Work in the authors' laboratory is supported by a grant from the National Institute of General Medical Sciences (GM41628) and by a grant to the Stowers Institute for Medical Research from the Helen Nelson Medical Research Fund at the Greater Kansas City Community Foundation.

1. ATP&#39;ye bağımlı Nükleozom Tadilat Tahliller Nükleozom remodeling aktiviteleri ATP&#39;ye bağımlı ölçmek için, ya da immüno-INO80 INO80 subcomplexes ATP ve 216 bp, 32 P-etiketli DNA fragmanının bir ucunda yer alan, tek bir nükleozom içeren bir alt-tabaka mononucleosomal, inkübe edilir. Reaksiyon ürünleri daha sonra yerli poli-akrilamid jeli içinde elektroforez işlemine tabi tutulmuştur. <ol><li> 32 P-etiketli, &#39;601&#39; DNA fragmanını meydana getirmek için, gelen amplifiye pGEM-3Z-601 4 oligonükleotitleri olarak 5&#39;-ve 5&#39;-ACAGGATGTATATATCTGACACGTGCCTGG AATACTCAAGCTTGGATGCCTGCAG kullanan bir uç konuma 601 nükleozom konumlandırma dizisini ihtiva eden bir 216 bp&#39;lik bir DNA fragmanı ileri ve geri primerler. <ol><li> Tablo 1 de tarif edildiği gibi, bir 100 | il PCR reaksiyonu ayarlayın. </li><li> Aşağıdaki programı kullanarak bir termal döngü PCR reaksiyonları gerçekleştirin: 1 dk 96 ° C, followe de94 ° C, 57 ° C, 30 döngü için 72 ° C&#39;de 60 saniye, 30 saniye ile 45 saniye D; 72 ° C &#39;de, 7 dakika ile biten. </li><li> PCR reaksiyon tamamlandıktan sonra, nükleaz içermeyen döndürme kolonları boyunca iki kez, reaksiyon ürünlerinin geçirilmesiyle mümkün bağlanamayan nükleotidleri gidermek. </li><li> PCR reaksiyonu, arzu edilen ~ 216 bp&#39;lik bir DNA fragmanı elde onaylamak için% 1.2 agaroz jeli içinde saflaştırılmış PCR ürünü 5 ul çalıştırın. </li><li> Saflaştınlmış PCR ürünü, 20-kat 5 ul seyreltin ve bir UV spektrofotometresi kullanılarak DNA konsantrasyonları ölçülür. Ortalama verim ~ 40 ng / ul. </li><li> Bir ışıma sayacı içinde arıtılmış PCR ürünü 1 ul radyoaktivite ölçülür. Cpm / ng hesaplayarak etiketleme verimliliği tahmin. Başarılı bir etiketleme reaksiyonu 601 DNA fragmanının ~ 15,000 cpm / ng elde etmesi beklenmektedir. </li></ol></li><li> Bir seri seyreltme yöntemi kullanılarak 5 etiketli 601 DNA üzerine Hela hücre nükleozom aktarın. <ol><li> 2 pmol karıştırın32 P-etiketli 601 DNA fragmanı ile HeLa nükleozom 6 ug 1.0 M NaCl, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.1 mM PMSF ve 1 mM ihtiva eden bir tampon maddesi 50 ul (5 tarif edildiği gibi hazırlanmıştır) DTT ve 30 dakika boyunca 30 ° C&#39;de inkübe edin. </li><li> Sıralı 0.8 M, 0.6 M seyreltin ve 10 mM Tris-HCI (pH 8.0), 1 mM EDTA, 0.1 mM PMSF, sırasıyla 12.5 ul, 20.8 ul, 41.6 ul, seyreltme ile 0.4 M NaCI, ve 1 mM DTT, her bir seyreltmeden sonra 30 ° C de 30 dakika inkübasyon ile. </li><li> Bundan başka, bir 30 dakika inkübasyon ile, sonra% 0.1 Nonidet P-40,% 20 gliserol ve 200 ug / ml BSA ihtiva eden aynı tampon 250 ul, 125 ul eklenmesi ile 0.1 M NaCl, sonra 0.2 M ve seyreltin ve son iki dilüsyonu arasında 30 ° C&#39;de ilave edildi. 3 aya kadar 4 ° C &#39;de mononucleosome tabakayı saklayın. </li></ol></li><li> 10 ul bir toplam hacim içinde ATP&#39;ye bağımlı nükleozom kayar reaksiyonları gerçekleştirmek. ReaINO80 nükleozom biçimlenme aktivitesi için en uygun NaCl konsantrasyonu olduğu ölü m bileşenler. Tablo 2&#39;de listelenen 50 mM NaCI (yayınlanmamış sonuçlar) dikkate bulunan NaCI miktarı göz önüne alındığında, 50 mM NaCl, her reaksiyonda toplam konsantrasyonunu ayarlamak nükleozomlardan ve enzim preparatları. <ol><li> Tahlillerinde başlamadan önce, yerli poli-akrilamid jelleri (18 x 16 cm) attı. % 5 akrilamid içeren, tek bir jel hazırlamak için (akrilamid: bisakrilamid 37,5: 1) ile, 0.5x TBE (45 mM Tris, borat, 1 mM EDTA),% 0.01 amonyum persülfat (BP), ve% 0.001 N, N, N &#39;, N&#39;-tetrametiletilendiamin (TEMED). Tablo 3&#39;te listelenen bileşenler karışımı jel oda sıcaklığında en az 2 saat boyunca polimerize olmaya bırakın. </li><li> Her bir reaksiyonun gerçekleşmesi için arada, önceden soğutulmuş bir silikonize 1.5 ml mikrosantrifüj tüpü ~ 20 nM ya da INO80 INO80 subcomplex birleştirmek (EB100 tampon miktarı ile (3 tarif edildiği gibi hazırlanmıştır) <strzun&gt; yeterli Tablo 4) 4.75 ul bir hacim elde edildi. Hemen toz halinde kuru buz veya sıvı azot içinde kalan INO80 içeren fraksiyonların yeniden dondurma. </li><li> &#39;X&#39; faktörü ile yukarı ölçeklendirme, bileşenlerin geri kalanı ile bir usta kokteyl kurmak (nerede reaksiyonlar X = toplam sayı +3). Tek bir 10 ul reaksiyon için gerekli olan her bir bileşenin miktarı, Tablo 5&#39;te listelenmiştir; tarifi yapılacak reaksiyon sayısına göre büyük çapta üretim için gerekmektedir. Bir Pipetman tüp dokunarak veya yukarı pipetle ve aşağı İyice karıştırın ve bir tezgah üstü mikrosantrifuj&#39;de birkaç saniye boyunca tüp spin. </li><li> Adım 1.3.2 kurmak reaksiyon tüplerinin her için ana kokteyli 5,25 ul koyun. Yukarı ve aşağı pipetleme ile iyice karıştırın. 