The investigators thank all the volunteers in Zambia who participated in this study and all the staff at the Zambia Emory HIV Research Project in Lusaka who made this study possible. The investigators would like to thank Jon Allen, Smita Chavan, and Mackenzie Hurlston for technical assistance and sample management. We would also like to thank Dr. Mark Brockman for his discussions and generous donation of the GXR25 cells.
This study was funded by R01 AI64060 and R37 AI51231 (EH) and the International AIDS Vaccine Initiative. This work was made possible in part by the generous support of the American people through the United States Agency for International Development (USAID).&#160;The contents are the responsibility of the study authors and do not necessarily reflect the views of USAID or the United States Government. This work also was supported, in part, by the Virology Core at the Emory Center for AIDS Research (Grant P30 AI050409). DC and JP were supported in part by Action Cycling Fellowships. This work was supported in part by the Yerkes National Primate Research Center base grant (2P51RR000165-51). This project was also funded in part by the National Center for Research Resources P51RR165 and is currently supported by the Office of Research Infrastructure Programs/OD P51OD11132.

The authors have nothing to disclose.

Debido a la longitud y el carácter técnico de este protocolo, hay varios pasos que son fundamentales tanto para la construcción exitosa de plásmidos Gag-MJ4 quiméricos, así como para la cuantificación de la capacidad de replicación viral. Aunque la estrategia de clonación basado enzima de restricción para la introducción de genes gag extranjera en MJ4 descrito en este protocolo tiene numerosas ventajas sobre los métodos basados ​​en la recombinación utilizadas anteriormente, el protocolo puede ...

