This work was supported by grants from CONACyT-SEP (SEP-2008-84582; CB-2011-01-168497) and Promep-SEP for R.A.G.; P.H. received a scholarship from CONACyT (447442).

1. HFF Hücre Kültürü ve Ad-enfeksiyon <ol><li> Daha önce tarif edildiği gibi, 8 HFF hücreleri üzerinde floresan oluşturucu birim (FFU) halinde HEK-293 hücrelerinden ve titre mono tabakaları Ad5 WT virüsü yayar. </li><li> Nemlendirilmiş bir kuluçka makinesi içinde DMEM /% 10 fetal sığır 37 ° C&#39;de steril kültür 100 mm&#39;lik tabaklar içerisinde serum (FBS) ve% 5 CO2, 10 ml insan alın derisi fibroblastları (HFF) büyütün. Dört 16 kare setleri hücreleri sayılarak bir Neubauer odasına kullanarak hücre sayısını belirler. Ml başına hücre sayısı dört 16-kare setleri hücrelerin ortalama sayısını hesaplamak ve 10 4 ile bu sayı çarpımı ile elde edilir. Adımda 1.3 dahil her zaman sonrası enfeksiyon için, 1 x 10 7 HFF hücreleri kullanın. </li><li> Mock-enfekte oluşturucu birim 30 odak MOl&#39;de tabak başına DMEM Ad5 1 ml ile 100 mm doku kültürü çanakları içinde adenovirüs tip 5 (Ad5) vahşi-tipi (WT) (H5pg4100 8) ile HFF hücreleri enfekte veya FFU veya hücre başına. Ah 2 saat süreyle inkübe edindikkatle yemeklere her 15 dakikada bir sallanan umidified 37 ° C&#39;de hücre kültürü inkübatörü% 5 CO2, hücreleri üzerinde virüs aşı maddesi homojen bir dağılım sağlamak için. Bu süre sonunda, ortam çıkarın ve% 10 FBS ile desteklenmiş taze DMEM ve CO2 37 ° C&#39;de nemlendirilmiş bir hücre kültürü inkübatöründe 16, 24 ya da 36 saat süreyle inkübe edilir ve% 5. 2.1 adıma geçin. </li></ol> Adenovirüs RC ile zenginleştirilmiştir Alt nükleer Kesirler 2. Hazırlık <ol><li> Hasat Ad5-enfekte veya hücre kavgacı ile sahte enfekte HFF hücreleri ve steril santrifüj tüplerine hücreleri toplamak. Adım 1.2 olarak hücre sayısını belirler. Adım 1.3 &#39;de belirtilen her zaman sonrası enfeksiyon için 1 x 10 7 hücre kullanın. </li><li> 220 x g&#39;de 5 dakika boyunca 4 ° C&#39;de santrifüj hücreleri. </li><li> Buz soğukluğunda PBS hücre pelletini (137 mM NaCI, 2.7 mM KCI, 10 mM Na-2 HPO 4 ve 1,8 mM KH 2 PO 4). Yıkama Hücre peletis, yıkama başına buz soğukluğunda 5 ml PBS ile 3 kez. Bu amaçla, santrifüj 220 x g&#39;de 5 dakika, tortusundan 4 ° C&#39;de hücreleri ve yüzer (SN) atmak ve nazik pipetleme hücre pelletini. </li><li> Plazma membranını bozmak için, 700 hücre topağı buz soğukluğunda hipotonik tampon maddesi (10 mM HEPES pH 7.9, 10 mM KCI, 1.5 mM MgCI2, 0.5 mM DTT, 20 μ ug / ml fenilmetilsülfonil florid (PMSF) u tekrar süspansiyon , 10 μ / ml sığır pankreatik tripsin inhibitörü, 10 μ ug / ml pepstatin A ve 10 μ ug / ml N-asetil-L-leusil-L-leusil-L dahil olmak üzere sistein, serin, treonin ve aspartil proteaz inhibitörlerinin bir karışımı, -argininal) ve hücreler 3 saat boyunca buz üzerinde şişmesi sağlar. </li><li> Lyse bir gevşek A tipi teflon havan ile homojenleştirici kullanılarak hücreler. Vuruşları ve parlak alan mikroskobu ile her 20 vuruş tüm hücreleri parçalanmış edilmiş olmasını sağlamak için monitör örneklerinin Dounce 80 gerçekleştirin, ancak çekirdekler n varhasarlı