This research was funded by Doris Duke Charitable Foundation, Burroughs Wellcome Fund, NIH R21DK080994, Duke Chancellor's pilot project fund, the Roche Foundation for Anemia Research and The Bill and Melinda Gates Foundation. G.L. is supported by Duke's UPGG and the NIH (Grant # 5R01AI090141-03) and K.A.W. by the NSF Graduate Research Fellowship Program.

1: P. Küçük ebatlı RNA İzolasyonu IDC Sırasında Falciparum <ol><li> Eşeysiz kültüründe 29 sıtma parazitleri edinin. NOT: Gerekli kültür boyutu istenen başvuru üzerine göre değişir; Bununla birlikte,% 3-5 parazitemi ve% 5 hematokrit bir 10 ml kültür, gerçek zamanlı PCR (RT-PCR) için yeterli RNA içerir. Tekniği başlangıçta asenkron kültürler için optimize edilmiş, ancak enfeksiyon döngüsü sırasında belirli bir zaman noktaları arzu edildiğinde, halka sahne parazitler geç 10-12 saat işgal sonrası daha sorbitol senkronizasyonu ile senkronize edilebilir. Senkronizasyon bir devir (yaklaşık 48 saat) 29 sonra tekrar edilmelidir. </li><li> Havuz enfekte hücreler bir araya (~ 5 x 10 9 eritrositler% 3-5 parasitemia at) ve kırmızı pelet hücreleri frensiz 5 dakika boyunca 800 xg&#39;de tüp ve santrifüj üstüne soğuk PBS doldurun. </li><li> Santrifüj işleminden sonra, ekli, dikkatli bir aspirasyon pipet kullanarak süpernatant kaldırmakbir vakuma, eritrosit pelet yana çıkarmak kolaydır. Soğuk 1x PBS ile bir kez daha topak yıkayın. </li><li> 30 dakika boyunca buz üzerinde tekrar süspansiyon hücre (1x PBS içinde) soğuk% 0.15 saponin içinde pelet ve yer. </li><li> 4 ° C&#39;de 12 dakika süreyle 1500 xg&#39;de Santrifüj hücreleri, soğuk PBS süpernatant (renkli koyu kırmızı olacak) ve tekrar süspansiyon pelet çıkarın. Bir kez daha bu adımı yineleyin. NOT: Bu mikroRNAlar parazit olan mikroRNA yansıtıcı olup eritrosit kirlenme olmasını sağlamak için, parazit, tecrit koşulları bir takım test edilmiştir: 1) bir saponin liziz, 2) bir saponin liziz RnazA konakçı hücre miRNA&#39;ların tedavisi ve 3 ile birlikte ) Metil-beta-siklodekstrin tedavi konak eritrositlerinden parazit kaldırmak için. Tüm tedaviler benzer sonuçlar verdi. </li><li> Lyse lizis tamponu tavsiye 600 ul kullanarak izole parazit pelet. Liziz tamponu Bu birim ~% 2 hematokrit ile% 5 parazitemi 30 mi kadar kültürler için yeterlidir. NOT: Daha büyük parazit kültürleri için, bu hacim artırılabilir. En az 1 dakika boyunca tam bir vorteks ile parazit pelet tamamen parçalama sağlamak için önemlidir. Ayrıca, ekstre kolaylığı için, lize numuneleri 1,7 ml mikrosantrifüj tüpüne transfer edilebilir. </li><li> Homojenat, ilave madde (2 M sodyum asetat, pH 4) arasında, 60 ul ya da aşama 6&#39;da kullanılan parçalama tamponu 1/10 hacim. </li><li> 10 dakika boyunca buz üzerinde örneklerin bırakın. </li><li> 600 ul veya her biri 1 dakika numune ve vorteks asit fenol choloroform arasında, Aşama 6&#39;da ilave lizis tamponu miktarına eşit bir hacim. </li><li> 5 dakika boyunca 10.000 x g&#39;de santrifüjleme ile örnekleri, sulu ve organik fazlar ayırın. Bu durum döner tüm hemoglobin / hemozoin organik fazda olmasını sağlamak için daha uzun kit önerdiği daha uzundur. </li><li> Üst (sulu) tabakayı toplayın ve yeni bir tüp aktarın. Sulu faz yanlısı anlaşılacağı renk (daha büyük olasılıkla) kahverengi, beyaz ya da tekrarlayın 9 ve 10 numaralı adımlarıtein kirlenme. </li><li> Pipetle elde edilen üstte kalan sıvı kısmın hacmi tayin edilir ve daha sonra% 100 etanol (~ 800 | il), 1.25 birimleri eklemek 1,7 ml mikrosantrifüj tüpü 5 kez ters yüz edilerek karıştırılır. </li><li> 1 dakika süre ile ya da vakum manifoldu kullanılarak 14.000 x g&#39;de santrifüjleme ile, ya bir mesafede RNA bağlayıcı filtre kartuşundan her bir örnek (ticari olarak temin edilebilir çeşitli olan) geçirin. </li><li> MiRNA 700 ul tampon 1 1 dakika için 14,000 xg&#39;de iplik, bir mıkro kullanarak yıkama ile filtre kartuşunu yıkayın. </li><li> Iki kez 1 dakika her biri için 14.000 x g&#39;de santrifüjleme ile 500 ul yıkama tamponu ile filtre kartuşunu 2/3 yıkayın. </li><li> 1 dakika her biri için 14.000 x g santrifüj, 50 ul iki yıkamalarda, 95 ° C &#39;ısıtılmış olan 100 ul DEPC su ile Elute RNA. 260 nm&#39;de UV absorbansı ile RNA konsantrasyonu ölçümü. NOT: RNA jel (TBE üre-akrilamid veya denatüre edici formaldehit agaroz jel olarak) olabilir be izole RNA&#39;ların büyüklük dağılımını değerlendirmek için kullanılan. NOT: Bu RNA mikrodizinin RNA-dizisi, Northern blot ve ribonükleaz koruma deneyi ile analiz için uygundur. </li></ol> 2: P. Küçük ebatlı RNA&#39;ların kantitasyonu IDC Sırasında Falciparum <ol><li> 260 nm&#39;de UV spektrofotometrisi kullanılarak adım 1 &#39;de izole edilmiş tek tek örneklerinin konsantrasyonunu belirler. </li><li> İstenilen RNA türleri için real-time PCR primerleri oluşturun. MRNAların ya da füzyon miRNA mRNA biz SYBR yeşil için primerler dizayn ederken miRNA için yalnız biz, önceden hazırlanmış miRNA qPCR deneyleri kullanılır. Ters mRNA dizisi (: ATCGAACATGCTGTGAACAT PKA-R) &#39;de miRNA&#39;nın alt bir gen spesifik primer ~ 100 bp iken: Füzyon RNA&#39;lar için, ileri primer MiRNA dizisi, (AAACCGTTACCATTACTGAGTT miR-451) idi. </li><li> Kullanarak, RNA numuneleri, ya mRNA ve / veya miRNA için miRNA&#39;ların (RNA 20-40 ng kullanımı), tek başına veya rastgele heksamerler bir firkete primeri cDNA sağlayın-mRNA füzyon türleri (RNA&#39;nın 1 | ig kullanılarak). Oda sıcaklığına kadar daha sonra soğuk, 65 ° C &#39;de 5 dakika süre ile, RNA ve primerler karıştırın. Daha sonra, ters transkriptaz