Determinar el host y características virales que influyen en el VIH-1 patogénesis y progresión de la enfermedad es de suma importancia para el diseño racional de vacunas. La respuesta inmune celular es un componente clave de la respuesta inmune humana a la infección VIH-1. Los linfocitos T citotóxicos (CTL) son necesarios para el control inicial de la viremia aguda, y permiten al ordenador establecer un estado de equilibrio (set point) de la carga viral 1,2. Experimental agotamiento de estas células efectoras se traduce en la pérdida de control viral 3,4. A pesar de esto, escapan mutaciones surgen dentro del genoma viral que subvertir reconocimiento de CTL de las células infectadas viralmente 5-9. Ciertos alelos HLA se han asociado con cargas virales más bajas y más lenta progresión de la enfermedad, incluido el B * 57, B * 27 B * 81 y 10-15. Parte de los beneficios de protección de los alelos HLA de clase I se puede atribuir al hecho de que se tengan en regiones funcionalmente limitados del genoma, tales como Gagy seleccionar para mutaciones de escape que disminuyen la capacidad del virus para replicarse in vitro 16-21. Aunque escape del sistema inmune celular es beneficioso para el virus en el contexto de la selección de HLA de clase I alelo, el efecto de estas mutaciones puede tener consecuencias diferenciales para el huésped tras la transmisión a un individuo HLA no coincidentes 22,23. Por lo tanto, la comprensión de los efectos de la transmisión mutaciones de escape HLA-asociada a la capacidad de replicación viral será importante para mejorar nuestra comprensión de los principios de VIH-1 patogénesis. Si bien se ha avanzado mucho para identificar y caracterizar los defectos de la aptitud de mutaciones de escape individuales asociados a una clase de HLA I alelos 24-29, de origen natural aislados HIV-1 han huellas únicas y complejas de los polimorfismos asociados-HLA, probablemente derivado de la HLA presión inmune mediada de diferentes orígenes immunogenetic 30. En apanálisis de la mera existencia, Goepfert et al. mostró que una acumulación de mutaciones asociadas a HLA en las secuencias de la mordaza de transmisión derivados de 88 Zambianos infectadas de forma aguda se asoció con una reducción en la carga viral del punto de ajuste 31. Esto sugirió que la transmisión de mutaciones de escape nocivos, específicamente en Gag, a los destinatarios-HLA no coincidentes proporciona un beneficio clínico, y puede ser debido a la replicación viral atenuada. De cara al futuro, es imprescindible para estudiar cómo las combinaciones de los polimorfismos de la mordaza del complejo dentro de los aislamientos naturales trabajan en conjunto para definir las características del virus de transmisión, tales como la capacidad de replicación, y cómo la replicación temprana podría a su vez afectar el VIH-1 parámetros clínicos y de la última etapa patogénesis. Brockman et al. Demostró por primera vez un vínculo entre la capacidad de replicación de secuencias-gag pro aislado durante la infección etapa crónica y la carga viral tanto en el subtipo C y las infecciones B32-35. El enfoque experimental se presenta en estos estudios, aunque apropiado para examinar la capacidad de replicación in vitro de secuencias derivadas de individuos con infección crónica, tiene varias advertencias y limitaciones técnicas que hacen que estudian el VIH-1 capacidad replicativa en el subtipo C individuos infectados de forma aguda difícil. Este método se basa en la recombinación de secuencias basadas población amplificados por PCR en el subtipo B NL4-3 provirus, que se deriva en parte de LAV, un laboratorio adaptado stock de virus 36. Generación de virus se realizó por co-transfección de una línea de células T CEM basada en 37 con amplicones de PCR y se digirió ADN NL4-3 delta pro-gag. Este método requiere la consecuencia de virus durante un período de semanas a meses, potencialmente sesgar la naturaleza del stock de virus recuperado en relación con las cuasiespecies virales in vivo, y por lo tanto alterar la medición de la capacidad de replicación in vitro. Este