veya kopmuş ot. </li><li> 300 x g&#39;de 5 dakika boyunca 4 ° C&#39;de, hücre homojenatı santrifüjleyin. Bir santrifüj tüpüne -20 ºC &#39;de sitoplazmik fraksiyon olarak SN saklayın. </li><li> Çözelti 1 (S1) 750 μ l (tekrar süspansiyon, çekirdeklerden pelet, selüler artığın ayrılması için 0.25 M sukroz, 10 mM MgC 10 de dahil olmak üzere 2 ila 20 μ / ml PMSF, sistein, serin, bir treonin ve kanşım aspartil proteaz inhibitörleri μ ug / ml sığır pankreatik tripsin inhibitörü, 10 μ ug / ml pepstatin A ve 10 μ ug / ml N-asetil-L-leusil-L-leusil-L-argininal) ve çözelti, 2 eşit bir hacmi boyunca tabaka (S2) (0.35 M sukroz, 0.5 mM MgCI2, 20 μ / ml PMSF, sistein, serin, 10 μ / ml sığır pankreatik tripsin inhibitörü, 10 μ ug / ml pepstatin A ve 10 μ içeren treonin ve aspartil proteaz inhibitörlerinin bir karışımı, ug / ml N-asetil-L-leusil-L-leusil-L-argininal). Centr1400 x g&#39;de 5 dakika boyunca 4 ° C&#39;de ifuge. </li><li> Bir mikropipet kullanarak SN atın. Pelet rahatsız etmemek. </li><li> S2 750 μ l izole çekirdek içeren pelletini. </li><li> Adenovirüs RC (RCF) ile zenginleştirilmiş çekirdek içi fraksiyonları izole edilmesi için, iki adet 5 dakikalık darbeleri kullanılarak, ultrasonik bir banyoda çekirdekler yeniden süspansiyon haline ses dalgalarına maruz veya parlak alan mikroskopisi ile gözlendiği haliyle, tüm çekirdek lize kadar devam eder. C ya da 4 ° altında örnekleri tutmak için gerektiğinde ultrasonik banyoda buz kullanın. </li><li> Çözelti 3 (S3) 3000 xg&#39;de (0.88 M sukroz, 0.5 mM MgCl2) ve santrifüj, 10 dakika boyunca 4 ° C eşit hacimde üzerinde sonike çekirdekleri katman. -70 ºC nucleoplasmic fraksiyonu (Npl) olarak 1.5 ml süpernatant saklayın. -70 ºC RCF olarak S2 700 μ l pelet ve mağaza tekrar. </li></ol> RCF 3. Western Blot Analizleri Not: TGA ve RCF fraksiyonlar s Western Blot analizi içinet kenara 640 Npl için l ve adım 2.11 elde edilen toplam hacim gelen RCF 300 μ l u. <ol><li> 5 dakika boyunca 95 ° C &#39;de 15 μ Laemmli tamponu 2x, her çekirdek içi fraksiyonun l (% 4 SDS,% 20 gliserol,% 10 2-merkaptoetanol,% 0.004 bromofenol mavisi, 0,125 M Tris-HCl, pH 6.8) ve kaynatın karıştırın. Bir% 10 sodyum dodesil sülfat-poliakrilamid jel elektroforezi (SDS-PAGE) 20 miliamperlik (mA), 1.5 saat için jel ve ayrı proteinleri denatüre örnekleri yükleyin. </li><li> Poliviniliden diflorür (PVDF) membran üzerinde 400 mA&#39;da 1.5 saat elektro proteinleri aktarın. </li><li> RT PBS içinde% 3 yağsız kuru süt ile 2 saat boyunca zarın bloke eder. </li><li> PBS /% 0.3 yağsız kuru süt 500 seyreltme: 1 viral E2A DNA-bağlama proteini (B6-8 9) karşı birincil antikor ile 4 ° C &#39;de O / N inkübe edin. </li><li> 3 kez PBS ile yıkayın membran /% 0.1 Tween 10 dakika boyunca 20. </li><li> Fare anti IgG sekonder AN membran inkübeoda sıcaklığında 2 saat süreyle PBS içinde 10.000 seyreltme: tibody Bir 1 at turpu peroksidaz (HRP) bağlanmış. </li><li> PBS ile membrana 3 kez yıkayın /% 0.1 Tween 20 10 dakika karıştırıldı. </li><li> Gelişmiş kemilüminesans ve X-ışını filmleri kullanılarak membran geliştirin. </li></ol> RCF 4. Viral