30 ° C ısıtma bloğu ya da su banyosuna reaksiyon tüpleri transfer reaksiyonları başlatmak ve 2 saat süreyle inkübe edin. </li><li> Bu arada, rakip DNA içeren kokteyl &#39;mix kaldırarak&#39; hazırlamakve nukleosomlar, X (reaksiyonlar + 4 X = toplam sayısı) bir faktör tarafından ölçeklendirme. Tek bir reaksiyon karışımı için kaldırma 1,5 ul hazırlamak için gerekli olan her bir bileşenin miktarı, Tablo 6&#39;da listelenmiştir; tarifi yapılacak deneyler sayısına bağlı olarak büyük çapta üretim için gerekmektedir. </li><li> Çıkarmadan karışımı 1.5 ul ekleyerek reaksiyonları sonlandırın. İyice karıştırın, aşağı doğru dönmeye ve bir 30 dakika daha 30 ° C&#39;de inkübe edin. </li><li> Bununla birlikte, sabit bir tampon dolaşımını sağlamak için, alt odasının iç tarafında bir manyetik karıştırma çubuğu ile tampon olarak 0.5x TBE kullanılarak 4 ° C&#39;de 30 dakika boyunca 100 V&#39;ta elektroforez birimi dikey olarak yerli poliakrilamid jel ön çalıştırın. </li><li> , Örnek yük 3x TBE,% 30 gliserol,% 0.25 bromofenol mavisi,% 0.25 ksilen siyanol FF ihtiva eden yükleme boyası 2.5 ul ekleyin. Kısaca örnekleri döner, iyice karıştırın ve yükleme uçları kullanılarak jel üzerine yerleştirin. </li><li> Tampon sirkülasyon ile 4 ° C sıcaklıkta 4,5 saat boyunca 200 V&#39;de jel çalıştırın.</li><li> Sinyali tespit etmek için, filtre kağıdı iki tabakanın bir yığın jel aktarın. Şeffaf bir plastik sarım ile üst jeli ile filtre kağıdı sarın ve daha sonra arzu edilen süre boyunca 4 ° C&#39;de depolama fosfor ekranına maruz kalmaktadır. </li><li> Bir izotop görüntüleme tarayıcı sistemi ile ekran tarama ve uygun yazılım kullanarak verileri analiz. </li></ol></li></ol> 2. Mononucleosome Bağlanma Analizleri Mononucleosomes için belirli bir INO80 kompleksinin bağlanma afinitesini tahlil edilmesi için, Adım 1.2 üretilen mononucleosomal alt-tabaka kullanılarak bir elektroforetik mobilite kayma deneyiyle (EMSA), gerçekleştirin. <ol><li> Reaksiyon nükleozom yeniden modelleme deneyleri için anlatıldığı şekilde, fakat reaksiyonlardan ATP kaldırma karışımı ihmal bağlayıcı bağlanma analizleri için karışımları ayarlama; 30 dakika boyunca 30 ° C&#39;de inkübe edin. </li><li> Her reaksiyon karışımına yükleme boyası 2.5 ul,% 3.5 akrilamid (akrilamid içeren bir yerli poliakrilamid jel için geçerlidir: 3 bis7.5: 1),% 1 gliserol, 0.5x TBE% 0.01 APS ve% 0.001 TEMED. </li><li> Tampon olarak kullanarak 0.5x TBE tampon sirkülasyon ile 4 ° C &#39;de 2.5 saat boyunca 200 V&#39;de jel üzerinde çalıştırıldı ve depolama fosfor ekranına maruz kalmaktadır. </li></ol> 3. DNA-bağımlı ve Nükleozom ATPaz Tahliller 20 mM Tris-HCl (pH 7.5), 60 mM NaCI, 6.6 mM MgCl2, 0.8 mM EDTA, 0.015% Nonidet P-40,% 2.5 gliserol, 0.1 mg / ml BSA, 1 ihtiva eden 5 ul reaksiyon karışımlarında ATPase deneyleri gerçekleştirmek mM DTT, 0.1 mM PMSF, 2 mM ATP, [α- 32P] ATP, 2 uCi (3,000 Ci / mmol) eklenmiştir. INO80 kompleksinin her INO80 kompleksi ya da miktar için dairesel plazmid DNA ölçmek için (5000 bp ~ 30 nM) kapalı içeren DNA- ya nucleosome bağımsız ATPaz, bir ölçmek için üç paralel reaksiyonlar, tek içeren EB100 tampon kurmak denenmiştir için DNA- bağımlı ATPaz ve nucleosome-bağımlı ATPaz ölçmek için bir HeLa oligonüklezomlar (~ 185 nM) içeren. Buz üzerinde bütün tepkileri ayarlayın. <ol&gt; <li> Her bir reaksiyon için, önceden soğutulmuş yağlanmış bir 1.5 ml mikrosantrifüj tüpleri içinde 2.2 ul bir hacim elde etmek için yeterli EB100 tampon bir miktarı ile ya da immüno INO80 INO80 subcomplexes 10-50 nM birleştirir. Hemen toz halinde kuru buz veya sıvı azot içinde bir INO80 içeren fraksiyonların yeniden dondurma. </li><li> Bir usta kokteyl ayarlayın. Tek bir reaksiyon için gerekli olan her bir bileşenin miktarı, Tablo 7&#39;de listelenmiştir., X = INO80 preparatların bir sayısının tahlil edilmesi 3 (X + 2) +1 bir unsur tarafından ölçekleme ile tarifi ölçeğinin. </li><li> &#39;Sub-Kokteylleri&#39; içeren tampon hazırlamak için sadece, DNA veya nukleosomlar, üç ayrı tüpler içine usta kokteyl 2.5 (X + 2) ul dağıtmak. 0.3 ya da EB100 bölgesinin (X + 2) ul, kapalı, dairesel plazmid DNA (1.5 ug / ml) ya da Hela oligonüklezomlar (1.5 ug / ul) ekleyin ve iyice karıştırın. </li><li> St kurmak enzim içeren bir reaksiyon tüpüne uygun alt kokteyli 2.8 ul koyunep 3.1. Hafifçe karıştırın aşağı yukarı pipet ve; kabarcıkları tanıtan kaçının. </li><li> , Reaksiyonlarını başlatmak 30 ° C ısı bloğu reaksiyon tüpleri aktarmak için. </li><li> En az 1.5 cm uzakta alt kenarı düz bir hat içinde 5, 15, 30, ve inkübasyon 60 dakika sonra, bir selüloz polietilenimin ince tabaka kromatografisi üzerine her tepkime karışımı 0.5 ul nokta (TLC), levha (20 x 10 cm) . Hemen birden çok zaman noktaları, tek bir tüpten alınabilir 30 ° C ısıya bloğuna reaksiyon tüpleri döner. Boyandıktan sonra, bir fön makinesi kullanıyorsanız TLC plakaları kurulayın. </li><li> TLC plakasının alt 0.5 cm çözelti içinde sokulmasına izin kadar 0,375 M potasyum fosfat (pH 3.5) ihtiva eden bir cam bölmeye TLC plakalarına aktarın. </li><li> Bölmesi kapağı ve sıvı fazın ön TLC plakalarının üst ulaşana kadar gelişir. Anında iyice bir darbe kurutma makinesi kullanarak plakaları kurulayın. </li><li> Oda sıcaklığında depolama fosfor ekranına kurutulmuştur, TLC plakaları Açığa.Bir izotop görüntüleme tarayıcı sistemi ile ekran tarama ve radyoaktif ATP substrat ve ADP ürünün miktarını belirlemek. </li><li> ATP hidroliz miktarının hesaplanması için aşağıdaki formül kullanılarak başlangıç ​​reaksiyon karışımı içinde mevcut olan ATP miktarı ile hidrolize% ATP çarpma: pmol ATP hidroliz = 10 pmol ATP Reaksiyon x başlayarak [ADP / (ATP + ADP)] </li></ol>