karışımı ekleyin (0.5 ul ters transkriptaz, 0.5 ul RNaz inhibitörü, 1 ul dNTP (her biri 2.5 mM), 4 ul 5x tamponu, 2 ul 0.1 M DTT, 1 ul H2O). <ol><li> SYBR yeşil veya TaqMan probu ya saptayabilen bir termo Run örnekler. Spesifik genlerin PCR 30 kantitatif yeşil SYBR using, 40 çevrim için, bir 3-aşama PCR, 15 sn için 95 ° C, en primer tavlama sıcaklığı eksi 30 saniye için 5 ° C olarak çalışır, ve 30 saniye süreyle 68 ° C olan Ticari SYBR yeşil master miks. MiRNA gerçek zamanlı PCR, 40 çevrim için, 1 dakika süre ile, iki aşamalı bir PCR gibi 15 sn için 95 ° C ve 60 ° C çalıştırıldı. </li><li> ΔΔCt yöntemiyle tahlilleri sayısal olarak ve her iki Rab GTPaz (PF08_0110) ya da 18S rRNA 31 karşı normalize. </li></ol></li></ol> 3: GirişSıtma Parazitler içine Küçük RNA&#39;lar <ol><li> Transfeksiyon başına kırmızı kan hücrelerinin 300 ul Pelet freni 1, 5 dakika boyunca 800 x g&#39;de santrifüj ile tam bir sıtma medya (eritrosit 250 ul, yaklaşık 1.5 x 10 9 hücreleri, sonuçta kullanılacağı). </li><li> RPMI ve tam cytomix (120 mM KCI içinde tekrar süspansiyon ile iki kez yıkanır, eritrositleri, 0,15 mM CaCl2, 10 mM K 2 HPO 4 / KH 2 PO 4, pH 7.6; 25 mM HEPES, pH 7.6, 2 mM EGTA, pH 7.6; 5 mM MgCl2; fren 1, 5 dakika boyunca 800 x g&#39;de santrifüje tabi tutulmasımn ardından% 50 hematokrit) KOH ile ayarlandı. </li><li> 0.2 cm elektroporasyon küvetine hücreleri aktarın. </li><li> Küvetler özel sentetik oligonükleotidlerin, 10 ug veya uygun miktarda ekleyin ve kültürleri tekrar süspansiyon. </li><li> 310 V / 950 iF için elektro-ayarlayın ve her küvete bir darbe teslim. </li><li> Önceden ısıtılmış tam mal olarak küvetin içinde eritrosit 300 ul yeniden süspansearia araçları ve 24 yuvalı plakalar içinde onları plaka ve sıtma kan gazı karışımı ile hava geçirmez bir kapta 37 ° C&#39;de inkübe (% 3 O 2,% 5 CO2). </li><li> 4 saat sonra,% 1 yaklaşık son parazitemi senkronize geç trofozoitleri ile transfekte eritrositlerde bulaştırmak. </li><li> Enfekte kültürlere, her 4-6 gün taze olarak transfekte eritrositlerde ekleyin ve bölüm 4 de belirtildiği gibi, YOYO-1 lekelemesi kullanılarak FACS ile% paraziteminin belirler. </li></ol> 4: Parazit Enfeksiyon Oranı üzerine Eritrosit mikroRNAlar Etkisinin Belirlenmesi <ol><li> 1.7 ml mikrosantrifüj tüpü içinde mikropipetöre sabit ve yerine göre yeniden süspanse kültürü 100 ul al. 5 dakika boyunca 800 x g&#39;de santrifüj ile bir masa üstü mikrosantrifüj 1 1x PBS ilave edildi ve santrifüj ile iki kez yıkanır. </li><li> % 0.025 glutaraldehit 1 ml süspanse pelet. Oda sıcaklığında 20 dakika boyunca inkübe edin. Not: örnekler 4 ° C&#39;de birkaç hafta muhafaza edilebilir. Daha sonra, enfekte R pelet5 dakika boyunca 800 x g&#39;de santrifüj ile BC ler. 1x 1 ml PBS ile iki kez yıkanır. </li><li> % 0.015 saponin 1 ml süspanse pelet. 15 dakika boyunca 4 ° C&#39;de inkübe edilir. Pelet 5 dakika boyunca 800 x g&#39;de santrifüj ile RBC bulaştırılır. 1x 1 ml PBS ile iki kez yıkanır. Repeat.4.3. 1x PBS 1 ul (1,000X), DNA leke ihtiva eden 1 ml içinde süspanse hücreleri. </li><li> 488 nM eksitasyon, bir akış sitometresi üzerinde parazitemi derece belirlemek ~ 530 nM (FL-1) emisyonu. </li><li> İlk olarak, kapı FSC ve SSC dayalı sitometresi akış eritrosit odaklanmak. Sonra FL-1 kanal floresan kapı RBC parazitemya derecelerde (enfekte eritrositler) ölçün. NOT: Daha sonra sahne parazitler erken evre parazitler daha 10X daha floresan, ve bulaşmamış eritrosit yukarıda ~ 100X. Aynı zamanda, düşük hızda toplama gürültü azaltma eğilimi gösterir. Son olarak, bu yaklaşım 3H-Hipoksantin Kuruluş ve Giemsa boyama, daha önce 13 rapor hem de ve tüm teknikler gav kıyasla olmuşturbenzer sonuçlar e. </li></ol> 5: miRNA-mRNA Fusion Ürünlerinin Biotin-etiketleme ve Elution <ol><li> Doğrudan kovalent 5 &#39;ucuna operatif şekilde bağlanmış destiyobiyotin ile özel sentetik RNA oligonükleotidleri (DB) sipariş. </li><li> Aşama 3&#39;te gösterildiği gibi, destiobiyotin-konjüge edilmiş (DB) miRNA&#39;nın ve modifiye edilmemiş miRNA (negatif kontrol) ile birlikte enfekte olmamış eritrositlerde transfekte. </li><li> P. ile transfekte eritrositlerde Infect falsiparum% 0.5 (adım 1.1) bir başlangıç ​​parazitemya için parazitleri. </li><li> Aşama 1 &#39;de yukarıda tarif edildiği gibi parazit RNA daha sonra 4 gün (96 saat) ekstrakte edin. </li><li> Streptavidin boncuk dolu 50 ul parazit RNA 10 ug inkübe, mikropipet vasıtasıyla ilave edilmiş ve 4 ° C &#39;de 1 saat süre ile, bir mikrosantrifüj tüpü rotator döndürün. </li><li> 30 saniye için 800 x g&#39;de boncuk Pelet ve 20 mM KCI, 1/1000 RNaz inhibitörü ile yıkayın. </li><li> 2 mM biyotin ve 200 ul RNA yakalama elüsyon tamponu (20 mM KCI, 1/1 ile karşılaştırma yoluyla boncuklar Elute RNA&#39;lar4 ° C&#39;de, 000 RNaz inhibitör ve 2 mM biyotin) ° C sıcaklıkta gece boyunca rotasyon ile. </li><li> Belirtilen P. zenginleştirme derecesini belirlemek Adım 2&#39;de gösterildiği gibi, SYBR yeşil QRT-PCR ve TaqMan qPCR mikroRNA zenginleştirme (pozitif kontrol) ile falciparum transkript. </li></ol> 6: P. Ribosomal Kişiler belirleme Polizom Ayırma Falciparum <ol><li> 5 ml% 15 sukroz çözeltisi (400 mM potasyum asetat, 25 mM potasyum HEPES, pH 7.2, 15 mM magnezyum asetat, 200 uM sikloheksimid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase inhibitör ve% 15 sükroz yerleştirin ) Bir SW41 bir ultra santrifüj tüpüne (14 x 89 mm) içine. </li><li> 5 ml&#39;lik bir şırınga kullanarak, 5 ml% 50 sukroz çözeltisi (400 mM potasyum asetat, 25 mM potasyum HEPES, pH 7.2, 15 mM magnezyum asetat, 200 uM sikloheksimid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase ekleme Önleyici ve uzun çelik iğne kullanılarak% 15 sukroz altında% 50 sukroz), sonra iğneyi çıkarın. </li><li&gt; Parafilm ile gradyan tüpün üst Seal haddeleme önlemek için sabit pozisyonda, onun yüzüne yavaşça tüp eğin, böylece masa üzerine yatay olarak yalan söylüyor. En az 2 saat boyunca yan tüp tutun. Beklerken, adım 6.5 ile başlar. </li><li> 2 saat sonra, yavaş yavaş, dik boru eğme ve önceden örnek yükleme en az 15 dakika (aşama 14) için soğumasına izin buz tüp aktarın. </li><li> 100-500 toplam RNA ug veya% 3-5 parazitemi kabaca 100 ml&#39;lik asenkron kültürünü oluşturmak için yeterli Plasmodium enfekte olan kan sahne kültürü toplayın. 