DNA tespiti NOT: Her iki TGA ve RCF fraksiyonlardan, DNA izolasyonu için aşama 2,11 &#39;de elde edilen toplam hacminin RCF için Npl 210 μ l ve 100 μ l kullanın. <ol><li> Proteinaz K, 1 mg / ml ve% 0.5 Tween 20 ile 55 ° C &#39;de 1 saat süre ile çekirdek altı fraksiyonlar inkübe edin. </li><li> 95 ° C &#39;de 10 dakika boyunca inkübe edilerek örnekleri proteinaz K inaktive. </li><li> 2 dakika boyunca oda sıcaklığında, 20,000 x g&#39;de santrifüjleyin örnekleri. </li><li> SN toplayın. 4 ° C &#39;de 3M sodyum asetatın 1/10 hacmi ve bir izopropanol hacminin, O / N-DNA çökeleği. </li><li> 10 dakika boyunca oda sıcaklığında, 20,000 x g&#39;de santrifüjleyin örnekleri. </li><li> SN u atınmikropipet şarkı. 20.000 x g&#39;de 5 dakika boyunca 4 ° C &#39;de% 70 etanol ve santrifüj ile pelet yıkayın. </li><li> 10 mM, 10 μ l DNA yeniden süspanse Tris-HCI pH 7.4 </li><li> 260 nm&#39;de optik yoğunluğu (OD) ölçmek suretiyle bir spektrofotometre kullanılarak DNA ölçmek. </li><li> Viral DNA&#39;yı büyütmek için, nükleotid 7273 ile ilgili, Geç Temel transkripsiyon birimi içindeki bir bölgenin yükseltilmesine olanak sağlayacak primerler ile reaksiyon hacmi 25 μ l, Taq DNA polimeraz kullanılarak, standart bir PCR reaksiyonunda, her çekirdek içi fraksiyondan DNA 100 ng kullanmak için Nükleotid 7353 (81 bp) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). 95 ° C &#39;de 3 dakika boyunca ilk denatürasyon, 20 amplifikasyon (95 ° C, 72 ° C&#39; de 30 saniye boyunca 62 ° C &#39;de 1 dakika boyunca tavlama ve uzatma 1 dakika) devirlik bir son uzatma adımı ile takip aşağıdaki döngü koşulları kullanarak 72 ºC&#39;de 3 dak. </li><li> Etidyum 90 V. Stain de,% 2 agaroz jelleri içinde PCR ürünü başlat0.5 μ ug / ml son konsantrasyonda bromür ve RCF viral DNA zenginleştirme doğrulamak için DNA görselleştirmek. Bu bileşik güçlü bir mutajen olduğu gibi, eldiven giymek emin olun her zaman çok dikkatli etidyum bromür Kulp ve. Kurumsal kurallarına göre etidyum bromür atınız. </li></ol> RCF 5. Geç Viral mRNA Algılama NOT: Her iki Npl ve RCF fraksiyonlardan RNA izolasyonu için, adım 2.11 &#39;de elde edilen toplam hacim gelen RCF için Npl için 640 μ l ve 300 μ l kullanın. <ol><li> Üreticinin talimatlarına uygun olarak Trizol kullanarak subnuclear fraksiyonlardan RNA izole. DEPC (diethilpyrocarbonate) enjekte edilmiş su 50 μ l RNA süspanse edin. </li><li> 260 nm&#39;de OD ölçümü için bir spektrofotometre kullanılarak RNA niceliğini (yaklaşık 3 μ g elde edilir). 50 ng RNA Mağaza / -70 ºC sıcaklıkta l alikotları u. </li><li> Saflaştırılmış RNA kontrol5 ng toplam RNA ve aşama 4,9 tarif edilen döngü koşulları kullanılarak, ters transkriptaz (RT) yokluğunda bir kontrol PCR reaksiyonunun gerçekleştirilmesi ile DNA kontaminasyonu yokluğu. <ol><li> DNA kontaminasyonu yok ise herhangi bir amplikon üretilmelidir. DNA kontaminasyonu mevcut ise, 10 U RNaz inhibitör 10 U DNase I, 0.1 M Tris-HCI pH 8.3, 0.5 M KCl ve 37 ° C &#39;de 30 dakika boyunca 15 mM MgCl2 ile örnekleri inkübe edin. Adım 5.1 olarak RNA yeniden izole etmek için devam edin. </li></ol></li><li> RCF