<ol>
	<li>Clapier, C. R., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+chromatin+remodeling+complexes.">The biology of chromatin remodeling complexes.</a> Annual Review of Biochemistry. 78, 273-304 (2009).</li><li>Narlikar, G. J., Sundaramoorthy, R., Owen-Hughes, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+and+functions+of+ATP-dependent+chromatin-remodeling+enzymes.">Mechanisms and functions of ATP-dependent chromatin-remodeling enzymes.</a> Cell. 154 (3), 490-503 (2013).</li><li>Chen, L., Ooi, S. K., Conaway, J. W., Conaway, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+purification+of+human+INO80+chromatin+remodeling+complexes+and+subcomplexes.">Generation and purification of human INO80 chromatin remodeling complexes and subcomplexes.</a> , (2013).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> J. Mol. Biol. 276 (1), (1006).</li><li>Owen-Hughes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+nucleosome+disruption+by+ATP-driven+chromatin+remodeling+complexes.">Analysis of nucleosome disruption by ATP-driven chromatin remodeling complexes.</a> Methods Mol. Biol. 119, 319-331 (1999).</li><li>Udugama, M., Sabri, A., Bartholomew, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+INO80+ATP-dependent+chromatin+remodeling+complex+is+a+nucleosome+spacing+factor.">The INO80 ATP-dependent chromatin remodeling complex is a nucleosome spacing factor.</a> Mol. Cell Biol. 31 (4), 662-673 (2011).</li><li>Jin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mammalian+chromatin+remodeling+complex+with+similarities+to+the+yeast+INO80+complex.">A mammalian chromatin remodeling complex with similarities to the yeast INO80 complex.</a> Journal of Biological Chemistry. 280 (50), 41207-41212 (1074).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subunit+organization+of+the+human+INO80+chromatin+remodeling+complex:+an+evolutionarily+conserved+core+complex+catalyzes+ATP-dependent+nucleosome+remodeling.">Subunit organization of the human INO80 chromatin remodeling complex: an evolutionarily conserved core complex catalyzes ATP-dependent nucleosome remodeling.</a> Journal of Biological Chemistry. 286 (13), 11283-11289 (2011).</li><li>Hamiche, A., Sandaltzopoulos, R., Gdula, D. A., Wu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATP-dependent+histone+octamer+sliding+mediated+by+the+chromatin+remodeling+complex+NURF.">ATP-dependent histone octamer sliding mediated by the chromatin remodeling complex NURF.</a> Cell. 97 (7), 833-842 (1999).</li><li>Polach, K. J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restriction+enzymes+as+probes+of+nucleosome+stability+and+dynamics.">Restriction enzymes as probes of nucleosome stability and dynamics.</a> Methods Enzymol. 304, 278-298 (1999).</li><li>Anderson, J. D., Thastrom, A., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+of+proteins+to+buried+nucleosomal+DNA+target+sites+occurs+via+a+mechanism+that+is+distinct+from+nucleosome+translocation,+Mol.Cell+Biol.">Spontaneous access of proteins to buried nucleosomal DNA target sites occurs via a mechanism that is distinct from nucleosome translocation, Mol.Cell Biol.</a> 22 (20), 7147-7157 (2002).</li><li>Saha, A., Wittmeyer, J., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+remodeling+through+directional+DNA+translocation+from+an+internal+nucleosomal+site.">Chromatin remodeling through directional DNA translocation from an internal nucleosomal site.</a> Nature Structural and Molecular Biology. 12 (9), 747-755 (2005).</li><li>Gottschalk, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ADP-ribosyl)ation+directs+recruitment+and+activation+of+an+ATP-dependent+chromatin+remodeler,+Proc.Natl.Acad.Sci.U.S.A.">Poly(ADP-ribosyl)ation directs recruitment and activation of an ATP-dependent chromatin remodeler, Proc.Natl.Acad.Sci.U.S.A.</a> 106 (33), 13770-13774 (2009).</li><li>Clapier, C. R., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+ISWI+involves+inhibitory+modules+antagonized+by+nucleosomal+epitopes.">Regulation of ISWI involves inhibitory modules antagonized by nucleosomal epitopes.</a> Nature. 492 (7428), 280-284 (2012).</li><li>Brune, M., Hunter, J. L., Corrie, J. E. T., Direct Webb, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-Time+Measurement+of+Rapid+Inorganic+Phosphate+Release+Using+a+Novel+Fluorescent+Probe+and+Its+Application+to+Actomyosin+Subfragment+1+ATPase,+Biochemistry.">Real-Time Measurement of Rapid Inorganic Phosphate Release Using a Novel Fluorescent Probe and Its Application to Actomyosin Subfragment 1 ATPase, Biochemistry.</a> 33 (27), 8262-8271 (1994).</li><li>Luk, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stepwise+histone+replacement+by+SWR1+requires+dual+activation+with+histone+H2A.Z+and+canonical+nucleosome.">Stepwise histone replacement by SWR1 requires dual activation with histone H2A.Z and canonical nucleosome.</a> Cell. 143 (5), 725-736 (2010).</li></ol>

