Work in the authors' laboratory is supported by a grant from the National Institute of General Medical Sciences (GM41628) and by a grant to the Stowers Institute for Medical Research from the Helen Nelson Medical Research Fund at the Greater Kansas City Community Foundation.

1. ATP&#39;ye bağımlı Nükleozom Tadilat Tahliller Nükleozom remodeling aktiviteleri ATP&#39;ye bağımlı ölçmek için, ya da immüno-INO80 INO80 subcomplexes ATP ve 216 bp, 32 P-etiketli DNA fragmanının bir ucunda yer alan, tek bir nükleozom içeren bir alt-tabaka mononucleosomal, inkübe edilir. Reaksiyon ürünleri daha sonra yerli poli-akrilamid jeli içinde elektroforez işlemine tabi tutulmuştur. <ol><li> 32 P-etiketli, &#39;601&#39; DNA fragmanını meydana getirmek için, gelen amplifiye pGEM-3Z-601 4 oligonükleotitleri olarak 5&#39;-ve 5&#39;-ACAGGATGTATATATCTGACACGTGCCTGG AATACTCAAGCTTGGATGCCTGCAG kullanan bir uç konuma 601 nükleozom konumlandırma dizisini ihtiva eden bir 216 bp&#39;lik bir DNA fragmanı ileri ve geri primerler. <ol><li> Tablo 1 de tarif edildiği gibi, bir 100 | il PCR reaksiyonu ayarlayın. </li><li> Aşağıdaki programı kullanarak bir termal döngü PCR reaksiyonları gerçekleştirin: 1 dk 96 ° C, followe de94 ° C, 57 ° C, 30 döngü için 72 ° C&#39;de 60 saniye, 30 saniye ile 45 saniye D; 72 ° C &#39;de, 7 dakika ile biten. </li><li> PCR reaksiyon tamamlandıktan sonra, nükleaz içermeyen döndürme kolonları boyunca iki kez, reaksiyon ürünlerinin geçirilmesiyle mümkün bağlanamayan nükleotidleri gidermek. </li><li> PCR reaksiyonu, arzu edilen ~ 216 bp&#39;lik bir DNA fragmanı elde onaylamak için% 1.2 agaroz jeli içinde saflaştırılmış PCR ürünü 5 ul çalıştırın. </li><li> Saflaştınlmış PCR ürünü, 20-kat 5 ul seyreltin ve bir UV spektrofotometresi kullanılarak DNA konsantrasyonları ölçülür. Ortalama verim ~ 40 ng / ul. </li><li> Bir ışıma sayacı içinde arıtılmış PCR ürünü 1 ul radyoaktivite ölçülür. Cpm / ng hesaplayarak etiketleme verimliliği tahmin. Başarılı bir etiketleme reaksiyonu 601 DNA fragmanının ~ 15,000 cpm / ng elde etmesi beklenmektedir. </li></ol></li><li> Bir seri seyreltme yöntemi kullanılarak 5 etiketli 601 DNA üzerine Hela hücre nükleozom aktarın. <ol><li> 2 pmol karıştırın32 P-etiketli 601 DNA fragmanı ile HeLa nükleozom 6 ug 1.0 M NaCl, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.1 mM PMSF ve 1 mM ihtiva eden bir tampon maddesi 50 ul (5 tarif edildiği gibi hazırlanmıştır) DTT ve 30 dakika boyunca 30 ° C&#39;de inkübe edin. </li><li> Sıralı 0.8 M, 0.6 M seyreltin ve 10 mM Tris-HCI (pH 8.0), 1 mM EDTA, 0.1 mM PMSF, sırasıyla 12.5 ul, 20.8 ul, 41.6 ul, seyreltme ile 0.4 M NaCI, ve 1 mM DTT, her bir seyreltmeden sonra 30 ° C de 30 dakika inkübasyon ile. </li><li> Bundan başka, bir 30 dakika inkübasyon ile, sonra% 0.1 Nonidet P-40,% 20 gliserol ve 200 ug / ml BSA ihtiva eden aynı tampon 250 ul, 125 ul eklenmesi ile 0.1 M NaCl, sonra 0.2 M ve seyreltin ve son iki dilüsyonu arasında 30 ° C&#39;de ilave edildi. 3 aya kadar 4 ° C &#39;de mononucleosome tabakayı saklayın. </li></ol></li><li> 10 ul bir toplam hacim içinde ATP&#39;ye bağımlı nükleozom kayar reaksiyonları gerçekleştirmek. ReaINO80 nükleozom biçimlenme aktivitesi için en uygun NaCl konsantrasyonu olduğu ölü m bileşenler. Tablo 2&#39;de listelenen 50 mM NaCI (yayınlanmamış sonuçlar) dikkate bulunan NaCI miktarı göz önüne alındığında, 50 mM NaCl, her reaksiyonda toplam konsantrasyonunu ayarlamak nükleozomlardan ve enzim preparatları. <ol><li> Tahlillerinde başlamadan önce, yerli poli-akrilamid jelleri (18 x 16 cm) attı. % 5 akrilamid içeren, tek bir jel hazırlamak için (akrilamid: bisakrilamid 37,5: 1) ile, 0.5x TBE (45 mM Tris, borat, 1 mM EDTA),% 0.01 amonyum persülfat (BP), ve% 0.001 N, N, N &#39;, N&#39;-tetrametiletilendiamin (TEMED). Tablo 3&#39;te listelenen bileşenler karışımı jel oda sıcaklığında en az 2 saat boyunca polimerize olmaya bırakın. </li><li> Her bir reaksiyonun gerçekleşmesi için arada, önceden soğutulmuş bir silikonize 1.5 ml mikrosantrifüj tüpü ~ 20 nM ya da INO80 INO80 subcomplex birleştirmek (EB100 tampon miktarı ile (3 tarif edildiği gibi hazırlanmıştır) <strzun&gt; yeterli Tablo 4) 4.75 ul bir hacim elde edildi. Hemen toz halinde kuru buz veya sıvı azot içinde kalan INO80 içeren fraksiyonların yeniden dondurma. </li><li> &#39;X&#39; faktörü ile yukarı ölçeklendirme, bileşenlerin geri kalanı ile bir usta kokteyl kurmak (nerede reaksiyonlar X = toplam sayı +3). Tek bir 10 ul reaksiyon için gerekli olan her bir bileşenin miktarı, Tablo 5&#39;te listelenmiştir; tarifi yapılacak reaksiyon sayısına göre büyük çapta üretim için gerekmektedir. Bir Pipetman tüp dokunarak veya yukarı pipetle ve aşağı İyice karıştırın ve bir tezgah üstü mikrosantrifuj&#39;de birkaç saniye boyunca tüp spin. </li><li> Adım 1.3.2 kurmak reaksiyon tüplerinin her için ana kokteyli 5,25 ul koyun. Yukarı ve aşağı pipetleme ile iyice karıştırın. 