ilişkili viral mRNA analiz etmek için, farklı gen ailesine (Tablo 1), adenoviral Geç mRNA tespit etmek için tasarlanmış primerler kullanılarak, RT-PCR ile, her çekirdek içi fraksiyondan RNA 100 ng yükseltmek. <ol><li> Ters transkripsiyon (RT) için, 42 ° C &#39;de 1 saat boyunca karıştırılır ve 70 ° C&#39; de 10 dakika boyunca, reaksiyon hacmi 20 μ l M-MuLV RT enzim kullanılarak, standart RT reaksiyonunda, her çekirdek içi fraksiyondan, RNA 100 ng kullanımı. </li><li> Yükseltilmesi için, 1 kullanınAşama 4.9 PCR reaksiyonları, cDNA μ l. Amplifikasyon 25 döngü izledi 95 ° C &#39;de 3 dakika boyunca ilk denatürasyon (95 ° C&#39;de 1 dakika, tavlama 72 ° C&#39;de 30 saniye için Tablo 1 ve uzatma belirtilen sıcaklıkta 1 dakika süre ile) ve aşağıdaki döngü koşulları kullanarak 72 ° C &#39;de 3 dakika boyunca son bir uzatmadan oluşmuştur. </li></ol></li><li> 0.5 μ ug / ml son konsantrasyonda etidyum bromür ile 90 V Leke jeller% 2 agaroz jelleri RT-PCR ürünleri, çalıştırmak ve RCF viral mRNA geç ilişki doğrulayacak görselleştirmek. Adımda 4.10 belirtildiği gibi etidyum bromür tutun. </li></ol> RCF 6. İmmünofloresan Görselleştirme NOT: Carry-out bu yordamı bir laminer akış kabini altında herhangi bir toz parçacıkları ile numunelerin kontaminasyonu önlemek ve kullanmadan önce tüm çözümleri filtre. <ol><li> Nokta 5 adımda korkunç 2.10 elde edilen RCF kısmının l uctly silan kaplı slayt. </li><li> Oda sıcaklığında yaklaşık 5 dakika boyunca nokta kurumasını bekleyin. </li><li> Yeniden hidrat yavaş ve dolaylı RCF nokta yanında bir damla PBS 500 μ l pipetle ve slayt eğerek akış sağlayarak. Taraftan aşırı PBS boşaltın. </li><li> Oda sıcaklığında 2 saat süre ile PBS /% 5 bovin serum albümini 500 μ l (BSA) ile örnek kaplayarak Blok. </li><li> Nazikçe ve dolaylı olarak numune üzerine PBS 500 μ l pipetle slayt 3 kez yıkayın. Aşırı PBS tahliye etmek slayt eğin. </li><li> Oda sıcaklığında 2 saat süreyle PBS içinde 500 seyreltme bir 1: viral E2A DNA-bağlama proteini (B6-8 9) karşı birincil antikor ile numuneyi inkübe edin. Antikor çözeltisi 20 μ l tespit örnek örtün ve kurumasını önlemek için nemli bir oda içinde inkübe edilir. </li><li> Yumuşak ve dolaylı numune üzerine 500 ul PBS μ l pipetleme PBS /% 0.02 Tween 20 ile numune 3 kez yıkayın. Eski kapalı drenaj slayt yatırıncess yıkama çözeltisi. </li><li> 4 ° C &#39;de 1 saat süre ile, PBS içinde 2000 seyreltme: 1 ile 488 nm&#39;de uyarıldı bir flüorofora bağlı fare anti IgG sekonder antikor ile inkübe edin. Antikor çözeltisi 20 μ l tespit örnek örtün ve kurumasını önlemek için nemli bir oda içinde inkübe edilir. </li><li> Yumuşak ve dolaylı numune üzerine 500 ul PBS μ l pipetleme PBS /% 0.02 Tween 20 ile numune 3 kez yıkayın. Fazla yıkama solüsyonu boşaltmak için slayt eğin. </li><li> Orta montaj olarak 2 μ PBS /% 10 gliserol kullanılarak bir lamel ile slayt üzerine tespit örnek örtün. Net oje ve mağaza el -20 ºC ile mühür. </li><li> 63x objektif ve 488 nm&#39;lik bir dalga boyunda bir 1,4 Sayısal açıklık (NA) ile, bir floresans mikroskobu kullanılarak örnekleri analiz edin. </li></ol>