10x (2 mM) sikloheksimid (CHX) ihtiva eden kültür ortamına bu hacim inci 1/10 ilave edin ve 10 dakika boyunca 37 ° C&#39;de inkübe edin. <ol><li> Santrifüj Pelet kültürler santrifüj ile 7 dakika (fren 1) için 500 xg&#39;de sonra PBS 200 uM CHX içeren 1x oda sıcaklığı ile iki kez yıkayın. 200 uM CHX içeren 1x PBS içinde parazit kültürleri yeniden süspanse ve buz üzerinde saklayın. </li></ol></li&gt; <li> RBC pelet hacmi tahmin edin. Liziz tamponu (400 mM potasyum asetat, 25 mM potasyum HEPES, pH 7.2, 15 mM magnezyum asetat, 200 uM CHX, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase inhibitör,% 1 (h / h) IGEPAL CA ekleme -630, ve% 0.5 4.25 ml nihai hacme kadar RBC pelet DOC) (w / v). 4 ° C&#39;de inkübe lizat Dönerken 10 dakika süreyle ° C. </li><li> Mikrosantrifüj tüplerine lizat transferi ve daha sonra 16,000 x g&#39;de 4 ° C&#39;de ve bir mikrosantrfuj örnekleri santrifüj 10 dakika boyunca ° C. </li><li> 0.5 M, soğuk sükroz tampon çözeltisi (400 mM potasyum asetat, 25 mM potasyum HEPES, pH 7.2, 15 mM magnezyum asetat, 200 uM sikloheksimid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase ve 1.25 mi pipetleme sükroz yastıkları hazırlayın Bir SW55 bir ultra santrifüj tüpüne (13 x 51 mm) içine inhibitör ve 0.5 M sükroz). </li><li> Dikkatle bir şırınga ve küçük (~ 27) iğne kullanılarak sakaroz yastık üstünde (aşama 7&#39;den) lizat süpernatant 3.75 ml katman. StorBölüm 1 &#39;de gösterildiği gibi, e -80 ° C de geri kalan lisat (~ 500 | il), toplam RNA düzeyini elde etmek için. </li><li> 4 önceden soğutulmuş bir ultrasantrifüjdeki rotora içine örnekleri yükleyin 13.2 ml tüpler tutabilir ° C. 366,000 x g&#39;de örnekleri santrifüj ve 146 dakika boyunca 4 ° C. </li><li> Bir pipet kullanarak, bir 15 mL konik tüp içine süpernatant aktarın. Serbest (ribozomlar tarafından bağlı olmayan) RNA&#39;lar RNA izolasyonu için -80 ° C&#39;de süpernatan saklayın. </li><li> Ribozom yeniden süspansiyon tamponu (400 mM potasyum asetat, 25 mM potasyum HEPES, pH 7.2, 15 mM magnezyum asetat, 200 uM sikloheksimid, 1 mM DTT, 1 mM PMSF, ve 40 U / ml RNase İnhibitörü) 500 ul ribozom pelletini 5 dakika boyunca pipetleme. </li><li> 16.000 x g&#39;de, 4 ° C&#39;de bir mikrosantrfuj örnekleri santrifüj &#160; 10 dakika boyunca ° C. </li><li> Buz üzerinde adım # 4 den degrade tutarken, sonra dikkatlice degrade usi üstünde ribozom süspansiyon tabaka, Parafilm kaldırmakng bir şırınga ve küçük (~ 27) iğne. </li><li> Önceden soğutulmuş bir ultra santrifüj tüpü rotor içine yükleyin ve 200,000 x g ve 180 dakika boyunca 4 ° C &#39;de yüklü gradyanlar santrifüj. Spin tamamlandığında, mağaza 4&#39;te degradeler santrifüj Hazır olana kadar ° C kincinin üzerine yüklemek için. </li><li> Gradyan kısımlara içine boş bir ultra santrifüj tüpüne (bu, önceki bir çalışmada kullanılan tüp olabilir) takın ve 100 x 10 hızda 5 dakika boyunca düzgün miktarlan RNAse bulunmayan su ile yıkayınız. </li><li> Adımda 6.16 yıkama sırasında, UV absorbans dedektörün hassasiyetini ayarlamak. İyi bir başlangıç ​​hassasiyeti 0,2, ancak bu, daha sonra (parazit sayısı, vs göre değişir olan) bir 254 sinyaline göre çalışır ayarlanabilir gerekebilir. </li><li> Dedektör hassasiyeti ayarlandıktan sonra su detektörü akan iken, sıfıra taban sinyalini ayarlayın. </li><li> Çizgiler daha sonra rem boş ve kadar fraksiyon toplayıcı yıkadıktan sonra, sıvı akışını tersineBoş ultrasantrifüjdeki tüpü ove. </li><li> Iğne aparatı çıkıncaya kadar kincinin ile% 60 sukroz solüsyonu çalıştırın. </li><li> Sıkın üzerinde dikkat çekici, yükleme odasının üstündeki ilk degrade içeren tüp takın ve mühür sıkın. Daha sonra, iğne ile, tüpün alt kısmını delmek. </li><li> (Pompanın önündeki akış hızı kontrol düğmesi ile kontrol) 12.5 x 10 sıvı akış hızı Reset sonra 18 sn kesirler toplamak için otomatik fraksiyon toplayıcı ayarlamak (~ 330 ul / fraksiyon) mikrosantrifüj tüplerinde. </li><li> Ileri% 60 sukroz çözeltisi akışını başlatın. </li><li> Degrade çözümünün ilk açılan mikrosantrifüj tüp içine düştüğünde, hemen fraksiyon toplama ve A 254 sinyalin canlı kayıt, hem başlar. </li><li> Keskin bir düşüş% 50 ve% 60 sükroz çözeltiler arasındaki ara yüze karşılık gelen bir 254 sinyalinde bir gözlenmiştir, sıvı akışı ve bir 254 durdurulmasına </sub&gt; kaydı. </li><li> Gradyan kesirler de saklayın -80 &#160; Daha sonra kullanmak üzere ° C. </li><li> % 60 sakaroz çözeltisini ultrasantrifüjdeki tüp dışarı boşaltır kadar 100 x 10 hızında sıvı akışını tersine. </li><li> Damıtmak için ek degrade varsa, yükleme odasından boş ultrasantrifüjdeki tüp kaldırmak ve adım 6.21 den yeniden başlatın. Tüm numuneler tamamlandığında ise adımlarla 6.16 ve 6.19 gerçekleştirildi gibi aparat yıkayın. </li></ol>