30 ° C ısıtma bloğu ya da su banyosuna reaksiyon tüpleri transfer reaksiyonları başlatmak ve 2 saat süreyle inkübe edin. </li><li> Bu arada, rakip DNA içeren kokteyl &#39;mix kaldırarak&#39; hazırlamakve nukleosomlar, X (reaksiyonlar + 4 X = toplam sayısı) bir faktör tarafından ölçeklendirme. Tek bir reaksiyon karışımı için kaldırma 1,5 ul hazırlamak için gerekli olan her bir bileşenin miktarı, Tablo 6&#39;da listelenmiştir; tarifi yapılacak deneyler sayısına bağlı olarak büyük çapta üretim için gerekmektedir. </li><li> Çıkarmadan karışımı 1.5 ul ekleyerek reaksiyonları sonlandırın. İyice karıştırın, aşağı doğru dönmeye ve bir 30 dakika daha 30 ° C&#39;de inkübe edin. </li><li> Bununla birlikte, sabit bir tampon dolaşımını sağlamak için, alt odasının iç tarafında bir manyetik karıştırma çubuğu ile tampon olarak 0.5x TBE kullanılarak 4 ° C&#39;de 30 dakika boyunca 100 V&#39;ta elektroforez birimi dikey olarak yerli poliakrilamid jel ön çalıştırın. </li><li> , Örnek yük 3x TBE,% 30 gliserol,% 0.25 bromofenol mavisi,% 0.25 ksilen siyanol FF ihtiva eden yükleme boyası 2.5 ul ekleyin. Kısaca örnekleri döner, iyice karıştırın ve yükleme uçları kullanılarak jel üzerine yerleştirin. </li><li> Tampon sirkülasyon ile 4 ° C sıcaklıkta 4,5 saat boyunca 200 V&#39;de jel çalıştırın.</li><li> Sinyali tespit etmek için, filtre kağıdı iki tabakanın bir yığın jel aktarın. Şeffaf bir plastik sarım ile üst jeli ile filtre kağıdı sarın ve daha sonra arzu edilen süre boyunca 4 ° C&#39;de depolama fosfor ekranına maruz kalmaktadır. </li><li> Bir izotop görüntüleme tarayıcı sistemi ile ekran tarama ve uygun yazılım kullanarak verileri analiz. </li></ol></li></ol> 2. Mononucleosome Bağlanma Analizleri Mononucleosomes için belirli bir INO80 kompleksinin bağlanma afinitesini tahlil edilmesi için, Adım 1.2 üretilen mononucleosomal alt-tabaka kullanılarak bir elektroforetik mobilite kayma deneyiyle (EMSA), gerçekleştirin. <ol><li> Reaksiyon nükleozom yeniden modelleme deneyleri için anlatıldığı şekilde, fakat reaksiyonlardan ATP kaldırma karışımı ihmal bağlayıcı bağlanma analizleri için karışımları ayarlama; 30 dakika boyunca 30 ° C&#39;de inkübe edin. </li><li> Her reaksiyon karışımına yükleme boyası 2.5 ul,% 3.5 akrilamid (akrilamid içeren bir yerli poliakrilamid jel için geçerlidir: 3 bis7.5: 1),% 1 gliserol, 0.5x TBE% 0.01 APS ve% 0.001 TEMED. </li><li> Tampon olarak kullanarak 0.5x TBE tampon sirkülasyon ile 4 ° C &#39;de 2.5 saat boyunca 200 V&#39;de jel üzerinde çalıştırıldı ve depolama fosfor ekranına maruz kalmaktadır. </li></ol> 3. DNA-bağımlı ve Nükleozom ATPaz Tahliller 20 mM Tris-HCl (pH 7.5), 60 mM NaCI, 6.6 mM MgCl2, 0.8 mM EDTA, 0.015% Nonidet P-40,% 2.5 gliserol, 0.1 mg / ml BSA, 1 ihtiva eden 5 ul reaksiyon karışımlarında ATPase deneyleri gerçekleştirmek mM DTT, 0.1 mM PMSF, 2 mM ATP, [α- 32P] ATP, 2 uCi (3,000 Ci / mmol) eklenmiştir. INO80 kompleksinin her INO80 kompleksi ya da miktar için dairesel plazmid DNA ölçmek için (5000 bp ~ 30 nM) kapalı içeren DNA- ya nucleosome bağımsız ATPaz, bir ölçmek için üç paralel reaksiyonlar, tek içeren EB100 tampon kurmak denenmiştir için DNA- bağımlı ATPaz ve nucleosome-bağımlı ATPaz ölçmek için bir HeLa oligonüklezomlar (~ 185 nM) içeren. Buz üzerinde bütün tepkileri ayarlayın. <ol&gt; <li> Her bir reaksiyon için, önceden soğutulmuş yağlanmış bir 1.5 ml mikrosantrifüj tüpleri içinde 2.2 ul bir hacim elde etmek için yeterli EB100 tampon bir miktarı ile ya da immüno INO80 INO80 subcomplexes 10-50 nM birleştirir. Hemen toz halinde kuru buz veya sıvı azot içinde bir INO80 içeren fraksiyonların yeniden dondurma. </li><li> Bir usta kokteyl ayarlayın. Tek bir reaksiyon için gerekli olan her bir bileşenin miktarı, Tablo 7&#39;de listelenmiştir., X = INO80 preparatların bir sayısının tahlil edilmesi 3 (X + 2) +1 bir unsur tarafından ölçekleme ile tarifi ölçeğinin. </li><li> &#39;Sub-Kokteylleri&#39; içeren tampon hazırlamak için sadece, DNA veya nukleosomlar, üç ayrı tüpler içine usta kokteyl 2.5 (X + 2) ul dağıtmak. 0.3 ya da EB100 bölgesinin (X + 2) ul, kapalı, dairesel plazmid DNA (1.5 ug / ml) ya da Hela oligonüklezomlar (1.5 ug / ul) ekleyin ve iyice karıştırın. </li><li> St kurmak enzim içeren bir reaksiyon tüpüne uygun alt kokteyli 2.8 ul koyunep 3.1. Hafifçe karıştırın aşağı yukarı pipet ve; kabarcıkları tanıtan kaçının. </li><li> , Reaksiyonlarını başlatmak 30 ° C ısı bloğu reaksiyon tüpleri aktarmak için. </li><li> En az 1.5 cm uzakta alt kenarı düz bir hat içinde 5, 15, 30, ve inkübasyon 60 dakika sonra, bir selüloz polietilenimin ince tabaka kromatografisi üzerine her tepkime karışımı 0.5 ul nokta (TLC), levha (20 x 10 cm) . Hemen birden çok zaman noktaları, tek bir tüpten alınabilir 30 ° C ısıya bloğuna reaksiyon tüpleri döner. Boyandıktan sonra, bir fön makinesi kullanıyorsanız TLC plakaları kurulayın. </li><li> TLC plakasının alt 0.5 cm çözelti içinde sokulmasına izin kadar 0,375 M potasyum fosfat (pH 3.5) ihtiva eden bir cam bölmeye TLC plakalarına aktarın. </li><li> Bölmesi kapağı ve sıvı fazın ön TLC plakalarının üst ulaşana kadar gelişir. Anında iyice bir darbe kurutma makinesi kullanarak plakaları kurulayın. </li><li> Oda sıcaklığında depolama fosfor ekranına kurutulmuştur, TLC plakaları Açığa.Bir izotop görüntüleme tarayıcı sistemi ile ekran tarama ve radyoaktif ATP substrat ve ADP ürünün miktarını belirlemek. </li><li> ATP hidroliz miktarının hesaplanması için aşağıdaki formül kullanılarak başlangıç ​​reaksiyon karışımı içinde mevcut olan ATP miktarı ile hidrolize% ATP çarpma: pmol ATP hidroliz = 10 pmol ATP Reaksiyon x başlayarak [ADP / (ATP + ADP)] </li></ol>