<ol>
	<li>Doucas, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+replication+is+coupled+with+the+dynamic+properties+of+the+PML+nuclear+structure.">Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure.</a> Genes &#38; Dev. 10, 196-207 (1996).</li><li>Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+virus+replication+compartments.">DNA virus replication compartments.</a> J. Virol. 88, 1404-1420 (2014).</li><li>Boon, J. A., Diaz, A., Ahlquist, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+viral+replication+complexes.">Cytoplasmic viral replication complexes.</a> Cell host microbe. 8, 77-85 (2010).</li><li>Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphological+and+biochemical+characterization+of+the+membranous+hepatitis+C+virus+replication+compartment.">Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment.</a> J. Virol. 87, 10612-10627 (2013).</li><li>Busch, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+Nucleoli.">Isolation of Nucleoli.</a> Exp Cell Res. 24, 150-163 (1963).</li><li>Lam, Y. W., Lyon, C. E., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+isolation+of+Cajal+bodies+from+HeLa+cells.">Large-scale isolation of Cajal bodies from HeLa cells.</a> Mol. Biol. Cell. 13, 2461-2473 (2002).</li><li>Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+nucleolus.">The nucleolus.</a> J Cell Sci. 118, 1335-1337 (2005).</li><li>Groitl, P., Dobner, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+adenovirus+type+5+early+region+1+and+4+virus+mutants.">Construction of adenovirus type 5 early region 1 and 4 virus mutants.</a> Methods Mol Med. 130, 29-39 (2007).</li><li>Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+which+recognize+native+and+denatured+forms+of+the+adenovirus+DNA-binding+protein.">Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein.</a> Virology. 128, 480-484 (1983).</li><li>Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+effects+on+adenovirus+late+gene+expression+of+deleting+the+E1b+55K+protein.">Selective effects on adenovirus late gene expression of deleting the E1b 55K protein.</a> J Gen Virol. 74 (Pt 4), 575-582 (1993).</li><li>Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+E1B+55-kilodalton+protein+is+required+for+both+regulation+of+mRNA+export+and+efficient+entry+into+the+late+phase+of+infection+in+normal+human+fibroblasts.">Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts.</a> J. Virol. 80, 964-974 (2006).</li><li>Castillo-Villanueva, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Mre11+Cellular+Protein+Is+Modified+by+Conjugation+of+Both+SUMO-1+and+SUMO-2/3+during+Adenovirus+Infection.">The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection.</a> ISRN Virology. 2014, 14 (2014).</li><li>Morris, S. J., Scott, G. E., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+late-phase+infection+is+controlled+by+a+novel+L4+promoter.">Adenovirus late-phase infection is controlled by a novel L4 promoter.</a> J. Virol. 84, 7096-7104 (2010).</li><li>Wright, J., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+adenovirus+5+L4+promoter+is+activated+by+cellular+stress+response+protein+p53.">The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53.</a> J. Virol. 87, 11617-11625 (2013).</li></ol>