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Malaria Report. , (2014).</li><li>Livincstone, F. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+human+polymorphisms.">Malaria and human polymorphisms.</a> Annu Rev Genet. 5, 33-64 (1971).</li><li>Nagel, R. L., Roth, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+red+cell+genetic+defects.">Malaria and red cell genetic defects.</a> Blood. 74, 1213-1221 (1989).</li><li>Aidoo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+effects+of+the+sickle+cell+gene+against+malaria+morbidity+and+mortality.">Protective effects of the sickle cell gene against malaria morbidity and mortality.</a> Lancet. 359, 1311-1312 (2002).</li><li>Tiffert, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+hydration+state+of+human+red+blood+cells+and+their+susceptibility+to+invasion+by+Plasmodium+falciparum.">The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum.</a> Blood. 105, 4853-4860 (2005).</li><li>Fairhurst, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+display+of+PfEMP-1+on+erythrocytes+carrying+haemoglobin+C+may+protect+against+malaria.">Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria.</a> Nature. 435, 1117-1121 (2005).</li><li>Cyrklaff, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemoglobins+S+and+C+interfere+with+actin+remodeling+in+Plasmodium+falciparum-infected+erythrocytes.">Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes.</a> Science. 334, 1283-1286 (2011).</li><li>Friedman, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Erythrocytic+mechanism+of+sickle+cell+resistance+to+malaria.">Erythrocytic mechanism of sickle cell resistance to malaria.</a> Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).</li><li>Pasvol, G., Weatherall, D. J., Wilson, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanism+for+the+protective+effect+of+haemoglobin+S+against+P.+falciparum+malaria.">Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria.</a> Nature. 274, 701-703 (1978).</li><li>Lecellier, C. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cellular+microRNA+mediates+antiviral+defense+in+human+cells.">A cellular microRNA mediates antiviral defense in human cells.</a> Science. 308, 557-560 (2005).</li><li>Niu, Q. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+artificial+miroRNAs+in+transgenic+Arabidopsis+thaliana+confers+virus+resistance.">Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance.</a> Nature biotechnology. 24, 1420-1428 (2006).</li><li>Zhao, G., Yu, D., Weiss, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+in+erythropoiesis.">MicroRNAs in erythropoiesis.</a> Curr Opin Hematol. 17, 155-162 (2010).</li><li>Lee, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LIN28B-mediated+expression+of+fetal+hemoglobin+and+production+of+fetal-like+erythrocytes+from+adult+human+erythroblasts+ex+vivo.">LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo.</a> Blood. 122, 1034-1041 (2013).</li><li>Sangokoya, C., Doss, J. F., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iron-responsive+miR-485-3p+regulates+cellular+iron+homeostasis+by+targeting+ferroportin.">Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin.</a> PLoS genetics. 9, e1003408 (2013).</li><li>Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genomic+analysis+of+erythrocyte+microRNA+expression+in+sickle+cell+diseases.">The genomic analysis of erythrocyte microRNA expression in sickle cell diseases.</a> PLoS ONE. 3, e2360 (2008).</li><li>Sangokoya, C., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=microRNA+miR-144+modulates+oxidative+stress+tolerance+and+associates+with+anemia+severity+in+sickle+cell+disease.">microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease.</a> Blood. 116, 4338-4348 (2010).</li><li>Deitsch, K., Driskill, C., Wellems, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+malaria+parasites+by+the+spontaneous+uptake+and+expression+of+DNA+from+human+erythrocytes.">Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes.</a> Nucleic acids research. 29, 850-853 (2001).</li><li>Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=trans+and+cis+splicing+in+trypanosomatids:+mechanism,+factors,+and+regulation.">trans and cis splicing in trypanosomatids: mechanism, factors, and regulation.</a> Eukaryotic cell. 2, 830-840 (2003).</li><li>Baum, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetics+and+comparative+genomics+reveal+RNAi+is+not+functional+in+malaria+parasites.">Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites.</a> Nucleic acids research. 37, 3788-3798 (2009).</li><li>Hall, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+survey+of+the+Plasmodium+life+cycle+by+genomic,+transcriptomic,+and+proteomic+analyses.">A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses.</a> Science. 307, 82-86 (2005).</li><li>Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+regulatory+dynamics+of+translation+in+the+asexual+blood+stages.">Genome-wide regulatory dynamics of translation in the asexual blood stages.</a> eLife. 3, (2014).</li><li>Oehring, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organellar+proteomics+reveals+hundreds+of+novel+nuclear+proteins+in+the+malaria+parasite+Plasmodium+falciparum.">Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum.</a> Genome biology. 13, R108 (2012).</li><li>Lasonder, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Plasmodium+falciparum+proteome+by+high-accuracy+mass+spectrometry.">Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry.</a> Nature. 419, 537-542 (2002).</li><li>Bozdech, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcriptome+of+the+intraerythrocytic+developmental+cycle+of+Plasmodium+falciparum.">The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum.</a> PLoS biology. 1, E5 (2003).</li><li>Gardner, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+human+malaria+parasite+Plasmodium+falciparum.">Genome sequence of the human malaria parasite Plasmodium falciparum.</a> Nature. 419, 498-511 (2002).</li><li>Zhang, M., Joyce, B. R., Sullivan, W. J., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+Plasmodium+and+toxoplasma+parasites.">Translational control in Plasmodium and toxoplasma parasites.</a> Eukaryotic cell. 12, 161-167 (2013).</li><li>Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+of+the+malaria+parasite+Plasmodium+falciparum.">Polysome profiling of the malaria parasite Plasmodium falciparum.</a> Molecular and biochemical parasitology. 179, 42-62 (2011).</li><li>Bunnik, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+reveals+translational+control+of+gene+expression+in+the+human+malaria+parasite+Plasmodium+falciparum.">Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum.</a> Genome biology. 14, R128 (2013).</li><li>LaMonte, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translocation+of+sickle+cell+erythrocyte+microRNAs+into+Plasmodium+falciparum+inhibits+parasite+translation+and+contributes+to+malaria+resistance.">Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance.</a> Cell host &amp; microbe. 12, 187-199 (2012).</li><li>Lambros, C., Vanderberg, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synchronization+of+Plasmodium+falciparum+erythrocytic+stages+in+culture.">Synchronization of Plasmodium falciparum erythrocytic stages in culture.</a> The Journal of parasitology. 65, 418-420 (1979).</li><li>Bourgeois, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+real-time+PCR+methods+with+blood+smears+and+rapid+diagnostic+test+in+Plasmodium+sp.+infection.">Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection.</a> Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).</li><li>Abruzzo, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+oligonucleotide+microarray+data+using+microfluidic+low-density+arrays:+a+new+statistical+method+to+normalize+real-time+RT-PCR+data.">Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data.</a> Biotechniques. 38, 785-792 (2005).</li><li>Sangokoya, C., LaMonte, G., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+microRNAs+of+human+mature+erythrocytes.">Isolation and characterization of microRNAs of human mature erythrocytes.</a> Methods in molecular biology. 667, 193-203 (2010).</li><li>Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+short+RNAs+in+the+malaria+parasite+and+its+red+blood+cell+host.">Analysis of short RNAs in the malaria parasite and its red blood cell host.</a> FEBS Lett. 580, 5185-5188 (2006).</li><li>Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=No+miRNA+were+found+in+Plasmodium+and+the+ones+identified+in+erythrocytes+could+not+be+correlated+with+infection.">No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection.</a> Malar J. 7, 47 (2008).</li></ol>