<ol>
	<li>Clapier, C. R., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+chromatin+remodeling+complexes.">The biology of chromatin remodeling complexes.</a> Annual Review of Biochemistry. 78, 273-304 (2009).</li><li>Narlikar, G. J., Sundaramoorthy, R., Owen-Hughes, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+and+functions+of+ATP-dependent+chromatin-remodeling+enzymes.">Mechanisms and functions of ATP-dependent chromatin-remodeling enzymes.</a> Cell. 154 (3), 490-503 (2013).</li><li>Chen, L., Ooi, S. K., Conaway, J. W., Conaway, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+purification+of+human+INO80+chromatin+remodeling+complexes+and+subcomplexes.">Generation and purification of human INO80 chromatin remodeling complexes and subcomplexes.</a> , (2013).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> J. Mol. Biol. 276 (1), (1006).</li><li>Owen-Hughes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+nucleosome+disruption+by+ATP-driven+chromatin+remodeling+complexes.">Analysis of nucleosome disruption by ATP-driven chromatin remodeling complexes.</a> Methods Mol. Biol. 119, 319-331 (1999).</li><li>Udugama, M., Sabri, A., Bartholomew, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+INO80+ATP-dependent+chromatin+remodeling+complex+is+a+nucleosome+spacing+factor.">The INO80 ATP-dependent chromatin remodeling complex is a nucleosome spacing factor.</a> Mol. Cell Biol. 31 (4), 662-673 (2011).</li><li>Jin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mammalian+chromatin+remodeling+complex+with+similarities+to+the+yeast+INO80+complex.">A mammalian chromatin remodeling complex with similarities to the yeast INO80 complex.</a> Journal of Biological Chemistry. 280 (50), 41207-41212 (1074).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subunit+organization+of+the+human+INO80+chromatin+remodeling+complex:+an+evolutionarily+conserved+core+complex+catalyzes+ATP-dependent+nucleosome+remodeling.">Subunit organization of the human INO80 chromatin remodeling complex: an evolutionarily conserved core complex catalyzes ATP-dependent nucleosome remodeling.</a> Journal of Biological Chemistry. 286 (13), 11283-11289 (2011).</li><li>Hamiche, A., Sandaltzopoulos, R., Gdula, D. A., Wu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATP-dependent+histone+octamer+sliding+mediated+by+the+chromatin+remodeling+complex+NURF.">ATP-dependent histone octamer sliding mediated by the chromatin remodeling complex NURF.</a> Cell. 97 (7), 833-842 (1999).</li><li>Polach, K. J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restriction+enzymes+as+probes+of+nucleosome+stability+and+dynamics.">Restriction enzymes as probes of nucleosome stability and dynamics.</a> Methods Enzymol. 304, 278-298 (1999).</li><li>Anderson, J. D., Thastrom, A., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+of+proteins+to+buried+nucleosomal+DNA+target+sites+occurs+via+a+mechanism+that+is+distinct+from+nucleosome+translocation,+Mol.Cell+Biol.">Spontaneous access of proteins to buried nucleosomal DNA target sites occurs via a mechanism that is distinct from nucleosome translocation, Mol.Cell Biol.</a> 22 (20), 7147-7157 (2002).</li><li>Saha, A., Wittmeyer, J., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+remodeling+through+directional+DNA+translocation+from+an+internal+nucleosomal+site.">Chromatin remodeling through directional DNA translocation from an internal nucleosomal site.</a> Nature Structural and Molecular Biology. 12 (9), 747-755 (2005).</li><li>Gottschalk, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ADP-ribosyl)ation+directs+recruitment+and+activation+of+an+ATP-dependent+chromatin+remodeler,+Proc.Natl.Acad.Sci.U.S.A.">Poly(ADP-ribosyl)ation directs recruitment and activation of an ATP-dependent chromatin remodeler, Proc.Natl.Acad.Sci.U.S.A.</a> 106 (33), 13770-13774 (2009).</li><li>Clapier, C. R., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+ISWI+involves+inhibitory+modules+antagonized+by+nucleosomal+epitopes.">Regulation of ISWI involves inhibitory modules antagonized by nucleosomal epitopes.</a> Nature. 492 (7428), 280-284 (2012).</li><li>Brune, M., Hunter, J. L., Corrie, J. E. T., Direct Webb, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-Time+Measurement+of+Rapid+Inorganic+Phosphate+Release+Using+a+Novel+Fluorescent+Probe+and+Its+Application+to+Actomyosin+Subfragment+1+ATPase,+Biochemistry.">Real-Time Measurement of Rapid Inorganic Phosphate Release Using a Novel Fluorescent Probe and Its Application to Actomyosin Subfragment 1 ATPase, Biochemistry.</a> 33 (27), 8262-8271 (1994).</li><li>Luk, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stepwise+histone+replacement+by+SWR1+requires+dual+activation+with+histone+H2A.Z+and+canonical+nucleosome.">Stepwise histone replacement by SWR1 requires dual activation with histone H2A.Z and canonical nucleosome.</a> Cell. 143 (5), 725-736 (2010).</li></ol>