The authors have nothing to disclose.

In order to elucidate the molecular mechanisms that govern regulation of cellular activities by viral infection understanding the composition and activities associated with RC would be instrumental. Therefore, to make a detailed analysis of RC, we established a cell-free system that takes advantage of the size and biochemical composition of these virus-induced structures, to isolate subnuclear fractions enriched with RC using a simple procedure that relies on velocity gradients with sucrose cushions. Critical steps of th...

Adenovirüsler, enfekte hücre çekirdeğinde replike olan bir çift sarmallı DNA genomunu içerir. Viral DNA çekirdeği girdiğinde, PML nükleer organları 1 bitişik lokalize. Viral erken gen ifadesinin ardından, nükleer mimarisi dramatik olarak adlandırılan viral mikroçevrelerde oluşumunu uyaran, yeniden düzenlenir viral çoğaltma Bölmeler (RC) 2. Adenovirüs (Ad) RC viral genomun replikasyonu ve viral geç genlerinin sentezlenmesi gerçekleşecek siteleri olduğundan, bu süreçlere katılmak için gerekli tüm viral ve hücresel faktörlerin alımı için bir ortam sağlar. İlginç bir şekilde, örneğin DNA hasar cevap olarak hücresel antiviral yanıt sorumlu olan hücresel proteinlerin, çeşitli doğal immün cevabı ve tümör bastırma yandaşlaştırılmıştır bu viral sitelerinin 2 için vardır. Eş zamanlı olarak düzenlenmesi sırasında etkin viral replikasyon teşvik Dolayısıyla, Reklam RC kabul edilebilir düzenleyici hubBu yapıların virüs konak hücre etkileşimleri anlamak için anahtar olduğunu belirten hücresel antiviral yanıt. Bununla birlikte, RC oluşumunun moleküler mekanizmalar, bunların kompozisyonu ve ilgili faaliyetler tam olarak anlaşılamamıştır. Çekirdeğin içinde replike diğer DNA virüslerinden adenoviral RC, hem de RC sitoplazmik RC 3 aksine, membranlara ilişkili değildir. Ayrıca, bu virüs kaynaklı yapıların protein ve nükleik asitlerin bütünüyle oluşan olması muhtemeldir. RNA virüsleri ile enfekte edilmiş hücrelerde oluşan RC, ayrıntılı morfolojik ve fonksiyonel ve biyokimyasal karakterizasyonu 4 kolaylaştırmıştır sitoplazmik lokalizasyonu ve membrana bağlı durum, yararlanarak, izole edilmiştir (genellikle viral fabrikaları olarak da adlandırılır). Bildiğimiz kadarıyla, nükleer viral RC belki de intranükleer m nükleer mimarisi ve yokluğu karmaşıklığı, izole edilmemişOnların izolasyon kolaylaştıracak embranes. Onların çalışma yerine mikroskobik, FISH ve transmisyon elektron mikroskobu güvendi. Ancak, subnuclear yapıların izole doğasında komplikasyonları rağmen, bu tür nukleoli ve Cajal Organları gibi diğer nükleer etki 5,6 öncesinde izole edilmiştir. Çekirdekçikler ve RC her iki protein ve nükleik asitten oluşan ve 0.5 arasında bir çapa sahip olması nedeniyle - 5 um, RC de izolasyon için uygun olmalıdır varsayıldı. Bu nedenle, daha kesin olarak RC ilişkili moleküler bileşim ve fonksiyonlarını karakterize etmek amacıyla biz RC ile zenginleştirilmiş çekirdek içi kısımlar izole etmek için yeni bir yöntem kurulmuştur. Bu amaçla, nükleollü 7 ya da diğer nükleer etki 6 izole etmek için kullanılan prosedürlerin benzer hız gradyanları ve sükroz yastıkları kullanılarak çekirdek altı fraksiyonlar hazırlandı ve moleküler bileşimin çalışma ve ilişkili aktiviteleri sağlayan bir hücre içermeyen bir sistem kurulmuşturRC. Bu teknik, bu nedenle virüs konak hücre etkileşimleri anlayışı ilerletmek ve aynı zamanda çekirdeğinde çoğaltmak diğer virüslerden RC ayrıntılı analizini kolaylaştırmak ve adenovirüs- oluşan benzer boyutlardaki çoğaltma bölmelerinin oluşumuna neden gereken güçlü bir araç temsil etmelidir örneğin, herpes, papilloma ya polyomavirusları olarak enfekte olmuş hücreleri.

<table border="0">
	<tbody>
		<tr>
			<td>DMEM</td>
			<td>Gibco</td>
			<td>12100-046</td>
			<td>Warm in 37 &#186;C water bath before use</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Gibco</td>
			<td>12484-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose, Ultra Pure</td>
			<td>Research Organics</td>
			<td>0928S</td>
			<td>Prepare a 2.55 M stock solution and store at 4 &#186;C</td>
		</tr>
		<tr>
			<td>Dounce homogenizer</td>
			<td>Kontess Glass Company</td>
			<td>884900-0000</td>
			<td></td>
		</tr>
		<tr>
			<td>Branson 1800 Ultrasonic Bath</td>
			<td>Branson</td>
			<td>Z769533&#160;SIGMA</td>
			<td>Turn on 15 min before use.</td>
		</tr>
		<tr>
			<td>Peroxidase AffiniPure F(ab&#39;)&#8322; Fragment Goat Anti-Mouse IgG (H+L)</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-036-003</td>
			<td>Use at a 1:10,000 dilution in PBS/0.03% non-fat milk</td>
		</tr>
		<tr>
			<td>Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate</td>
			<td>Life Technologies</td>
			<td>A-21121</td>
			<td>Use at a 1:2,000 dilution in PBS</td>
		</tr>
		<tr>
			<td>Silane-Prep Slides</td>
			<td>Sigma</td>
			<td>S4651-72EA</td>
			<td>Open in a laminar flow cabinet</td>
		</tr>
		<tr>
			<td>SuperSignal West Pico Chemiluminescent Substrate</td>
			<td>Pierce ThermoScientific</td>
			<td>34080</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of viral replication compartment-enriched sub-nuclear fractions from adenovirus-infected normal human cells

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments through the recruitment of viral and cellular proteins to sites occupied by the viral genome. These sites, called replication compartments (RC), can be considered viral-induced nuclear domains where the viral genome is localized and viral and cellular proteins that participate in replication, transcription and post-transcriptional processing are recruited. Moreover, cellular proteins involved in the antiviral response, such as tumor suppressor proteins, DNA damage response (DDR) components and innate immune response factors are also co-opted to RC. Although RC seem to play a crucial role to promote an efficient and productive replication cycle, a detailed analysis of their composition and associated activities has not been made. To facilitate the study of adenoviral RC and potentially those from other DNA viruses that replicate in the cell nucleus, we adapted a simple procedure based on velocity gradients to isolate Ad RC and established a cell-free system amenable to conduct morphological, functional and compositional studies of these virus-induced subnuclear structures, as well as to study their impact on host-cell interactions.