The authors have no competing financial interests to declare.

HbS o P. neden olduğu şiddetli sıtmaya karşı koruma sağlar, çünkü büyük ölçüde, sıtmanın endemik bölgelerde en yaygın hemoglobin varyantları biridir Falciparum. Teknikleri P. gen regülasyonu insan microRNA rolünü karakterize etmek gerekli Falciparum Bu yazının boyunca ayrıntılı olarak verilmektedir. Tüm küçük RNA&#39;ların içerecek şekilde toplam RNA ekstre edilmesi ve oldukça basit bir parazit lizis prosedürü uygulayarak olarak, bu füzyon RNA&#39...

Cinsi Plasmodium apicomplexan parazitlerin neden Sıtma, Her yıl dünya çapında yaklaşık 200 milyon kişiyi enfekte ve yaklaşık 600.000 kişinin ölümüne neden olan 1, en ​​yaygın insan parazitik bir hastalıktır. İnsanları enfekte eden beş Plasmodium türleri arasında, insan hastalığı ile en çok ilgili P. ve P. falciparum Şiddetli sıtma komplikasyonlar için onların yaygın dağılımları ve potansiyel nedeniyle Vivax. Sıtma parazitinin yaşam döngüsü sivrisinekler ve insanlarda hem de enfeksiyon gerektirir. Virüslü bir sivrisinek bir insanı ısırdığında, parazitler replikasyon başlangıç ​​yuvarlak meydana karaciğer, kan dolaşımı yoluyla seyahat. Ev sahibi hepatosit gelen merozoitler kopma sonra, aseksüel veya cinsel ya çoğaltma başlatarak, yakındaki kırmızı kan hücreleri enfekte. P. 48 saat sürer replikasyon aseksüel aşaması, en mal kaynağı hem beri falciparum, bu çalışmanın odak noktasıaria semptom ve kolayca in vitro değinmeyecek. Gelişmiş anti-sıtma terapileri de dahil olmak üzere kamu sağlığı girişimlerinin, bir dizi biraz küresel sıtma yükünü azalttık ederken, ilaca dirençli parazitlerin devam çıkması sıtma kontrolü çabaları için bir sorun oluşturur. Yeni tedavi yaklaşımları önerebilir bir alan genetik varyantlar sıtmaya karşı direnç kazandıran nasıl çeşitli üzerinde çalışmadır. Sıtmanın endemik olduğu bölgelerde, eritrosit polimorfizmleri çeşitli 2,3 oldukça yaygındır. Orak hücre belki de en belirgin olduğu bu mutasyonlar, semptomatik sıtma enfeksiyonu 4 başlamasından büyük bir direnç ile ilişkilidir. Onlar sıtma enfeksiyonu karşı eritrositler nedeni olan altta yatan mekanizmalar tam olarak anlaşılamamıştır. Hemoglobin mutasyonları ile parazitlenmiş eritrositler gelişmiş hücresel katılık ve dehidratasyon yoluyla geliştirilmiş fagositoz tabi olanP. azalarak işgali ile ilişkili 5 Falciparum. HbS, HbC allelin de eritrosit yüzeyine ve hücre iskeleti yeniden modellenmesi, daha da parazit gelişimini inhibe 6,7 protein ekspresyonunu etkilemektedir. Son olarak, P. Falciparum homozigot orak içinde kötü büyür (HbSS) sıtma direnci içsel faktörler eritrosit düşündüren, in vitro 8,9 eritrosit. Bu mekanizmaların her bir rol oynuyor gibi görünmektedir Ancak, tam sıtma orak hücre direnci arkasında mekanizmalarını açıklar yoktur. Yeterince anlaşılamamıştır eritrosit faktörlerden biri potansiyel seti olgun eritrositler içinde miRNA mevcut büyük havuzudur. MikroRNA&#39;lar 3 &#39;UTR içindeki baz çiftlemesi, çeviri ve / veya hedef mRNA stabilitesini aracılık 19-25 nt küçük boyutlu kodlayıcı olmayan RNA&#39;lar, bulunmaktadır. Bu bastırma-o dahil olmak üzere, memeli bağışıklık tepkilerinin kontrolünde implike edilmiştirf virüs replikasyonu, 10, ve bitkilerde virüslere karşı direnç gösterilmiştir Ayrıca eritropoezi 11,12 ve demir metabolizması 13 dahil olmak üzere birçok eritrosit süreçleri düzenleyen gösterilmiştir. Önceki çalışmalar ifadesi dramatik HBSS değiştirilmiş 14,15 eritrosit eritrosit miRNA&#39;lar, bir bol ve çeşitli nüfus tespit edilmiştir. Olgun eritrositler aktif transkripsiyon ve çeviri yoksun olduğundan, bu eritrosit miRNA&#39;lar fonksiyonel rolü belirsizliğini korumaktadır. Önemli malzeme değişimi konak hücreye ve P. arasında oluşur gibi intraerythrocytic gelişim döngüsü (IDC) 16 sırasında falciparum, bu HbS eritrositler içinde değişmiş miRNA profil doğrudan hücre içsel sıtma direncine katkıda bulunabilir iddia edildi. Bu çalışmalar sonunda, izole tespit ve fonksiyonel m olan, insan miRNA&#39;nın rolünü araştırmak için bir boru hattı geliştirilmesine yol açmıştıralaria parazit P. Bu konak / insan miRNA&#39;lar sonuçta kovalent sigorta ve sonra translasyon parazit mRNA transkriptleri 17 bastırmak olduğunu belirtti falciparum. Bu şekilde trans-ekleme ile oluşturulan ilk çapraz tür kimerik transkript bir örnek Resim ve miRNA mRNA füzyon diğer parazitler gibi diğer türlerde de meydana geliyor olabilir bir şekilde gösterir. Tüm tripanosom mRNAlar trans-splayslanmış bir bağlayıcı lideri (SL) ile polisistronik transkript 18 ayrılmasını düzenleyen bulunmaktadır. P. yana falciparum Dicer / Önce 19,20 için ortologlarını yoksun, bu eritrosit miRNA&#39;lar P. benzer SL makineleri kaçırmak mümkündür falsiparum hedef genlerin entegre. P. Son çalışmalar falsiparum Aslında 5 &#39;lider sekansların bağlantı 21 mevcudiyetine işaret vardır. Bu çalışma transkriptomik ve transla de dahil olmak, insan-parazit miRNA-mRNA füzyon transkriptleri keşfine yol açtı yöntemleri ayrıntılarıtional regülasyon teknikleri. Bu yöntemlerin genel amaçları P. gen regülasyonu, fenotipleri ve çeviri potansiyelinin küçük RNA&#39;ların etkilerini araştırmak için vardır Falciparum transkript. İnsan-parazit kimerik transkript ilk tanımlama gibi oldukça sadece küçük RNA&#39;lar izole teknikleri kullanarak daha toplam hem de küçük RNA&#39;lar dahil real-time PCR, transcriptome sıralama ve EST kütüphane yakalama gibi RNA analiz tekniklerinin kullanımı üzerine dayanıyordu. Büyük bir havuzda birlikte tüm RNA İzolasyon, ayrı ayrı olarak daha parazit hem transloke insan küçük RNA belirlenmesini yanı sıra daha büyük bir sekansın bir parçası olarak, bu küçük bir RNA dizilerinin varlığının sağladı. Bu daha sonra bu füzyonların fonksiyonel sonuçlarını belirlemek için bu füzyon mRNA&#39;ların çeviri devletin bir analizini gerekli. Parazitin genom bir karakterizasyonu kapsamlı çabalar ikend transcriptome parazitin biyoloji 22-25 anlayışına eklemiş, çok daha az P. yaşam döngüsü boyunca mRNA transcriptome öteleme yönetmelik hakkında bilinen Falciparum 26. Parazitin proteom Bu sınırlı anlayış parazitin biyoloji anlayışını ve anti-sıtma terapötik nesil için yeni hedefler belirlemek için yeteneği hem de engellemiştir. Parazitin hücre biyolojisi anlayış bu boşluk P. translasyonel düzenlemeyi incelemek için yeterli tekniklerin olmaması nedeniyle büyük ölçüde devam etmiştir Falciparum. Yakın zamanda kağıt P. ribozomal ayak izi kullanımını tarif Falciparum küresel çeviri durumunu belirlemek için 21. Transkript öteleme potansiyelinin biri iyi kurulmuş ölçüm Polizom profilleme tarafından belirlenen ilgili ribozomların sayısıdır. Bununla birlikte, ne bu teknik, P. uygulanır Falciparum &lt;/ em&gt;, en Polisomlar kurtarmak edemiyor ve ağırlıklı olarak monosomes yakalar. Son zamanlarda, çeşitli gruplar 27,28 P. optimize Polisomlar korumak ve ev sahibi kırmızı hücrelerin 28 kendi aseksüel gelişimi sırasında bu sıtma parazitlerinin ribozomal doluluk ve translasyonel potansiyelini karakterize etmek aynı zamanda eritrosit ve parazit parçalama yoluyla falsiparum Polizom teknikleri. Topluca, bu yöntemler, insan miRNA ve parazit mRNA&#39;larının gözlenen füzyon daha önce bildirilen yöntemler kullanılarak 27 gösterilmiştir olanlar füzyon mRNA&#39;lann, parazit protein çevirisini modüle ve HBA sıtma direncinin önemli bir belirleyicisidir ve HbSS 17 eritrosit göstermektedir. Bu yöntemler, bu füzyon RNA&#39;lar P. içinde olup olmadığını, RNA ekleme olaylarını tanımlamak ve fonksiyonel keşfetmek isteyen herhangi bir sisteme yararlı olacaktır falciparum ya da olmasın diğer ökaryotik sistemlerde.