The authors declare that they have no competing financial interests.

, Ve yeniden modelleme ve / veya enzimler ATPaz kirletici biz deneylerde uyulması, nükleozom şekillenmesi ve ATPaz aktiviteleri INO80 komplekslerin katalitik aktivitesine bağlı sağlamak için, rutin deney nükleozom modelleme ve INO80 komplekslerin katalitik olarak aktif olmayan ATPaz aktivitesi, saflaştırılır Yabani tip INO80 aynı prosedür kullanılarak paralel. INO80 kompleksi ya da subcomplexes farklı preparatlar içinde etkinliklerini karşılaştırmak, deney yöntemi için karmaşık hale ATP ve / vey...

SnF2 aile kromatin biçimlenme kompleksleri merkezi SnF2 gibi ATPaz alt birimini 1,2 içerir. Tek alt-birim enzimler gibi bazı SnF2 gibi ATPaz fonksiyonu, diğer daha büyük bir çoklu alt birim kompleksi katalitik alt-birimi olarak işlev yaparken. Biçimlenme kompleksleri onların faaliyetlerine katkıda kromatinin alt birimlerinin her biçimlenme sürecini incelemek biyokimyasal analizleri gerçekleştirmek için yeteneği gerektiren hangi moleküler mekanizmaların tanıtılması. İnsan INO80 kompleksi ve diğer enzimler tarafından yeniden yapılanma kromatin ATP&#39;ye bağımlı nükleozom yeniden modelleme, kendi DNA- ve / veya nükleozom bağımlı ATPaz aktivasyonu takiben, nükleozomlann için yeniden şekillenme enzimin bağlanması ile başlayan bir çok-aşamalı bir süreç olarak tasavvur edilebilir nükleozomal DNA ve nükleozomlardan 1,2 nihai konumlandırılması hakkında yeniden şekillenme enzim translokasyon. ATP&#39;ye bağımlı kromatin değiştirme prosesinin r molekül ayrıntılarını anlamakreaksiyonun her aşaması için kromatin remodeling karmaşık bireysel alt birimlerinin katkıları biçimlenme kendi bireysel adımlar içine reaksiyonu ve tanımı diseksiyonu equires. Bu tür analizler in vitro tanımlanmış moleküler alt tabakalar kullanılarak nucleosome biçimlenme ve diğer faaliyetlerini analiz yeteneği gerektirir. Önceki bir JOVE protokol, tanımlanmış ait birim bileşimleri ile 3 INO80 kromatin biçimlenme kompleksleri ve subcomplexes oluşturmak için kullanılan prosedürleri tarif. Burada, biz, DNA&#39;ya ve nucleosome-aktive ATPaz ve bu kompleksleri ile ilişkili nucleosome biçimlenme faaliyetlerini bağlayıcı nucleosome kantitatif analizini sağlayan üç biyokimyasal analizler sunmak.