The authors declare that they have no competing financial interests.

, Ve yeniden modelleme ve / veya enzimler ATPaz kirletici biz deneylerde uyulması, nükleozom şekillenmesi ve ATPaz aktiviteleri INO80 komplekslerin katalitik aktivitesine bağlı sağlamak için, rutin deney nükleozom modelleme ve INO80 komplekslerin katalitik olarak aktif olmayan ATPaz aktivitesi, saflaştırılır Yabani tip INO80 aynı prosedür kullanılarak paralel. INO80 kompleksi ya da subcomplexes farklı preparatlar içinde etkinliklerini karşılaştırmak, deney yöntemi için karmaşık hale ATP ve / vey...

SnF2 aile kromatin biçimlenme kompleksleri merkezi SnF2 gibi ATPaz alt birimini 1,2 içerir. Tek alt-birim enzimler gibi bazı SnF2 gibi ATPaz fonksiyonu, diğer daha büyük bir çoklu alt birim kompleksi katalitik alt-birimi olarak işlev yaparken. Biçimlenme kompleksleri onların faaliyetlerine katkıda kromatinin alt birimlerinin her biçimlenme sürecini incelemek biyokimyasal analizleri gerçekleştirmek için yeteneği gerektiren hangi moleküler mekanizmaların tanıtılması. İnsan INO80 kompleksi ve diğer enzimler tarafından yeniden yapılanma kromatin ATP&#39;ye bağımlı nükleozom yeniden modelleme, kendi DNA- ve / veya nükleozom bağımlı ATPaz aktivasyonu takiben, nükleozomlann için yeniden şekillenme enzimin bağlanması ile başlayan bir çok-aşamalı bir süreç olarak tasavvur edilebilir nükleozomal DNA ve nükleozomlardan 1,2 nihai konumlandırılması hakkında yeniden şekillenme enzim translokasyon. ATP&#39;ye bağımlı kromatin değiştirme prosesinin r molekül ayrıntılarını anlamakreaksiyonun her aşaması için kromatin remodeling karmaşık bireysel alt birimlerinin katkıları biçimlenme kendi bireysel adımlar içine reaksiyonu ve tanımı diseksiyonu equires. Bu tür analizler in vitro tanımlanmış moleküler alt tabakalar kullanılarak nucleosome biçimlenme ve diğer faaliyetlerini analiz yeteneği gerektirir. Önceki bir JOVE protokol, tanımlanmış ait birim bileşimleri ile 3 INO80 kromatin biçimlenme kompleksleri ve subcomplexes oluşturmak için kullanılan prosedürleri tarif. Burada, biz, DNA&#39;ya ve nucleosome-aktive ATPaz ve bu kompleksleri ile ilişkili nucleosome biçimlenme faaliyetlerini bağlayıcı nucleosome kantitatif analizini sağlayan üç biyokimyasal analizler sunmak.