<table border="0" cellpadding="0" cellspacing="0" width="651">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:651px;">REAGENTS-All reagents must be RNAse-free.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Diethyl pyrocarbonate (DEPC; Sigma, cat. no. D5758)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DEPC-treated water (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Yoyo-1 DNA fluorescent dye (Thermo Fisher)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gene Pulser II (or comparible) electroporator (Bio-Rad)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.2 cm Electroporation cuvettes</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">4 M potassium acetate (Mallinckrodt, cat. no. 6700)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 M potassium HEPES (pH 7.2; Sigma, cat. no. H0527)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M magnesium acetate (Sigma, cat. no. M-2545)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M dithiothreitol (DTT; Research Products International, cat. no. D11000)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">100 mM phenylmethylsulfonate fluoride (PMSF; dissolved in isopropanol; Sigma, cat. no. P7626)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (v/v) Igepal CA-630 (Sigma-Aldrich, cat. no. I3021)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (w/v) sodium deoxycholate (DOC; Sigma, cat. no. D-6750)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Cycloheximide (CHX; Sigma, cat. no. C-7698)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose (Mallinckrodt, cat. no. 8360-04)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNAseOUT (Invitrogen, cat. no. 100000840)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RPMI-1640 w/ L-glutamine (Cellgro, cat. no. 10-040-CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% AlbuMAX I (w/v in sterile water) (Invitrogen, cat. no. 11020-039)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gentamicin (Gibco, cat. no. 15750-060))</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HT supplement (100x) (Invitrogen, cat. no. 11067030)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">45% (w/v) sucrose (Sigma, cat no. G8769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M HEPES buffer (Gibco, cat. no. 15630-080)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glass slides (VWR, cat. no. 48311-702)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Giemsa stain (50X) (VWR, cat no. m708-01)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5&#39; Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Biotin powder (Sigma-Aldrich)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1M Potassium Chloride</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptavidin Sepharose High Performance Beads (GE Healthcare)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose cushion (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose chase solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA capture Wash Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Elution Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">REAGENT SETUP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">500 ml RPMI-1640 w/ L-glutamine</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 ml gentamicin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml HT supplement</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2.5 ml 45% glucose</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 ml 10% AlbuMAX I</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">12.5 ml 1 M HEPES</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sterile filter with 0.2 mm vacuum filter flask.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media containing 10x CHX</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as Plasmodium cell culture media above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 mM cycloheximide</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter.&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x PBS containing cycloheximide</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">400 mM potassium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 mM potassium HEPES, pH 7.2</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15 mM magnesium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">200 mM cycloheximide (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM DTT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM PMSF (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">40 U/ml RNaseOUT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% (v/v) Igepal CA-630</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% (w/v) DOC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose to make 15% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose to make 50% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose to make 0.5 M sucrose cushion</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">The 60% sucrose chase solution requires only sucrose and water, no other components</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Wash Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20mM&#160; KCl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5unit/ml Rnase Out (Invitrogen)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Elution Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as RNA Capture Wash Buffer, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2mM Biotin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">EQUIPMENT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Ultra-ClearTM &#189; x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polyallomer 9/16 x 3 &#189; in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">L8-80M ultracentrifuge (Beckman)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Steel blunt syringe needle, 4 inch, 16G (Aldrich, cat. no. Z261378)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 ml syringe with 27G&#189; needle (Becton Dickinson, cat no. 309623)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml syringe (Becton Dickinson, cat. no. 309646)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Parafilm</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tube rotator, end-over-end</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microcentrifuge, refrigerated</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">TracerDAQ (Measurement Computing)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf 5810R centrifuge</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)</td>
		</tr>
	</tbody>
</table>

methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum

Orak hücre alel sorumlu genetik varyasyon (HbS) sıtma parazitinin, P. tarafından enfeksiyonu karşı eritrosit sağlar Falciparum. Multifaktöryel olduğu bilinmektedir, bu direncin, moleküler temeli, tam olarak anlaşılamamıştır. Son çalışmalar kez sıtma parazitleri transloke eritrosit microRNA, ayırıcı ifadesi, gen düzenlemesi ve parazit büyümesi hem de etkilediği bulundu. Bu miRNA&#39;ların sonra parazit mRNA&#39;ların gizli alt grupları ile 5 &#39;RNA füzyon ile bir kimerik RNA transkripti oluşturarak mRNA translasyonunu inhibe ettiği gösterilmiştir. Burada kullanılan teknikler gen regülasyonu ve P. translasyonel potansiyeline fonksiyonel rolü ve varsayılan mekanizma altında yatan eritrosit microRNA incelemek için falsiparum, ev sahibi eritrositlerin içine modifiye sentetik microRNA transfeksiyonunun dahil detaylı olarak açıklanacaktır. Son olarak, polisom gradyan yöntemi tra derecesini belirlemek için kullanılırBu transkriptlerin nslation. Birlikte, bu teknikler bize eritrosit microRNA düzensiz düzeyleri orak eritrositlerin hücre içsel sıtma direncine katkıda bulunduğunu göstermek için izin verdi.

P. insan microRNA Küresel profilleme Falciparum Burada sunulan teknikler çeşitli koşullar içerisinde parazitlerden microRNA çıkarmak için kullanıldı. Unutulmaması gereken bir şey, genellikle bu makalede ve orijinal çalışmada 29 hem de sunulan microRNA verileri için bir referans noktası olarak görev 32, belirtildiği gibi enfekte olmamış eritrositlerde için RNA ekstraksiyonu gerçekleştirilmiştir olmasıdır. Bu daha önceki çal?...

Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts.

Yöntemler Küçük RNA&#39;ların ve Ribosomal doluluk Düzenleyici Rolü Araştırma<em&gt; Plasmodium falciparum</em

The genetic variation responsible for the sickle cell allele (HbS) enables erythrocytes to resist infection by the malaria parasite, P. falciparum. The ...

methods-to-investigate-regulatory-role-small-rnas-ribosomal-occupancy

Research

JoVE Journal

Immunology and Infection

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

8.8K Görüntüleme.  Duke University School of Medicine. Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts. 

Video: Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the disease, is characterised by an accumulation of Plasmodium falciparum infected red blood cells (iRBC) at pigmented trophozoite stage in the microvasculature of the brain2-4. This microvessel obstruction (sequestration) leads to acidosis, hypoxia and harmful inflammatory cytokines (reviewed in 5). Sequestration is also found in most microvascular tissues of the human body2, 3. The mechanism by which iRBC attach to the blood vessel walls is still poorly understood.
The immortalized Human Brain microvascular Endothelial Cell line (HBEC-5i) has been used as an in vitro model of the blood-brain barrier6. However, Plasmodium falciparum iRBC attach only poorly to HBEC-5i in vitro, unlike the dense sequestration that occurs in cerebral malaria cases. We therefore developed a panning assay to select (enrich) various P. falciparum strains for adhesion to HBEC-5i in order to obtain populations of high-binding parasites, more representative of what occurs in vivo.
A sample of a parasite culture (mixture of iRBC and uninfected RBC) at the pigmented trophozoite stage is washed and incubated on a layer of HBEC-5i grown on a Petri dish. After incubation, the dish is gently washed free from uRBC and unbound iRBC. Fresh uRBC are added to the few iRBC attached to HBEC-5i and incubated overnight. As schizont stage parasites burst, merozoites reinvade RBC and these ring stage parasites are harvested the following day. Parasites are cultured until enough material is obtained (typically 2 to 4 weeks) and a new round of selection can be performed. Depending on the P. falciparum strain, 4 to 7 rounds of selection are needed in order to get a population where most parasites bind to HBEC-5i. The binding phenotype is progressively lost after a few weeks, indicating a switch in variant surface antigen gene expression, thus regular selection on HBEC-5i is required to maintain the phenotype.
In summary, we developed a selection assay rendering P. falciparum parasites a more "cerebral malaria adhesive" phenotype. We were able to select 3 out of 4 P. falciparum strains on HBEC-5i. This assay has also successfully been used to select parasites for binding to human dermal and pulmonary endothelial cells. Importantly, this method can be used to select tissue-specific parasite populations in order to identify candidate parasite ligands for binding to brain endothelium. Moreover, this assay can be used to screen for putative anti-sequestration drugs7.