Viral replikasyon bölme (RC), protein ve diğer nükleer etki benzer nükleik asitten oluşan çekirdek içi virüslerin neden olduğu yapılar olduğu için, bu biyokimyasal özelliklerine göre hız gradyanları ile izolasyon için uygun olduğu kanıtlanmıştır. Fraksiyonlara protokol Kritik adımlar örnekleri farklı alt-hücresel fraksiyonların bütünlüğünü sağlamak için parlak bir alan mikroskobu ile izlenmesi gereken adım her birinde Şekil 1&#39;de gösterilmiştir. Hücreler şişe...

Watch this Scientific Journal Video about Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells at JoVE.com

Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC.

Adenovirüs ile enfekte Normal İnsan Hücreleri Viral Çoğaltma Bölme zenginleştirilmiş Alt nükleer Kesirler izolasyonu

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments ...

isolation-viral-replication-compartment-enriched-sub-nuclear

Research

JoVE Journal

Immunology and Infection

8.7K Görüntüleme.  Universidad Autónoma del Estado de Morelos. We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC. 

Video: Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

Virüs mutasyon Frekans RNA Virüsler ve Karakterizasyonu Fidelity Varyantlar izolasyonu

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

İmmünoloji ve Enfeksiyon

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

Nucleocapsids gelen Viral DNA hazırlanması

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

Polarize İnsan Havayolu bir sıvı kaplı Kültürünün Oluşturulması Solunum Patojenler için Host Hücre Yanıtı Okumak Epitel Calu-3 Hücreler<em&gt; In vitro</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Isolation of Myeloid Dendritic Cells and Epithelial Cells from Human Thymus

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen presenting cell (APC) types found in a normal thymus and it is well established that they play distinct roles during thymic selection. These cells are localized in distinct microenvironments in the thymus and each APC type makes up only a minor population of cells. To further understand the biology of these cell types, characterization of these cell populations is highly desirable but due to their low frequency, isolation of any of these cell types requires an efficient and reproducible procedure. This protocol details a method to obtain cells suitable for characterization of diverse cellular properties. Thymic tissue is mechanically disrupted and after different steps of enzymatic digestion, the resulting cell suspension is enriched using a Percoll density centrifugation step. For isolation of myeloid DC (CD11c+), cells from the low-density fraction (LDF) are immunoselected by magnetic cell sorting. Enrichment of TEC populations (mTEC, cTEC) is achieved by depletion of hematopoietic (CD45hi) cells from the low-density Percoll cell fraction allowing their subsequent isolation via fluorescence activated cell sorting (FACS) using specific cell markers. The isolated cells can be used for different downstream applications.

This protocol details a method to isolate antigen presenting cells from human thymus via different steps of enzymatic digestion of the tissue followed by density centrifugation of the single cell suspension and finally magnetic and/or FACS sorting of the cell populations of interest.

İnsan Thymus ile myeloid dendritik hücreleri ve epitel hücreleri İzolasyonu

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these glycoprotein &#8216;spikes&#8217; is often technically challenging but important for understanding viral pathogenesis and in drug design. Here, a protocol is presented for viral spike structure determination through computational averaging of electron cryo-tomography data. Electron cryo-tomography is a technique in electron microscopy used to derive three-dimensional tomographic volume reconstructions, or tomograms, of pleomorphic biological specimens such as membrane viruses in a near-native, frozen-hydrated state. These tomograms reveal structures of interest in three dimensions, albeit at low resolution. Computational averaging of sub-volumes, or sub-tomograms, is necessary to obtain higher resolution detail of repeating structural motifs, such as viral glycoprotein spikes. A detailed computational approach for aligning and averaging sub-tomograms using the Jsubtomo software package is outlined. This approach enables visualization of the structure of viral glycoprotein spikes to a resolution in the range of 20-40 &#197; and study of the study of higher order spike-to-spike interactions on the virion membrane. Typical results are presented for Bunyamwera virus, an enveloped virus from the family Bunyaviridae. This family is a structurally diverse group of pathogens posing a threat to human and animal health.

An approach is presented for determining structures of viral membrane glycoprotein complexes using a combination of electron cryo-tomography and sub-tomogram averaging with the computational package Jsubtomo.