<table><tbody><tr><td>Protease Inhibitor Cocktail</td><td>Sigma</td><td>P8340</td><td></td></tr><tr><td>10x PCR reaction buffer&amp;nbsp;</td><td>Roche Applied Science&amp;nbsp;</td><td>11435094001</td><td></td></tr><tr><td>Roche Taq DNA Polymerase</td><td>Roche Applied Science&amp;nbsp;</td><td>11435094001</td><td></td></tr><tr><td>NucAway Nuclease-free Spin Columns&amp;nbsp;</td><td>Ambion</td><td>Cat. # AM10070</td><td></td></tr><tr><td>ultrapure ATP&amp;nbsp;</td><td>USB/Affymetrix</td><td>77241 25 UM</td><td></td></tr><tr><td>bovine serum albumin&amp;nbsp;</td><td>Sigma</td><td>A9418&amp;nbsp;</td><td></td></tr><tr><td>40% Acrylamide/Bis 37.5:1</td><td>Amresco</td><td>0254-500ML</td><td></td></tr><tr><td>Sonicated salmon sperm DNAs&amp;nbsp;</td><td>GE Healthcare</td><td>27-4565-01</td><td></td></tr><tr><td>10% ammonium persulfate (APS)</td><td>Thermo Scientific</td><td>17874</td><td></td></tr><tr><td>benzonase&amp;nbsp;</td><td>Novagen</td><td>Cat. No. 70664</td><td></td></tr><tr><td>dCTP, [&amp;alpha;-&lt;sup&gt;32&lt;/sup&gt;P]- 6,000 Ci/mmol</td><td>PerkinElmer</td><td>BLU013Z250UC</td><td></td></tr><tr><td>PCR thermal cycler PTC 200</td><td>MJ Research</td><td>PTC 200</td><td></td></tr><tr><td>Hoefer vertical electrophoresis unit</td><td>Hoefer</td><td>SE600X-15-1.5</td><td></td></tr><tr><td>lubricated 1.5 ml microcentrifuge tubes&amp;nbsp;</td><td>Costar</td><td>3207</td><td></td></tr><tr><td>Storage Phosphor Screen&amp;nbsp;</td><td>Molecular Dynamics</td><td>63-0034-79</td><td></td></tr><tr><td>3MM filter paper</td><td>Whatman&amp;nbsp;</td><td>28458-005</td><td>VWR</td></tr><tr><td>Typhoon PhosphorImager&amp;nbsp;</td><td>GE Healthcare</td><td>8600</td><td></td></tr><tr><td>ImageQuant software</td><td>GE Healthcare</td><td>ver2003.02</td><td></td></tr><tr><td>TLC Glass Plates, PEI-Cellulose F</td><td>Millipore</td><td>5725-7</td><td></td></tr><tr><td>Immobilon-FL Transfer Membrane 7 x 8.4</td><td>Millipore</td><td>IPFL07810</td><td></td></tr><tr><td>General purpose survey meter with end-window or pancake GM (Geiger-Mueller) probe</td><td>Biodex</td><td>Model 14C</td><td></td></tr></tbody></table>

biochemical assays for analyzing activities of atp-dependent chromatin remodeling enzymes

Members of the SNF2 family of ATPases often function as components of multi-subunit chromatin remodeling complexes that regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Biochemically dissecting the contributions of individual subunits of such complexes to the multi-step ATP-dependent chromatin remodeling reaction requires the use of assays that monitor the production of reaction products and measure the formation of reaction intermediates. This JOVE protocol describes assays that allow one to measure the biochemical activities of chromatin remodeling complexes or subcomplexes containing various combinations of subunits. Chromatin remodeling is measured using an ATP-dependent nucleosome sliding assay, which monitors the movement of a nucleosome on a DNA molecule using an electrophoretic mobility shift assay (EMSA)-based method. Nucleosome binding activity is measured by monitoring the formation of remodeling complex-bound mononucleosomes using a similar EMSA-based method, and DNA- or nucleosome-dependent ATPase activity is assayed using thin layer chromatography (TLC) to measure the rate of conversion of ATP to ADP and phosphate in the presence of either DNA or nucleosomes. Using these assays, one can examine the functions of subunits of a chromatin remodeling complex by comparing the activities of the complete complex to those lacking one or more subunits. The human INO80 chromatin remodeling complex is used as an example; however, the methods described here can be adapted to the study of other chromatin remodeling complexes.

Rakamlar nükleozom kayar (Şekil 1) ve bağlayıcı (Şekil 2) ve deneyler DNA- veya nükleozom bağlı ATPaz deneyleri (Şekil 3) de dahil olmak üzere INO80 aktivitelerini karakterize etmek için kullanılır biyokimyasal tahlillerde temsili sonuçlar göstermektedir. Şekil 1 &#39;de gösterilen deney sağlam INO80 komplekslerinin yeteneği FLAG Ies2 veya FLAG INO80E ile arıtılmış INO80 bir 216 bp radyo etiketli DNA ...

Watch this Scientific Journal Video about Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes at JoVE.com

Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes

Here we describe biochemical assays that can be used to characterize ATP-dependent chromatin remodeling enzymes for their abilities to 1) catalyze ATP-dependent nucleosome sliding, 2) engage with nucleosome substrates, and 3) hydrolyze ATP in a nucleosome- or DNA-dependent manner.

ATP-bağımlı Kromatin Tadilat Enzimler Faaliyetlerinin Analizi için biyokimyasal Tahliller

Members of the SNF2 family of ATPases often function as components of multi-subunit chromatin remodeling complexes that regulate nucleosome dynamics and ...

biochemical-assays-for-analyzing-activities-atp-dependent-chromatin

Research

JoVE Journal

Biology

14.7K Görüntüleme.  Stowers Institute for Medical Research. Here we describe biochemical assays that can be used to characterize ATP-dependent chromatin remodeling enzymes for their abilities to 1) catalyze ATP-dependent nucleosome sliding, 2) engage with nucleosome substrates, and 3) hydrolyze ATP in a nucleosome- or DNA-dependent manner.