<table border="0" cellpadding="0" cellspacing="0" width="839">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Name of Reagent/Material</td>
			<td style="width:212px;">Company</td>
			<td style="width:147px;">Catalog Number</td>
			<td style="width:123px;">Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Protease Inhibitor Cocktail</td>
			<td style="width:212px;">Sigma</td>
			<td style="width:147px;">P8340</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10x PCR reaction buffer&#160;</td>
			<td style="width:212px;">Roche Applied Science&#160;</td>
			<td style="width:147px;">11435094001</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Roche Taq DNA Polymerase</td>
			<td style="width:212px;">Roche Applied Science&#160;</td>
			<td style="width:147px;">11435094001</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NucAway Nuclease-free Spin Columns&#160;</td>
			<td>Ambion</td>
			<td style="width:147px;">Cat. # AM10070</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ultrapure ATP&#160;</td>
			<td>USB/Affymetrix</td>
			<td style="width:147px;">77241 25 UM</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">bovine serum albumin&#160;</td>
			<td style="width:212px;">Sigma</td>
			<td style="width:147px;">A9418&#160;</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">N,N,N&#180;,N&#180;-tetramethylethylenediamine (TEMED)</td>
			<td style="width:212px;">Thermo Scientific</td>
			<td style="width:147px;">17919</td>
			<td style="width:123px;">Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">40% Acrylamide/Bis 37.5:1</td>
			<td style="width:212px;">Amresco</td>
			<td style="width:147px;">0254-500ML</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sonicated salmon sperm DNAs&#160;</td>
			<td>GE Healthcare</td>
			<td style="width:147px;">27-4565-01</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10% ammonium persulfate (APS)</td>
			<td style="width:212px;">Thermo Scientific</td>
			<td style="width:147px;">17874</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">benzonase&#160;</td>
			<td>Novagen</td>
			<td style="width:147px;">Cat. No. 70664</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;">[&#945;-32P] ATP (3000 Ci/mmol)</td>
			<td style="width:212px;">PerkinElmer</td>
			<td style="width:147px;">BLU003H250UC</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">dCTP, [&#945;-32P]- 6000Ci/mmol</td>
			<td style="width:212px;">PerkinElmer</td>
			<td style="width:147px;">BLU013Z250UC</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;"></td>
			<td style="width:212px;"></td>
			<td style="width:147px;"></td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Equipment</td>
			<td style="width:212px;">Company</td>
			<td style="width:147px;"></td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR thermal cycler PTC 200</td>
			<td>MJ Research</td>
			<td style="width:147px;">PTC 200</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hoefer vertical electrophoresis unit</td>
			<td style="width:212px;">Hoefer</td>
			<td style="width:147px;">SE600X-15-1.5</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">lubricated 1.5ml microcentrifuge tubes&#160;</td>
			<td style="width:212px;">Costar</td>
			<td style="width:147px;">3207</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Storage Phosphor Screen&#160;</td>
			<td>Molecular Dynamics</td>
			<td style="width:147px;">63-0034-79</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">3MM filter paper</td>
			<td>Whatman&#160;</td>
			<td style="width:147px;">28458-005</td>
			<td style="width:123px;">VWR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Typhoon PhosphorImager&#160;</td>
			<td>GE Healthcare</td>
			<td style="width:147px;">8600</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ImageQuant software</td>
			<td>GE Healthcare</td>
			<td style="width:147px;">ver2003.02</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">TLC Glass Plates, PEI-Cellulose F</td>
			<td style="width:212px;">Millipore</td>
			<td style="width:147px;">5725-7</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Immobilon-FL Transfer Membrane 7 x 8.4</td>
			<td style="width:212px;">Millipore</td>
			<td style="width:147px;">IPFL07810</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:359px;">General purpose survey meter with end-window or pancake GM (Geiger-Mueller) probe</td>
			<td style="width:212px;">Biodex</td>
			<td style="width:147px;">Model 14C</td>
			<td style="width:123px;"></td>
		</tr>
	</tbody>
</table>

biochemical assays for analyzing activities of atp-dependent chromatin remodeling enzymes

Members of the SNF2 family of ATPases often function as components of multi-subunit chromatin remodeling complexes that regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Biochemically dissecting the contributions of individual subunits of such complexes to the multi-step ATP-dependent chromatin remodeling reaction requires the use of assays that monitor the production of reaction products and measure the formation of reaction intermediates. This JOVE protocol describes assays that allow one to measure the biochemical activities of chromatin remodeling complexes or subcomplexes containing various combinations of subunits. Chromatin remodeling is measured using an ATP-dependent nucleosome sliding assay, which monitors the movement of a nucleosome on a DNA molecule using an electrophoretic mobility shift assay (EMSA)-based method. Nucleosome binding activity is measured by monitoring the formation of remodeling complex-bound mononucleosomes using a similar EMSA-based method, and DNA- or nucleosome-dependent ATPase activity is assayed using thin layer chromatography (TLC) to measure the rate of conversion of ATP to ADP and phosphate in the presence of either DNA or nucleosomes. Using these assays, one can examine the functions of subunits of a chromatin remodeling complex by comparing the activities of the complete complex to those lacking one or more subunits. The human INO80 chromatin remodeling complex is used as an example; however, the methods described here can be adapted to the study of other chromatin remodeling complexes.

Rakamlar nükleozom kayar (Şekil 1) ve bağlayıcı (Şekil 2) ve deneyler DNA- veya nükleozom bağlı ATPaz deneyleri (Şekil 3) de dahil olmak üzere INO80 aktivitelerini karakterize etmek için kullanılır biyokimyasal tahlillerde temsili sonuçlar göstermektedir. Şekil 1 &#39;de gösterilen deney sağlam INO80 komplekslerinin yeteneği FLAG Ies2 veya FLAG INO80E ile arıtılmış INO80 bir 216 bp radyo etiketli DNA ...

Watch this Scientific Journal Video about Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes at JoVE.com

Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes

Here we describe biochemical assays that can be used to characterize ATP-dependent chromatin remodeling enzymes for their abilities to 1) catalyze ATP-dependent nucleosome sliding, 2) engage with nucleosome substrates, and 3) hydrolyze ATP in a nucleosome- or DNA-dependent manner.

ATP-bağımlı Kromatin Tadilat Enzimler Faaliyetlerinin Analizi için biyokimyasal Tahliller

Members of the SNF2 family of ATPases often function as components of multi-subunit chromatin remodeling complexes that regulate nucleosome dynamics and ...

biochemical-assays-for-analyzing-activities-atp-dependent-chromatin

Research

JoVE Journal

Biology

14.7K Görüntüleme.  Stowers Institute for Medical Research. Here we describe biochemical assays that can be used to characterize ATP-dependent chromatin remodeling enzymes for their abilities to 1) catalyze ATP-dependent nucleosome sliding, 2) engage with nucleosome substrates, and 3) hydrolyze ATP in a nucleosome- or DNA-dependent manner.