método is más apropiado para el estudio de los individuos infectados crónicamente, donde se selecciona de manera efectiva para el virus de la más alta capacidad replicativa, y donde la clonación de numerosos diferentes variantes virales a partir de un gran número de individuos infectados crónicamente es bastante mano de obra intensiva y por lo tanto no es factible. Sin embargo, dentro de un individuo infectado de forma aguda, hay generalmente uno y cincuenta y nueve variantes presentes, y eliminando así el riesgo de sesgo de la naturaleza del stock de virus recuperado, a través de presiones de selección in vitro, permite una evaluación más precisa de la capacidad de replicación in vitro. En segundo lugar, este método requiere la recombinación de secuencias gag-pro subtipo C en una columna vertebral derivada subtipo B, y podría introducir sesgos de incompatibilidad columna vertebral en el análisis. Debido a estas limitaciones, un gran número de secuencias deben ser analizados con el fin de superar las posibles sesgos introducidos. Aquí describimos una apro experimental alternativoach apropiada para el estudio de secuencias derivadas del subtipo C individuos con infección aguda. Utilizamos una estrategia de clonación basada en la enzima de restricción para introducir el gen gag derivado de puntos de tiempo infección aguda de los individuos infectados por VIH-1 subtipo C en la cadena principal proviral subtipo C, MJ4. El uso de MJ4 como una red troncal común en el que para clonar genes gag es crucial para el análisis de subtipo C secuencias derivadas. MJ4 se deriva de un aislado primario 38, y por lo tanto sería menos probable que introducir un sesgo debido a la incompatibilidad subtipo entre la columna vertebral y el gen gag. Además, el enfoque de la utilización de la clonación restricción basada enzima permite la proviral construye a transfectar directamente en células 293T, y para la recuperación de un virus clonal de stock idéntica a la secuencia gag clonado. El método presentado a continuación es un método de alto rendimiento para evaluar la capacidad de replicación del subtipo C derivada Gag-MJ4virus quiméricos. La transfección en células 293T es sencillo y recuperación de virus toma sólo tres días. In vitro la capacidad de replicación se ensayó en la misma línea de células T basado CEM-CCR5 creado por Brockman et al. 37, pero utilizando importantes modificaciones de protocolo necesaria para la replicación exitosa del subtipo C MJ4 virus quiméricos. El uso de una línea de células T apropiada en lugar de PBMC permite un gran número de virus quimérico MJ4 subtipo C de la prueba con alta reproducibilidad del ensayo. Por último, utilizando un ensayo radiomarcado de la transcriptasa inversa para la cuantificación de virus en el sobrenadante es más rentable que el uso de kits de ELISA de p24 disponibles comercialmente. También le da un rango dinámico más alto, lo cual era importante para la detección de los virus de mal y altamente replican dentro del mismo ensayo y para detectar diferencias sutiles en la replicación entre los aislados. En conclusión, el método que aquí se presenta ha permitidoel estudio en profundidad de la capacidad de replicación de secuencias gag derivados de VIH-1 subtipo C infecta de forma aguda las personas de Zambia, y tal como está escrita, también podría ampliarse para estudiar otro subtipo C poblaciones infectadas. Se observó un alto grado de variación en las capacidades de replicación entre los diferentes aislados de la mordaza. Además, hemos sido capaces de demostrar una asociación estadística entre la capacidad de replicación del Gag transmitida y el punto de ajuste de la carga viral, así como con CD4 + descenso durante un período de tres años 39. Estos resultados destacan la importancia de estudiar las características virales cómo transmitidos, tales como la capacidad de replicación, interactúan con el sistema inmune del huésped para influir en la patogénesis durante la infección temprana y serán integrales para el desarrollo de intervenciones de vacunas eficaces, así como el tratamiento.