Video: Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes

Sequential Salt Extractions for the Analysis of Bulk Chromatin Binding Properties of Chromatin Modifying Complexes

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous nature of most mammalian chromatin-modifying complexes. In order to overcome these hurdles, we have adapted a sequential salt extraction (SSE) assay for evaluating the relative binding affinities of chromatin-bound complexes. This easy and straightforward assay can be used by non-experts to evaluate the relative difference in binding affinity of two related complexes, the changes in affinity of a complex when a subunit is lost or an individual domain is inactivated, and the change in binding affinity after alterations to the chromatin landscape. By sequentially re-suspending bulk chromatin in increasing amounts of salt, we are able to profile the elution of a particular protein from chromatin. Using these profiles, we are able to determine how alterations in a chromatin-modifying complex or alterations to the chromatin environment affect binding interactions. Coupling SSE with other in vitro and in vivo assays, we can determine the roles of individual domains and proteins on the functionality of a complex in a variety of chromatin environments.

Sequential salt extraction of chromatin bound proteins is a useful tool for determining the binding properties of large protein complexes. This method can be employed to evaluate the role of individual subunits or domains in the overall affinity of a protein complex to bulk chromatin.

Kromatin kompleksleri değiştirme özelliklerini bağlama toplu Kromatin analizi için sıralı tuz çekimi

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous ...

Genetik

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for example, during cellular differentiation, morphogenesis, and functional stimulation (such as activation of immune cells), or after exposure to drugs and other factors from the local environment. Depending on the stimulus and cell type, these changes occur rapidly and at any possible level of gene regulation. Displaying all molecular processes of a responding cell to a certain type of stimulus/drug is one of the hardest tasks in molecular biology. Here, we describe a protocol that enables the simultaneous analysis of multiple layers of gene regulation. We compare, in particular, transcription factor binding (Chromatin-immunoprecipitation-sequencing (ChIP-seq)), de novo transcription (4-thiouridine-sequencing (4sU-seq)), mRNA processing, and turnover as well as translation (ribosome profiling). By combining these methods, it is possible to display a detailed and genome-wide course of action.
Sequencing newly transcribed RNA is especially recommended when analyzing rapidly adapting or changing systems, since this depicts the transcriptional activity of all genes during the time of 4sU exposure (irrespective of whether they are up- or downregulated). The combinatorial use of total RNA-seq and ribosome profiling additionally allows the calculation of RNA turnover and translation rates. Bioinformatic analysis of high-throughput sequencing results allows for many means for analysis and interpretation of the data. The generated data also enables tracking co-transcriptional and alternative splicing, just to mention a few possible outcomes.
The combined approach described here can be applied for different model organisms or cell types, including primary cells. Furthermore, we provide detailed protocols for each method used, including quality controls, and discuss potential problems and pitfalls.

This protocol describes the combinatorial use of ChIP-seq, 4sU-seq, total RNA-seq, and ribosome profiling for cell lines and primary cells. It enables tracking changes in transcription-factor binding, de novo transcription, RNA processing, turnover and translation over time, and displaying the overall course of events in activated and/or rapidly changing cells.

Gerçek zamanlı analiz bağlama, transkripsiyon, çeviri ve ciro hücresel etkinleştirme sırasında küresel olayları görüntülemek üzere transkripsiyon faktörü

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for ...

In Vitro Ubiquitination and Deubiquitination Assays of Nucleosomal Histones

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination of chromatin function and DNA-associated processes. This modification involves a sequential action of several enzymes including E1 ubiquitin-activating, E2 ubiquitin-conjugating and E3 ubiquitin-ligase and is reversed by deubiquitinases (DUBs). Ubiquitination induces degradation of proteins or alteration of protein function including modulation of enzymatic activity, protein-protein interaction and subcellular localization. A critical step in demonstrating protein ubiquitination or deubiquitination is to perform in vitro reactions with purified components. Effective ubiquitination and deubiquitination reactions could be greatly impacted by the different components used, enzyme co-factors, buffer conditions, and the nature of the substrate.&#160; Here, we provide step-by-step protocols for conducting ubiquitination and deubiquitination reactions. We illustrate these reactions using minimal components of the mouse Polycomb Repressive Complex 1 (PRC1), BMI1, and RING1B, an E3 ubiquitin ligase that monoubiquitinates histone H2A on lysine 119. Deubiquitination of nucleosomal H2A is performed using a minimal Polycomb Repressive Deubiquitinase (PR-DUB) complex formed by the human deubiquitinase BAP1 and the DEUBiquitinase ADaptor (DEUBAD) domain of its co-factor ASXL2. These ubiquitination/deubiquitination assays can be conducted in the context of either recombinant nucleosomes reconstituted with bacteria-purified proteins or native nucleosomes purified from mammalian cells. We highlight the intricacies that can have a significant impact on these reactions and we propose that the general principles of these protocols can be swiftly adapted to other E3 ubiquitin ligases and deubiquitinases.

Ubiquitination is a post-translational modification that plays important roles in cellular processes and is tightly coordinated by deubiquitination. Defects in both reactions underlie human pathologies. We provide protocols for conducting ubiquitination and deubiquitination reaction in vitro using purified components.

Nükliosomal Histones in vitro Ubiquitination ve Deubiquitination bulguları

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination ...

Biyokimya

Assays for Validating Histone Acetyltransferase Inhibitors

Lysine acetyltransferases (KATs) catalyze acetylation of lysine residues on histones and other proteins to regulate chromatin dynamics and gene expression. KATs, such as CBP/p300, are under intense investigation as therapeutic targets due to their critical role in tumorigenesis of diverse cancers. The development of novel small molecule inhibitors targeting the histone acetyltransferase (HAT) function of KATs is challenging and requires robust assays that can validate the specificity and potency of potential inhibitors.
This article outlines a pipeline of three methods that provide rigorous in vitro validation for novel HAT inhibitors (HATi). These methods include a test tube HAT assay, Chromatin Hyperacetylation Inhibition (ChHAI) assay, and Chromatin Immunoprecipitation-quantitative PCR (ChIP-qPCR). In the HAT assay, recombinant HATs are incubated with histones in a test tube reaction, allowing for acetylation of specific lysine residues on the histone tails. This reaction can be blocked by a HATi and the relative levels of site-specific histone acetylation can be measured via immunoblotting. Inhibitors identified in the HAT assay need to be confirmed in the cellular environment.
The ChHAI assay uses immunoblotting to screen for novel HATi that attenuate the robust hyperacetylation of histones induced by a histone deacetylase inhibitor (HDACi). The addition of an HDACi is helpful because basal levels of histone acetylation can be difficult to detect via immunoblotting.
The HAT and ChHAI assays measure global changes in histone acetylation, but do not provide information regarding acetylation at specific genomic regions. Therefore, ChIP-qPCR is used to investigate the effects of HATi on histone acetylation levels at gene regulatory elements. This is accomplished through selective immunoprecipitation of histone-DNA complexes and analysis of the purified DNA through qPCR. Together, these three assays allow for the careful validation of the specificity, potency, and mechanism of action of novel HATi.