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

An in vitro model for cerebral malaria sequestration is described1. Plasmodium falciparum infected red blood cells are selected for binding to immortalized human brain microvascular endothelial cells. The selected parasites show a distinct phenotype. The selection process can be applied using various P. falciparum strains and endothelial cell lines.

Seçimi Plasmodium falciparum İnsan Beyninin endotel hücreleri Cytoadhesion için Parazitler

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the ...

İmmünoloji ve Enfeksiyon

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

Paraziter Eşek Arıları Bir Giriş<em&gt; Drosophila</em&gt; Ve antiparaziter İmmün Yanıt

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

Bir<em&gt; In vitro</emOkumak&gt; Co-enfeksiyon Modeli<em&gt; Plasmodium falciparum</emİnsan İlköğretim Monosit kökenli Bağışıklık Hücrelerde&gt;-HIV-1 Etkileşimleri

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully understood and several hypotheses have been put forward, including mechanical obstruction of microvessels by P. falciparum-parasitized red blood cells (pRBC). Indeed, during the intra-erythrocytic stage of its life cycle, P. falciparum has the unique ability to modify the surface of the infected erythrocyte by exporting surface antigens with varying adhesive properties onto the RBC membrane. This allows the sequestration of pRBC in multiple tissues and organs by adhesion to endothelial cells lining the microvasculature of post-capillary venules 1. By doing so, the mature forms of the parasite avoid splenic clearance of the deformed infected erythrocytes 2 and restrict their environment to a more favorable low oxygen pressure 3. As a consequence of this sequestration, it is only immature asexual parasites and gametocytes that can be detected in peripheral blood.
Cytoadherence and sequestration of mature pRBC to the numerous host receptors expressed on microvascular beds occurs in severe and uncomplicated disease. However, several lines of evidence suggest that only specific adhesive phenotypes are likely to be associated with severe pathological outcomes of malaria. One example of such specific host-parasite interactions has been demonstrated in vitro, where the ability of intercellular adhesion molecule-1 to support binding of pRBC with particular adhesive properties has been linked to development of cerebral malaria 4,5. The placenta has also been recognized as a site of preferential pRBC accumulation in malaria-infected pregnant women, with chondrotin sulphate A expressed on syncytiotrophoblasts that line the placental intervillous space as the main receptor 6. Rosetting of pRBC to uninfected erythrocytes via the complement receptor 1 (CD35)7,8 has also been associated with severe disease 9.
One of the most recently described P. falciparum cytoadherence phenotypes is the ability of the pRBC to form platelet-mediated clumps in vitro. The formation of such pRBC clumps requires CD36, a glycoprotein expressed on the surface of platelets. Another human receptor, gC1qR/HABP1/p32, expressed on diverse cell types including endothelial cells and platelets, has also been shown to facilitate pRBC adhesion on platelets to form clumps 10. Whether clumping occurs in vivo remains unclear, but it may account for the significant accumulation of platelets described in brain microvasculature of Malawian children who died from CM 11. In addition, the ability of clinical isolate cultures to clump in vitro was directly linked to the severity of disease in Malawian 12 and Mozambican patients 13, (although not in Malian 14).
With several aspects of the pRBC clumping phenotype poorly characterized, current studies on this subject have not followed a standardized procedure. This is an important issue because of the known high variability inherent in the assay 15. Here, we present a method for in vitro platelet-mediated clumping of P. falciparum with hopes that it will provide a platform for a consistent method for other groups and raise awareness of the limitations in investigating this phenotype in future studies. Being based in Malawi, we provide a protocol specifically designed for a limited resource setting, with the advantage that freshly collected clinical isolates can be examined for phenotype without need for cryopreservation.

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

This method investigates the platelet-mediated clumping phenotype of Plasmodium falciparum-infected erythrocytes (pRBC) in clinical isolates. This is performed by isolating and co-incubating platelet-rich plasma and a suspension of pRBC.

Trombosit-aracılı kesekleşme için Basit Protokolü<em&gt; Plasmodium falciparum</emBir kaynak Poor Setting&gt; ile enfekte Eritrosit

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully ...

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

We describe a method for isolation and characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. Infection of susceptible mouse-strains with this parasite strain results in the induction of experimental cerebral malaria, a neurologic syndrome that recapitulates certain important aspects of Plasmodium falciparum-mediated severe malaria in humans 1,2 . Mature forms of blood-stage malaria express parasitic proteins on the surface of the infected erythrocyte, which allows them to bind to vascular endothelial cells. This process induces obstructions in blood flow, resulting in hypoxia and haemorrhages 3 and also stimulates the recruitment of inflammatory leukocytes to the site of parasite sequestration.
Unlike other infections, i.e neutrotopic viruses4-6, both malaria-parasitized red blood cells (pRBC) as well as associated inflammatory leukocytes remain sequestered within blood vessels rather than infiltrating the brain parenchyma. Thus to avoid contamination of sequestered leukocytes with non-inflammatory circulating cells, extensive intracardial perfusion of infected-mice prior to organ extraction and tissue processing is required in this procedure to remove the blood compartment. After perfusion, brains are harvested and dissected in small pieces. The tissue structure is further disrupted by enzymatic treatment with Collagenase D and DNAse I. The resulting brain homogenate is then centrifuged on a Percoll gradient that allows separation of brain-sequestered leukocytes (BSL) from myelin and other tissue debris. Isolated cells are then washed, counted using a hemocytometer and stained with fluorescent antibodies for subsequent analysis by flow cytometry.
This procedure allows comprehensive phenotypic characterization of inflammatory leukocytes migrating to the brain in response to various stimuli, including stroke as well as viral or parasitic infections. The method also provides a useful tool for assessment of novel anti-inflammatory treatments in pre-clinical animal models.

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

A method for isolation of adherent inflammatory leukocytes from brain blood vessels of Plasmodium berghei ANKA-infected mice is described. The method allows quantification as well as phenotypic characterization of isolated leukocytes after staining with fluorescent antibodies and subsequent analysis by flow cytometry.

Den Beyin sekestre Lökositler İzolasyonu ve Analizi<em&gt; Plasmodium berghei</em&gt; ANKA-enfekte Fare

We describe a method for isolation and  characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. ...