<table border="0" cellpadding="0" cellspacing="0" width="1024">
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:444px;">Name of the Reagent</td>
			<td style="width:195px;">Company</td>
			<td style="width:133px;">Catalogue number</td>
			<td style="width:252px;">Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GOF: 5&#39; ATTTGACTAGCGGAGGCTAGAA 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VifOR: 5&#39; TTCTACGGAGACTCCATGACCC 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GagInnerF1: 
			5&#39; AGGCTAGAAGGAGAGAGATG 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BclIDegRev2: 
			5&#39; AGTATTTGATCATAYTGYYTYACTTTR 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MJ4For1b: 5&#39; CGAAATCGGCAAAATCCC 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MJ4Rev: 5&#39; CCCATCTCTCTCCTTCTAGC 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BclIRev: 5&#39; TCTATAAGTATTTGATCATACTGTCTT 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GagF2: 5&#39; GGGACATCAAGCAGCCAT 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">For3: 5&#39; CTAGGAAAAAGGGCTGTTGGAAATG 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GagR6: 5&#39; CTGTATCATCTGCTCCTG 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rev3: 5&#39; GACAGGGCTATACATTCTTACTAT 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rev1: 5&#39; AATTTTTCCAGCTCCCTGCTTGCCCA 3&#39;</td>
			<td>IDT DNA</td>
			<td>Custom Oligo</td>
			<td>25nmol, standard desalt</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CoolRack PCR 96 XT</td>
			<td>Biocision</td>
			<td>BCS-529</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CoolRack M15</td>
			<td>Biocision</td>
			<td>BCS-125</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nuclease free water</td>
			<td>Fisher</td>
			<td>SH30538FS</td>
			<td>Manufactured by Hyclone</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAamp Viral RNA Mini Kit</td>
			<td>Qiagen</td>
			<td style="width:133px;">52906</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Simport PCR 8 Strip Tubes, Blue (Flat Cap)</td>
			<td>Daigger</td>
			<td>EF3647BX</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SuperScript III one-step RT-PCR system</td>
			<td>Life Technologies/Invitrogen</td>
			<td>12574035</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phusion Hot-start II DNA polymerase</td>
			<td>Fisher</td>
			<td>F-549L&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR Nucleotide Mix</td>
			<td>Roche</td>
			<td>4638956001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agarose, high gel strength</td>
			<td>Fisher</td>
			<td>50-213-128</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TAE 10X</td>
			<td>Life Technologies/Invitrogen</td>
			<td>AM9869</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Promega 1kb DNA ladder</td>
			<td>Fisher</td>
			<td>PRG5711</td>
			<td>Manufactured by Promega</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sybr Safe DNA Gel Stain, 10000x</td>
			<td>Life Technologies/Invitrogen</td>
			<td>S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Wizard SV Gel and PCR Clean-Up System</td>
			<td>Promega</td>
			<td>A9282</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Razor blades, single-edged</td>
			<td>Fisher</td>
			<td>12-640</td>
			<td>Manufactured by Surgical Design</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Thermocycler, PTC-200</td>
			<td>MJ Research</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Microbiology &#38; Cloning reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LB Agar, Miller</td>
			<td>Fisher</td>
			<td>BP1425-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LB Broth, Lennox</td>
			<td>Fisher</td>
			<td>BP1427-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 100mm x 15mm polystyrene petri dishes</td>
			<td>Fisher</td>
			<td>08-757-12</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ampicillin sodium salt</td>
			<td>Sigma-Aldrich</td>
			<td>A9518-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Falcon 14ml Polypropylene round-bottom tubes</td>
			<td>BD Biosciences</td>
			<td>352059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NgoMIV restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0564L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BclI restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0160L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HpaI restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0105L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T4 DNA Ligase, 5U/&#956;L</td>
			<td>Roche</td>
			<td>10799009001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">JM109 competent cells, &#62;10^8 cfu/&#956;g&#160;</td>
			<td>Promega</td>
			<td>L2001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PureYield plasmid miniprep system</td>
			<td>Promega&#160;</td>
			<td>A1222</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Safe Imager 2.0 Blue Light Transilluminator</td>
			<td>Invitrogen</td>
			<td>G6600</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Microfuge 18 centrifuge</td>
			<td>Beckman Coulter</td>
			<td>367160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell culture reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Amphyl cleaner/disinfectant</td>
			<td>Fisher</td>
			<td>22-030-394</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fugene HD, 1 mL</td>
			<td>VWR</td>
			<td>PAE2311</td>
			<td>Manufactured by Promega</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hexadimethrine bromide (Polybrene)</td>
			<td>Sigma-Aldrich</td>
			<td>H9268-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Costar Plates, 6-well, flat</td>
			<td>Fisher</td>
			<td>07-200-83</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Costar Plates, 24-well, flat</td>
			<td>Fisher</td>
			<td>07-200-84</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Costar Plates, 96-well, round</td>
			<td>Fisher</td>
			<td>07-200-95</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flasks, Corning filter top/canted neck, 75 cm^2</td>
			<td>Fisher</td>
			<td>10-126-37</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flasks, Corning filter top/canted neck, 150 cm^2</td>
			<td>Fisher</td>
			<td>10-126-34</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Conical Tubes, 50ml, blue cap</td>
			<td>Fisher</td>
			<td>14-432-22</td>
			<td>Manufactured by BD Biosciences</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Conical Tubes, 15ml, blue cap</td>
			<td>Fisher</td>
			<td>14-959-70C&#160;&#160;</td>