Video: Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes

A Chromatin Assay for Human Brain Tissue

Chronic neuropsychiatric illnesses such as schizophrenia, bipolar disease and autism are thought to result from a combination of genetic and environmental factors that might result in epigenetic alterations of gene expression and other molecular pathology. Traditionally, however, expression studies in postmortem brain were confined to quantification of mRNA or protein. The limitations encountered in postmortem brain research   such as variabilities in autolysis time and tissue integrities   are also likely to impact any studies of higher order chromatin structures. However, the nucleosomal organization of genomic DNA   including DNA:core histone binding - appears to be largely preserved in representative samples provided by various brain banks. Therefore, it is possible to study the methylation pattern and other covalent modifications of the core histones at defined genomic loci in postmortem brain. Here, we present a simplified native chromatin immunoprecipitation (NChIP) protocol for frozen (never-fixed) human brain specimens. Starting with micrococcal nuclease digestion of brain homogenates, NChIP followed by qPCR can be completed within three days. The methodology presented here should be useful to elucidate epigenetic mechanisms of gene expression in normal and diseased human brain.

Until recently, expression studies on human brain were limited to quantification of RNA or protein. With the chromatin immunoprecipitation techniques described in this paper, it will be possible to map histone methylation and other epigenetic regulators of gene expression in postmortem brain.

İnsan Beyninin Doku Kromatin Testi

Chronic neuropsychiatric illnesses such as schizophrenia, bipolar disease and autism are thought to result from a combination of genetic and environmental ...

Biyoloji

Zebrafish Brain Ventricle Injection

Proper brain ventricle formation during embryonic brain development is required for normal brain function.  Brain ventricles are the highly conserved cavities within the brain that are filled with cerebrospinal fluid.  In zebrafish, after neural tube formation, the neuroepithelium undergoes a series of constrictions and folds while it fills with fluid resulting in brain ventricle formation.  In order to understand the process of ventricle formation, and the neuroepithelial shape changes that occur at the same time, we needed a way to visualize the ventricle space in comparison to the brain tissue.  However, the nature of transparent zebrafish embryos makes it difficult to differentiate the tissue from the ventricle space.  Therefore, we developed a brain ventricle injection technique where the ventricle space is filled with a fluorescent dye and imaged by brightfield and fluorescent microscopy.  The brightfield and the fluorescent images are then processed and superimposed in Photoshop.  This technique allows for visualization of the ventricle space with the fluorescent dye, in comparison to the shape of the neuroepithelium in the brightfield image.  Brain ventricle injection in zebrafish can be employed from 18 hours post fertilization through early larval stages.  We have used this technique extensively in our studies of brain ventricle formation and morphogenesis as well as in characterizing brain morphogenesis mutants (1-3).

After neural tube formation, the neuroepithelium constricts and folds while the tube fills with embryonic cerebrospinal fluid (eCSF) to form the embryonic brain ventricles. We developed this ventricle injection technique to better visualize the fluid filled space in contrast to the neuroepithelial shape in a live embryo.

Zebra balığı Beyin Ventrikül Enjeksiyon

Proper brain ventricle formation during embryonic brain development is required for normal brain function.  Brain ventricles are the highly conserved ...

Photobleaching Assays (FRAP &amp; FLIP) to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with good spatial and temporal resolution. Here we describe how to perform FRAP and FLIP assays of chromatin proteins, including H1 and HP1, in mouse embryonic stem (ES) cells. In a FRAP experiment, cells are transfected, either transiently or stably, with a protein of interest fused with the green fluorescent protein (GFP) or derivatives thereof (YFP, CFP, Cherry, etc.). In the transfected, fluorescing cells, an intense focused laser beam bleaches a relatively small region of interest (ROI). The laser wavelength is selected according to the fluorescent protein used for fusion. The laser light irreversibly bleaches the fluorescent signal of molecules in the ROI and, immediately following bleaching, the recovery of the fluorescent signal in the bleached area - mediated by the replacement of the bleached molecules with the unbleached molecules - is monitored using time lapse imaging. The generated fluorescence recovery curves provide information on the protein's mobility. If the fluorescent molecules are immobile, no fluorescence recovery will be observed. In a complementary approach, Fluorescence Loss in Photobleaching (FLIP), the laser beam bleaches the same spot repeatedly and the signal intensity is measured elsewhere in the fluorescing cell. FLIP experiments therefore measure signal decay rather than fluorescence recovery and are useful to determine protein mobility as well as protein shuttling between cellular compartments. Transient binding is a common property of chromatin-associated proteins. Although the major fraction of each chromatin protein is bound to chromatin at any given moment at steady state, the binding is transient and most chromatin proteins have a high turnover on chromatin, with a residence time in the order of seconds. These properties are crucial for generating high plasticity in genome expression1. Photobleaching experiments are therefore particularly useful to determine chromatin plasticity using GFP-fusion versions of chromatin structural proteins, especially in ES cells, where the dynamic exchange of chromatin proteins (including heterochromatin protein 1 (HP1), linker histone H1 and core histones) is higher than in differentiated cells2,3.

Photobleaching Assays FRAP &amp; FLIP to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

We describe photobleaching methods including Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) to monitor chromatin protein dynamics in embryonic stem (ES) cells. Chromatin protein dynamics, which is considered to be one of the means to study chromatin plasticity, is enhanced in pluripotent cells.

Embriyonik Kök Hücreler Yaşayan Kromatin Protein Dynamics Tedbir Tahliller (sıkı bağlamak ve FLIP) Photobleaching

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with ...