Inhibitors of histone acetyltransferases (HATs, also known as lysine acetyltransferases), such as CBP/p300, are potential therapeutics for treating cancer. However, rigorous methods for validating these inhibitors are needed. Three in vitro methods for validation include HAT assays with recombinant acetyltransferases, immunoblotting for histone acetylation in cell culture, and ChIP-qPCR.

Histon Asetiltransferaz Inhibitörlerinin Doğrulanması için tahliller

Lysine acetyltransferases (KATs) catalyze acetylation of lysine residues on histones and other proteins to regulate chromatin dynamics and gene ...

Kanser Araştırmaları

CD Spectroscopy to Study DNA-Protein Interactions

Circular dichroism (CD) spectroscopy is a simple and convenient method to investigate the secondary structure and interactions of biomolecules. Recent advancements in CD spectroscopy have enabled the study of DNA-protein interactions and conformational dynamics of DNA in different microenvironments in detail for a better understanding of transcriptional regulation in vivo. The area around a potential transcription zone needs to be unwound for transcription to occur. This is a complex process requiring the coordination of histone modifications, binding of the transcription factor to DNA, and other chromatin remodeling activities. Using CD spectroscopy, it is possible to study conformational changes in the promoter region caused by regulatory proteins, such as ATP-dependent chromatin remodelers, to promote transcription. The conformational changes occurring in the protein can also be monitored. In addition, queries regarding the affinity of the protein towards its target DNA and sequence specificity can be addressed by incorporating mutations in the target DNA. In short, the unique understanding of this sensitive and inexpensive method can predict changes in chromatin dynamics, thereby improving the understanding of transcriptional regulation.

The interaction of an ATP-dependent chromatin remodeler with a DNA ligand is described using CD spectroscopy. The induced conformational changes on a gene promoter analyzed by the peaks generated can be used to understand the mechanism of transcriptional regulation.

DNA-Protein Etkileşimlerini İncelemek için CD Spektroskopisi

Circular dichroism (CD) spectroscopy is a simple and convenient method to investigate the secondary structure and interactions of biomolecules. Recent ...

In Vitro Characterization of Histone Chaperones using Analytical, Pull-Down and Chaperoning Assays

Histone proteins associate with DNA to form the eukaryotic chromatin. The basic unit of chromatin is a nucleosome, made up of a histone octamer consisting of two copies of the core histones H2A, H2B, H3, and H4, wrapped around by the DNA. The octamer is composed of two copies of an H2A/H2B dimer and a single copy of an H3/H4 tetramer. The highly charged core histones are prone to non-specific interactions with several proteins in the cellular cytoplasm and the nucleus. Histone chaperones form a diverse class of proteins that shuttle histones from the cytoplasm into the nucleus and aid their deposition onto the DNA, thus assisting the nucleosome assembly process. Some histone chaperones are specific for either H2A/H2B or H3/H4, and some function as chaperones for both. This protocol describes how in vitro laboratory techniques such as pull-down assays, analytical size-exclusion chromatography, analytical ultra-centrifugation, and histone chaperoning assay could be used in tandem to confirm whether a given protein is functional as a histone chaperone.

In Vitro Characterization of Histone Chaperones using Analytical, Pull-Down and Chaperoning Assays

This protocol describes a battery of methods that includes analytical size-exclusion chromatography to study histone chaperone oligomerization and stability, pull-down assay to unravel histone chaperone-histone interactions, AUC to analyze the stoichiometry of the protein complexes, and histone chaperoning assay to functionally characterize a putative histone chaperone in vitro.

İn Vitro Histon Chaperonlarının Analitik, Pull-Down ve Chaperoning Testleri Kullanılarak Karakterizasyonu

Histone proteins associate with DNA to form the eukaryotic chromatin. The basic unit of chromatin is a nucleosome, made up of a histone octamer consisting ...

Deciphering Molecular Mechanism of Histone Assembly by DNA Curtain Technique

Chromatin is a higher-order structure that packages eukaryotic DNA. Chromatin undergoes dynamic alterations according to the cell cycle phase and in response to environmental stimuli. These changes are essential for genomic integrity, epigenetic regulation, and DNA metabolic reactions such as replication, transcription, and repair. Chromatin assembly is crucial for chromatin dynamics and is catalyzed by histone chaperones. Despite extensive studies, the mechanisms by which histone chaperones enable chromatin assembly remains elusive. Moreover, the global features of nucleosomes organized by histone chaperones are poorly understood. To address these problems, this work describes a unique single-molecule imaging technique named DNA curtain, which facilitates the investigation of the molecular details of nucleosome assembly by histone chaperones. DNA curtain is a hybrid technique that combines lipid fluidity, microfluidics, and total internal reflection fluorescence microscopy (TIRFM) to provide a universal platform for real-time imaging of diverse protein-DNA interactions.Using DNA curtain, the histone chaperone function of Abo1, the Schizosaccharomyces pombe bromodomain-containing AAA+ ATPase, is investigated, and the molecular mechanism underlying histone assembly of Abo1 is revealed. DNA curtain provides a unique approach for studying chromatin dynamics.