			<td>Manufactured by BD Biosciences</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trypsin-EDTA</td>
			<td>Fisher</td>
			<td>MT25052CI</td>
			<td>Manufactured by Mediatech</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RPMI, 500 ml</td>
			<td>Life Technologies/Invitrogen</td>
			<td>11875-119</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DMEM, 500 ml</td>
			<td>Life Technologies/Invitrogen</td>
			<td>11965-118</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/Streptomycin/Glutamine, 100X</td>
			<td>Life Technologies/Invitrogen</td>
			<td>10378-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS with magnesium and calcium, 500ml</td>
			<td>Life Technologies/Invitrogen</td>
			<td>14040-133</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS without magnesium and calcium</td>
			<td>Life Technologies/Invitrogen</td>
			<td>20012-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sarstedt tubes, assorted colors</td>
			<td>Sarstedt</td>
			<td>72.694.996</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Reservoir Trays for Multichannel, 55ml</td>
			<td>Fisher</td>
			<td>13-681-501</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DEAE-Dextran</td>
			<td>Fisher</td>
			<td>NC9691007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning 96 well clear V bottom tissue culture treated microplate</td>
			<td>Fisher</td>
			<td>07-200-96</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HEPES, 1M Buffer Solution</td>
			<td>Life Technologies/Invitrogen</td>
			<td>15630-080</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FBS, Defined, 500 ml</td>
			<td>Fisher</td>
			<td>SH30070 03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">X-gal</td>
			<td>VWR</td>
			<td>PAV3941</td>
			<td>Manufactured by Promega</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glutaraldehyde, Grade II, 25% in H2O</td>
			<td>Sigma-Aldrich</td>
			<td>G6257-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1M Magnesium chloride solution</td>
			<td>Sigma-Aldrich</td>
			<td>M1028-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Formaldehyde solution, for molecular biology, 36.5%</td>
			<td>Sigma-Aldrich</td>
			<td>F8775-500ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Potassium hexacyanoferrate(II) trihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>P9387-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Potassium hexacyanoferrate(III)</td>
			<td>Sigma-Aldrich</td>
			<td>P8131-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Allegra X15-R centrifuge</td>
			<td>Beckman Coulter</td>
			<td>392932</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TC10 automated cell counter</td>
			<td>Bio-Rad</td>
			<td>1450001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VistaVision inverted microscope</td>
			<td>VWR</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Reverse-Transcriptase Quantification Assay reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">dTTP, [&#945;-33P]- 3000Ci/mmol, 10mCi/ml, 1 mCi</td>
			<td>Perkin-Elmer</td>
			<td>NEG605H001MC</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1M Tris-Cl, pH 8.0</td>
			<td>Life Technologies/Invitrogen</td>
			<td>15568025</td>
			<td>Must be adjusted to pH 7.8 with KOH</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2M potassium chloride (KCl)</td>
			<td>Life Technologies/Invitrogen</td>
			<td>AM9640G</td>
			<td>Adjust to 1M solution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.5M EDTA</td>
			<td>Life Technologies/Invitrogen</td>
			<td>15575-020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nonidet P40</td>
			<td>Roche</td>
			<td style="width:133px;">11333941103</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Polyadenylic acid (Poly rA) potassium salt&#160;</td>
			<td>Midland Reagent Co.</td>
			<td>P-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo d(T) primer&#160;</td>
			<td>Life Technologies/Invitrogen</td>
			<td>18418-012</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dithiothreitol (DTT)</td>
			<td>Sigma-Aldrich</td>
			<td>43815-1G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SR, Super Resolution Phosphor Screen, Small</td>
			<td>Perkin-Elmer</td>
			<td>7001485</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning Costar Thermowell 96 well plate model (M) Polycarbonate</td>
			<td>Fisher</td>
			<td>07-200-245</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning 96 Well Microplate Aluminum Sealing Tape, Nonsterile</td>
			<td>Fisher</td>
			<td>07-200-684</td>
			<td>Manufactured by Corning Life</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DE-81 anion exchange paper</td>
			<td>Whatman</td>
			<td>3658-915</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trisodium citrate dihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>S1804-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium Chloride</td>
			<td>Fisher</td>
			<td>S671-3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Autoradiography cassette</td>
			<td>Fisher</td>
			<td>FB-CA-810</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cyclone storage phoshpor screen</td>
			<td>Packard</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

a restriction enzyme based cloning method to assess the in vitro replication capacity of hiv-1 subtype c gag-mj4 chimeric viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

Para ejecutar correctamente este protocolo, lo que crea un plásmido proviral capaz de ensamblar completamente funcionales, infecciosas quimeras Gag-MJ4, el gran cuidado se debe tomar para generar los amplicones PCR apropiados. Determinación de si la PCR ha generado el amplicón de la mordaza de tamaño adecuado es crucial. Los productos deben estar dentro de 100 pares de bases (pb) de la amplificación de aproximadamente 1700 pb se muestra en la Figura 1A. La longitud exacta de este fragmento...

Watch this Scientific Journal Video about A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses at JoVE.com

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

Una enzima de restricción método basado clonación para evaluar la<em&gt; In vitro</em&gt; Capacidad de replicación del VIH-1 subtipo C Gag-MJ4 quiméricos virus

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target ...

a-restriction-enzyme-based-cloning-method-to-assess-vitro-replication

Research

JoVE Journal

Immunology and Infection

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

15.5K vistas.  Emory University. HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.