Quantitative Comparison of cis-Regulatory Element (CRE) Activities in Transgenic Drosophila melanogaster

Gene expression patterns are specified by cis-regulatory element (CRE) sequences, which are also called enhancers or cis-regulatory modules. A typical CRE possesses an arrangement of binding sites for several transcription factor proteins that confer a regulatory logic specifying when, where, and at what level the regulated gene(s) is expressed. The full set of CREs within an animal genome encodes the organism&prime;s program for development1, and empirical as well as theoretical studies indicate that mutations in CREs played a prominent role in morphological evolution2-4. Moreover, human genome wide association studies indicate that genetic variation in CREs contribute substantially to phenotypic variation5,6. Thus, understanding regulatory logic and how mutations affect such logic is a central goal of genetics. 
Reporter transgenes provide a powerful method to study the in vivo function of CREs. Here a known or suspected CRE sequence is coupled to heterologous promoter and coding sequences for a reporter gene encoding an easily observable protein product. When a reporter transgene is inserted into a host organism, the CRE&prime;s activity becomes visible in the form of the encoded reporter protein. P-element mediated transgenesis in the fruit fly species Drosophila (D.) melanogaster7 has been used for decades to introduce reporter transgenes into this model organism, though the genomic placement of transgenes is random. Hence, reporter gene activity is strongly influenced by the local chromatin and gene environment, limiting CRE comparisons to being qualitative. In recent years, the phiC31 based integration system was adapted for use in D. melanogaster to insert transgenes into specific genome landing sites8-10. This capability has made the quantitative measurement of gene and, relevant here, CRE activity11-13 feasible. The production of transgenic fruit flies can be outsourced, including phiC31-based integration, eliminating the need to purchase expensive equipment and/or have proficiency at specialized transgene injection protocols. 
Here, we present a general protocol to quantitatively evaluate a CRE&prime;s activity, and show how this approach can be used to measure the effects of an introduced mutation on a CRE&prime;s activity and to compare the activities of orthologous CREs. Although the examples given are for a CRE active during fruit fly metamorphosis, the approach can be applied to other developmental stages, fruit fly species, or model organisms. Ultimately, a more widespread use of this approach to study CREs should advance an understanding of regulatory logic and how logic can vary and evolve.

Quantitative Comparison of cis-Regulatory Element CRE Activities in Transgenic Drosophila melanogaster

Phenotypic variation for traits can result from mutations in cis-regulatory element (CRE) sequences that control gene expression patterns. Methods derived for use in Drosophila melanogaster can quantitatively compare the levels of spatial and temporal patterns of gene expression mediated by modified or naturally occurring CRE variants.

Uygulamalarda Kantitatif Karşılaştırılması Cis</emTransgenik>-Regulatory Element (CRE) Etkinlikler Drosophila melanogaster</em

Gene expression patterns are specified by cis-regulatory element (CRE) sequences, which are also called enhancers or cis-regulatory modules. A typical CRE ...

Blood Collection for Biochemical Analysis in Adult Zebrafish

The zebrafish has been used as an animal model for studies of several human diseases. It can serve as a powerful preclinical platform for studies of molecular events and therapeutic strategies as well as for evaluating the physiological mechanisms of some pathologies1. 
There are relatively few publications related to adult zebrafish physiology of organs and systems2, which may lead researchers to infer that the basic techniques needed to allow the exploration of zebrafish systems are lacking3. Hematologic biochemical values of zebrafish were first reported in 2003 by Murtha and colleagues4 who employed a blood collection technique first described by Jagadeeswaran and colleagues in 1999. Briefly, blood was collected via a micropipette tip through a lateral incision, approximately 0.3 cm in length, in the region of the dorsal aorta5. Because of the minute dimensions involved, this is a high-precision technique requiring a highly skilled practitioner. The same technique was used by the same group in another publication in that same year6. In 2010, Eames and colleagues assessed whole blood glucose levels in zebrafish7. They gained access to the blood by performing decapitations with scissors and then inserting a heparinized microcapillary collection tube into the pectoral articulation. They mention difficulties with hemolysis that were solved with an appropriate storage temperature based on the work Kilpatrick et al.8. When attempting to use Jagadeeswaran's technique in our laboratory, we found that it was difficult to make the incision in precisely the right place as not to allow a significant amount of blood to be lost before collection could be started. 
Recently, Gupta et al.9 described how to dissect adult zebrafish organs, Kinkle et al.10 described how to perform intraperitoneal injections, and Pugach et al.11 described how to perform retro-orbital injections. However, more work is needed to more fully explore basic techniques for research in zebrafish.
The small size of zebrafish presents challenges for researchers using it as an experimental model. Furthermore, given this smallness of scale, it is important that simple techniques are developed to enable researchers to explore the advantages of the zebrafish model.

This paper presents a technique for collection of blood from the dorsal aorta of Zebrafish. It also provides instructions for obtaining serum for use in biochemical analyses, such as tests for determining cholesterol and triglyceride levels.

Yetişkin Zebra balığı Biyokimyasal Analiz için Kan Alma

The zebrafish has been used as an animal model for studies of several human diseases. It can serve as a powerful preclinical platform for studies of ...

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

The nematode C. elegans has emerged as an important model for the study of conserved genetic pathways regulating fat metabolism as it relates to human obesity and its associated pathologies. Several previous methodologies developed for the visualization of C. elegans triglyceride-rich fat stores have proven to be erroneous, highlighting cellular compartments other than lipid droplets. Other methods require specialized equipment, are time-consuming, or yield inconsistent results. We introduce a rapid, reproducible, fixative-based Nile red staining method for the accurate and rapid detection of neutral lipid droplets in C. elegans. A short fixation step in 40% isopropanol makes animals completely permeable to Nile red, which is then used to stain animals. Spectral properties of this lipophilic dye allow it to strongly and selectively fluoresce in the yellow-green spectrum only when in a lipid-rich environment, but not in more polar environments. Thus, lipid droplets can be visualized on a fluorescent microscope equipped with simple GFP imaging capability after only a brief Nile red staining step in isopropanol. The speed, affordability, and reproducibility of this protocol make it ideally suited for high throughput screens. We also demonstrate a paired method for the biochemical determination of triglycerides and phospholipids using gas chromatography mass-spectrometry. This more rigorous protocol should be used as confirmation of results obtained from the Nile red microscopic lipid determination. We anticipate that these techniques will become new standards in the field of C. elegans metabolic research.