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the &asymp;40% limit, the investigator usually keeps the percentage at around 10%. In many cases it is necessary to isolate the parasite-containing red blood cells (RBCs) from the uninfected ones, to enrich the culture and proceed with a given experiment. 
When P. falciparum infects the erythrocyte, the parasite degrades and feeds from haemoglobin 2, 3. However, the parasite must deal with a very toxic iron-containing haem moiety 4, 5. The parasite eludes its toxicity by transforming the haem into an inert crystal polymer called haemozoin 6, 7. This iron-containing molecule is stored in its food vacuole and the metal in it has an oxidative state which differs from the one in haem 8. The ferric state of iron in the haemozoin confers on it a paramagnetic property absent in uninfected erythrocytes. As the invading parasite reaches maturity, the content of haemozoin also increases 9, which bestows even more paramagnetism on the latest stages of P. falciparum inside the erythrocyte.
Based on this paramagnetic property, the latest stages of P. falciparum infected-red blood cells can be separated by passing the culture through a column containing magnetic beads. These beads become magnetic when the columns containing them are placed on a magnet holder. Infected RBCs, due to their paramagnetism, will then be trapped inside the column, while the flow-through will contain, for the most part, uninfected erythrocytes and those containing early stages of the parasite.
Here, we describe the methodology to enrich the population of late stage parasites with magnetic columns, which maintains good parasite viability 10. After performing this procedure, the unattached culture can be returned to an incubator to allow the remaining parasites to continue growing.

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

The paramagnetic properties of hemozoin are used to isolate late stages of Plasmodium falciparum-infected red blood cells growing in culture. The method is simple and fast and does not affect the subsequent invasive capabilities of the parasites.

Ayrılması<em&gt; Plasmodium falciparum</emManyetik Yoluyla&gt; Geç Evre-enfekte Eritrositler

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the ...

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of free merozoites from the blood by phagocytic cells. However assessing the functional efficacy of merozoite specific opsonizing antibodies is challenging due to the short half-life of merozoites and the variability of primary phagocytic cells. Described in detail herein is a method for generating viable merozoites using the E64 protease inhibitor, and an assay of merozoite opsonin-dependent phagocytosis using the pro-monocytic cell line THP-1. E64 prevents schizont rupture while allowing the development of merozoites which are released by filtration of treated schizonts. &#160;Ethidium bromide labelled merozoites are opsonized with human plasma samples and added to THP-1 cells. Phagocytosis is assessed by a standardized high throughput protocol. Viable merozoites are a valuable resource for assessing numerous aspects of P. falciparum biology, including assessment of immune function. Antibody levels measured by this assay are associated with clinical immunity to malaria in naturally exposed individuals. The assay may also be of use for assessing vaccine induced antibodies. &#160;

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Measuring antibody function is key to understanding immunity to Plasmodium falciparum malaria. This method describes the purification of viable merozoites, and measurement of opsonization-dependent phagocytosis by flow cytometry.

Yüksek Kapasiteli saflaştırılması<em&gt; Plasmodium falciparum</emOpsonizing Antikor Analizlerde kullanım için&gt; merozoitler

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of ...

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, therefore, suitable to be used for routine purposes. For best resolution, data evaluation and data management, a miniaturized electrophoresis system is required. Together with such an electrophoresis system and the in-house developed software (freely available here) assignment of the pattern of bands to a genotype is standardized and straight forward. DNA extraction is simple (boiling prep), setting-up of the reactions is easy and they can be run on any standard PCR machine. PCR cycling is common except prolonged ramping and elongation times. Compared to spa typing and Multi Locus Sequence Typing (MLST), RS-PCR does not require DNA sequencing what simplifies the analysis considerably and allows a high throughput. Furthermore, the resolution for bovine strains of S. aureus is at least as good as spa typing and better than MLST or pulsed-field gel electrophoresis (PFGE). The RS-PCR data base includes presently a total of 141 genotypes and variants. The method is highly associated with the virulence gene pattern, contagiosity and pathogenicity of S. aureus strains involved in bovine mastitis. S. aureus genotype B (GTB) is contagious and causes herds problems causing large costs in the Switzerland and other European countries. All the other genotypes observed in Switzerland infect individual cows and quarters. Genotyping by RS-PCR allows the reliable prediction of the epidemiological and the pathogenic potential of S. aureus involved in bovine intramammary infection (IMI), two key factors for clinical veterinary medicine. Because of these beneficial properties together with moderate costs and a high sample throughput the goal of this publication is to give a detailed, step-by-step protocol for easily establishing and running RS-PCR for genotyping S. aureus in other laboratories.

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR RS-PCR

Here, ribosomal spacer PCR (RS-PCR) is used together with a miniaturized electrophoresis system as a fast and high resolution method for genotyping S. aureus at moderate costs allowing a high throughput.

bir Genotiplendirme<em&gt; Staphylococcus aureus</em&gt; Tarafından Ribozomal Spacer PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, ...

Using Phylogenetic Analysis to Investigate Eukaryotic Gene Origin

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct a tree to show the evolutionary relationship among different taxa (classification units) at the molecular level. Phylogenetic analysis can also be used to investigate domain relationships within an individual taxon, particularly for organisms that have undergone substantial change in morphology and physiology, but for which researchers lack fossil evidence due to the organisms&#39; long evolutionary history or scarcity of fossilization.
In this text, a detailed protocol is described for using the phylogenetic method, including amino acid sequence alignment using Clustal Omega, and subsequent phylogenetic tree construction using both Maximum Likelihood (ML) of Molecular Evolutionary Genetics Analysis (MEGA) and Bayesian Inference via MrBayes. To investigate the origin of eukaryotic Sugars Will Eventually be Exported Transporters (SWEET) genes, 228 SWEETs including 35 SWEET proteins from unicellular eukaryotes and 57 SemiSWEET proteins from prokaryotes were analyzed. Interestingly, SemiSWEETs were found in prokaryotes, but SWEETs were found in eukaryotes. Two phylogenetic trees constructed using theoretically distinct methods have consistently&#160;suggested that the first eukaryotic SWEET gene might stem from the fusion of a bacterial SemiSWEET gene and an archaeal SemiSWEET gene.&#160;It is worth noting that one should be cautious to draw a conclusion based only on phylogenetic analysis, although it is useful to explain the underlying relationship between different taxa, which is difficult or even impossible to discern through experimental means.

A method of constructing a phylogenetic tree based on sequence homology of SWEETs from eukaryotes and SemiSWEETs from prokaryotes is described. Phylogenetic analysis is a useful tool for explaining the evolutionary relatedness between homologous proteins or genes from different organism groups.

Ökaryotik gen kökenli araştırmaya filogenetik analizi kullanılarak

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct ...

Bone Marrow Transplantation Platform to Investigate the Role of Dendritic Cells in Graft-versus-Host Disease

Allogeneic bone marrow transplantation (BMT) is an effective therapy for hematological malignancies due to the graft-versus-leukemia (GVL) effect to eradicate tumors. However, its application is limited by the development of graft-versus-host disease (GVHD), a major complication of BMT. GVHD is evoked when T-cells in the donor grafts recognizealloantigen expressed by recipient cells and mount unwanted immunological attacks against recipient healthy tissues. Thus, traditional therapies are designed to suppress donor T-cell alloreactivity. However, these approaches substantially impair the GVL effect so that the recipient&#39;s survival is not improved. Understanding the effects of therapeutic approaches on BMT, GVL, and GVHD, is thus essential. Due to the antigen-presenting and cytokine-secreting capacities to stimulate donor T-cells, recipient dendritic cells (DCs) play a significant role in the induction of GVHD. Therefore, targeting recipient DCs becomes a potential approach for controlling GVHD. This work provides a description of a novel BMT platform to investigate how host DCs regulate GVH and GVL responses after transplantation. Also presented is an effective BMT model to study the biology of GVHD and GVL after transplantation.

Graft-versus-host disease is a major complication after allogeneic bone marrow transplantation. Dendritic cells play a critical role in the pathogenesis of graft-versus-host disease. The current article describes a novel bone marrow transplantation platform to investigate the role of dendritic cells in the development of graft-versus-host disease and the graft-versus-leukemia effect.

Kemik İliği Transplantasyon Platformu Greft-versus-Host Hastalığında Dendritik Hücrelerin Rolünü Araştırmak Için

Allogeneic bone marrow transplantation (BMT) is an effective therapy for hematological malignancies due to the graft-versus-leukemia (GVL) effect to ...