande cura deve essere presa per generare le opportune ampliconi della PCR. Determinare se la PCR ha generato all&#39;amplicon bavaglio di dimensioni appropriate è fondamentale. I prodotti dovrebbero essere meno di 100 paia di basi (bp) del amplicone circa 1.700 bp rappresentato nella figura 1A. La lunghezza esatta di questo frammento varier?...

Watch this Scientific Journal Video about A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses at JoVE.com

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

Un enzima di restrizione metodo basato clonazione per valutare l&#39;<em&gt; In vitro</em&gt; Replica Capacità di HIV-1 Sottotipo C Gag-MJ4 chimerici virus

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target ...

a-restriction-enzyme-based-cloning-method-to-assess-vitro-replication

Research

JoVE Journal

Immunology and Infection

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

15.5K Views.  Emory University. HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.