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

We present robust biochemical and microscopic methods for studying Caenorhabditis elegans lipid stores. A rapid, simple, fixing-staining procedure for fluorescent lipid droplet imaging leverages the spectral properties of the lipophilic dye Nile red. We then present biochemical measurement of triglycerides and phospholipids using solid phase extraction and gas chromatography-mass spectrometry.

Fat Kütle Biyokimyasal ve Yüksek Verimli Mikroskobik Değerlendirme<em&gt; Caenorhabditis Elegans</em

The nematode C. elegans has emerged as an important  model for the study of conserved genetic pathways regulating fat metabolism as  it relates to human ...

Biochemical Titration of Glycogen In vitro

Glycogen is the main energetic polymer of glucose in vertebrate animals and plays a crucial role in whole body metabolism as well as in cellular metabolism. Many methods to detect glycogen already exist but only a few are quantitative. We describe here a method using the Abcam Glycogen assay kit, which is based on specific degradation of glycogen to glucose by glucoamylase. Glucose is then specifically oxidized to a product that reacts with the OxiRed probe to produce fluorescence. Titration is accurate, sensitive and can be achieved on cell extracts or tissue sections. However, in contrast to other techniques, it does not give information about the distribution of glycogen in the cell. As an example of this technique, we describe here the titration of glycogen in two cell lines, Chinese hamster lung fibroblast CCL39 and human colon carcinoma LS174, incubated in normoxia (21% O2) versus hypoxia (1% O2). We hypothesized that hypoxia is a signal that prepares cells to synthesize and store glycogen in order to survive1.

Biochemical Titration of Glycogen In vitro

We describe here an accurate, reproducible and convenient biochemical method for titration of glycogen in vitro. This technique uses the Abcam Glycogen assay kit and is based on successive hydrolysis of glycogen to glucose and glucose titration by fluorescence.

Glikojenin Biyokimyasal titrasyonu<em&gt; In vitro</em

Glycogen is the main energetic polymer of glucose in vertebrate animals and plays a crucial role in whole body metabolism as well as in cellular ...

Generation and Purification of Human INO80 Chromatin Remodeling Complexes and Subcomplexes

INO80 chromatin remodeling complexes regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Human INO80 complexes consist of 14 protein subunits including Ino80, a SNF2-like ATPase, which serves both as the catalytic subunit and the scaffold for assembly of the complexes. Functions of the other subunits and the mechanisms by which they contribute to the INO80 complex&#39;s chromatin remodeling activity remain poorly understood, in part due to the challenge of generating INO80 subassemblies in human cells or heterologous expression systems. This JOVE protocol describes a procedure that allows purification of human INO80 chromatin remodeling subcomplexes that are lacking a subunit or a subset of subunits. N-terminally FLAG epitope tagged Ino80 cDNA are stably introduced into human embryonic kidney (HEK) 293 cell lines using Flp-mediated recombination. In the event that a subset of subunits of the INO80 complex is to be deleted, one expresses instead mutant Ino80 proteins that lack the platform needed for assembly of those subunits. In the event an individual subunit is to be depleted, one transfects siRNAs targeting this subunit into an HEK 293 cell line stably expressing FLAG tagged Ino80 ATPase. Nuclear extracts are prepared, and FLAG immunoprecipitation is performed to enrich protein fractions containing Ino80 derivatives. The compositions of purified INO80 subcomplexes can then be analyzed using methods such as immunoblotting, silver staining, and mass spectrometry. The INO80 and INO80 subcomplexes generated according to this protocol can be further analyzed using various biochemical assays, which are described in the accompanying JOVE protocol. The methods described here can be adapted for studies of the structural and functional properties of any mammalian multi-subunit chromatin remodeling and modifying complexes.

This protocol describes a procedure for generating and purifying wild type and mutant versions of the human INO80 chromatin remodeling complex. Epitope tagged versions of INO80 subunits are stably expressed in HEK293 cells, and complete complexes and complexes lacking specific sets of subunits are purified by immunoaffinity chromatography.

Nesil ve İnsan INO80 Kromatin Yaptırma Kompleksleri ve subcomplexes saflaştırılması

INO80 chromatin remodeling complexes regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Human INO80 ...

Isolation of Specific Genomic Regions and Identification of Associated Molecules by enChIP

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the functions of these regions. To enable the non-biased identification of molecules interacting with a specific genomic region of interest, we recently developed the engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) technique. Here, we describe how to use enChIP to isolate specific genomic regions and identify the associated proteins and RNAs. First, a genomic region of interest is tagged with a transcription activator-like (TAL) protein or a clustered regularly interspaced short palindromic repeats (CRISPR) complex consisting of a catalytically inactive form of Cas9 and a guide RNA. Subsequently, the chromatin is crosslinked and fragmented by sonication. The tagged locus is then immunoprecipitated and the crosslinking is reversed. Finally, the proteins or RNAs that are associated with the isolated chromatin are subjected to mass spectrometric or RNA sequencing analyses, respectively. This approach allows the successful identification of proteins and RNAs associated with a genomic region of interest.

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the functions of these regions. This protocol describes procedures to perform engineered DNA-binding molecule-mediated chromatin imunoprecipitation (enChIP) for identification of proteins and RNAs associated with a specific genomic region.

Belirli Genomik Bölgeler ve enChIP tarafından İlişkili Moleküllerin Tanımlanması İzolasyonu

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

Retroviral Entegrasyon Siteleri Amplifikasyon, Yeni Nesil Sıralama ve Genomik DNA Haritalama

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...