DNA curtain, a high-throughput single-molecule imaging technique, provides a platform for real-time visualization of diverse protein-DNA interactions. The present protocol utilizes the DNA curtain technique to investigate the biological role and molecular mechanism of Abo1, a Schizosaccharomyces pombe bromodomain-containing AAA+ ATPase.

Histon Düzeneğinin Moleküler Mekanizmasının DNA Perde Tekniği ile Deşifre Edilmesi

Chromatin is a higher-order structure that packages eukaryotic DNA. Chromatin undergoes dynamic alterations according to the cell cycle phase and in ...

Chromatin Immunoprecipitation (ChIP) to Assay Dynamic Histone Modification in Activated Gene Expression in Human Cells

In response to a variety of extracellular ligands, the STAT (signal transducer and activator of transcription) transcription factors are rapidly recruited from their latent state in the cytoplasm to cell surface receptors where they are activated by phosphorylation at a single tyrosine residue1. They then dimerize and translocate to the nucleus to drive the transcription of target genes, affecting growth, differentiation, homeostasis and the immune response. Not surprisingly, given their widespread involvement in normal cell processes, dysregulation of STAT function contributes to human disease, particularly to cancers2 and autoimmune diseases3. It is well established that transcription is regulated by alterations to the chromatin template4,5. These alterations include the activities of ATP-dependent complexes, as well as covalent histone modifications and DNA methylation6. Because STAT activation of gene expression is both rapid and transient, it requires specific mechanisms for modulating the chromatin template at STAT-dependent gene loci. To define these mechanisms, we characterize the histone modifications and the enzymatic activities that generate them at gene loci that respond to STAT signaling. This protocol describes chromatin immunoprecipitation, a method that is valuable for the study of STAT signaling to chromatin in activated gene expression.

Chromatin Immunoprecipitation ChIP to Assay Dynamic Histone Modification in Activated Gene Expression in Human Cells

This protocol describes how chromatin immunoprecipitation (ChIP) is used to study the dynamic alterations to the chromatin template that regulate transcription induced by a signal transduction pathway.

Kromatin Immunoprecipitation İnsan Hücrelerinde Aktif Gen İfadesi Testi Dinamik Histon Modifikasyon (ChIP)

In response to a variety of extracellular ligands, the STAT (signal transducer and activator of transcription) transcription factors are rapidly recruited ...

Biyoloji

HAT1 Enzim Aktivitesinin Taranması için Tıklama Tabanlı Bir Testin Geliştirilmesi

An Acetyl-Click Chemistry Assay to Measure Histone Acetyltransferase 1 Acetylation

HAT1, also known as Histone acetyltransferase 1, plays a crucial role in chromatin synthesis by stabilizing and acetylating nascent H4 before nucleosome assembly. It is required for tumor growth in various systems, making it a potential target for cancer treatment. To facilitate the identification of compounds that can inhibit HAT1 enzymatic activity, we have devised an acetyl-click assay for rapid screening. In this simple assay, we employ recombinant HAT1/Rbap46, which is purified from activated human cells. The method utilizes the acetyl-CoA analog 4-pentynoyl-CoA (4P) in a click-chemistry approach. This involves the enzymatic transfer of an alkyne handle through a HAT1-dependent acylation reaction to a biotinylated H4 N-terminal peptide. The captured peptide is then immobilized on neutravidin plates, followed by click-chemistry functionalization with biotin-azide. Subsequently, streptavidin-peroxidase recruitment is employed to oxidize amplex red, resulting in a quantitative fluorescent output. By introducing chemical inhibitors during the acylation reaction, we can quantify enzymatic inhibition based on a reduction of the fluorescence signal. Importantly, this reaction is scalable, allowing for high throughput screening of potential inhibitors for HAT1 enzymatic activity.

Yazar Spotlight: HAT1 İnhibitörü Taraması için Asetil-Tıklama Testi Geliştirme

Quick and accurate chemical assays to screen for specific inhibitors are an important tool in the drug development arsenal. Here, we present a scalable acetyl-click chemistry assay to measure the inhibition of HAT1 acetylation activity.

Histon Asetiltransferaz 1 Asetilasyonunu Ölçmek için Bir Asetil-Tıklama Kimyası Testi

HAT1, also known as Histone acetyltransferase 1, plays a crucial role in chromatin synthesis by stabilizing and acetylating nascent H4 before nucleosome ...

ATP-bağımlı Kromatin Tadilat Enzimler Faaliyetlerinin Analizi için biyokimyasal Tahliller

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

Kromatin kompleksleri değiştirme özelliklerini bağlama toplu Kromatin analizi için sıralı tuz çekimi

Gerçek zamanlı analiz bağlama, transkripsiyon, çeviri ve ciro hücresel etkinleştirme sırasında küresel olayları görüntülemek üzere transkripsiyon faktörü

Nükliosomal Histones in vitro Ubiquitination ve Deubiquitination bulguları

Histon Asetiltransferaz Inhibitörlerinin Doğrulanması için tahliller

DNA-Protein Etkileşimlerini İncelemek için CD Spektroskopisi

İn Vitro Histon Chaperonlarının Analitik, Pull-Down ve Chaperoning Testleri Kullanılarak Karakterizasyonu

Histon Düzeneğinin Moleküler Mekanizmasının DNA Perde Tekniği ile Deşifre Edilmesi

Kromatin Immunoprecipitation İnsan Hücrelerinde Aktif Gen İfadesi Testi Dinamik Histon Modifikasyon (ChIP)

Histon Asetiltransferaz 1 Asetilasyonunu Ölçmek için Bir Asetil-Tıklama Kimyası Testi

Histon Asetiltransferaz 1 Asetilasyonunu Ölçmek için Bir Asetil-Tıklama Kimyası Testi