Jsubtomo kullanılarak Elektron Cryotomography Rekonstrüksiyonunda ikinci viral zarf glikoproteini Spikes ortalamasını

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Isolation of Leukocytes from the Human Maternal-fetal Interface

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua parietalis). This interface is the anatomical site of contact between maternal and fetal tissues; therefore, it is an immunological site of action during pregnancy. Infiltrating leukocytes at the maternal-fetal interface play a central role in implantation, pregnancy maintenance, and timing of delivery. Therefore, phenotypic and functional characterizations of these leukocytes will provide insight into the mechanisms that lead to&#160;pregnancy disorders. Several protocols have been described in order to isolate infiltrating leukocytes from the decidua basalis and decidua parietalis; however, the lack of consistency in the reagents, enzymes, and times of incubation makes it difficult to compare these results. Described herein is&#160;a novel approach that combines the use of gentle mechanical and enzymatic dissociation techniques to preserve the viability and integrity of extracellular and intracellular markers in leukocytes isolated from the human tissues at the maternal-fetal interface. Aside from immunophenotyping, cell culture, and cell sorting, the future applications of this protocol are numerous and varied. Following this protocol, the isolated leukocytes can be used to determine DNA methylation, expression of target genes, in vitro leukocyte functionality (i.e., phagocytosis, cytotoxicity, T-cell proliferation, and plasticity, etc.), and the production of reactive oxygen species at the maternal-fetal interface. Additionally, using the described protocol, this laboratory has been able to describe new and rare leukocytes at the maternal-fetal interface.

Described herein is a protocol to isolate and further study the infiltrating leukocytes of the decidua basalis and decidua parietalis - the human maternal-fetal interface. This protocol maintains the integrity of cell surface markers and yields enough viable cells for downstream applications as proven by flow cytometry analysis.

İnsan Maternal-Fetal Arabirimi lökosit İzolasyonu

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua ...

Isolation of Sertoli Cells and Peritubular Cells from Rat Testes

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of puberty - more than ten years after the establishment of systemic immune tolerance. Spermatogenic cells express a number of proteins that may be seen as non-self by the immune system. The testis must then be able to establish tolerance to these neo-antigens on the one hand but still be able to protect itself from infections and tumor development on the other hand. Therefore the testis is one of a few immune privileged sites in the body that tolerate foreign antigens without evoking a detrimental inflammatory immune response. Sertoli cells play a key role for the maintenance of this immune privileged environment of the testis and also prolong survival of cotransplanted cells in a foreign environment. Therefore primary Sertoli cells are an important tool for studying the immune privilege of the testis that cannot be easily replaced by established cell lines or other cellular models. Here we present a detailed and comprehensive protocol for the isolation of Sertoli cells - and peritubular cells if desired - from rat testes within a single day.

Primary Sertoli cells are required for studying testis-immune privilege, signal transduction during inflammation or infection, and utilization of their immunoprotective properties. Here we describe an enzyme-based protocol for the isolation of highly purified primary Sertoli cells and peritubular cells from rat testes.

Sıçan Testislerindeki Sertoli Hücreleri İzolasyon ve peritübüler Hücreler

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the person-to-person route or indirectly through environmental surfaces or food, contaminated fomites and inanimate surfaces are important vehicles for the spread of the virus during norovirus outbreaks.
We developed and evaluated a protocol using macrofoam swabs for the detection and typing of human noroviruses from hard surfaces. Compared with fiber-tipped swabs or antistatic wipes, macrofoam swabs allow virus recovery (range 1.2-33.6%) from toilet seat surfaces of up to 700 cm2. The protocol includes steps for the extraction of the virus from the swabs and further concentration of the viral RNA using spin columns. In total, 127 (58.5%) of 217 swab samples that had been collected from surfaces in cruise ships and long-term care facilities where norovirus gastroenteritis had been reported tested positive for GII norovirus by RT-qPCR. Of these 29 (22.8%) could be successfully genotyped. In conclusion, detection of norovirus on environmental surfaces using the protocol we developed may assist in determining the level of environmental contamination during outbreaks as well as detection of virus when clinical samples are not available; it may also facilitate monitoring of effectiveness of remediation strategies.

A macrofoam based sampling methodology was developed and evaluated for the detection and quantification of norovirus on environmental hard surfaces.

Yüzeyler İnsan Norovirus Tespiti sürüntü Örnekleme Yöntemi

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

Isolation of Dendritic Cells from the Human Female Reproductive Tract for Phenotypical and Functional Studies

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low numbers of DCs present per tissue. Yet, as the phenotype and function of DCs is modified by the tissue environment, it is necessary to analyze tissue resident DC populations, since blood derived DCs incompletely reflect the complexities of DCs in tissues. Here we present a protocol to isolate DCs from the human female reproductive tract (FRT) using hysterectomy specimens that allows both phenotypical and functional analyses. The protocol consists of tissue digestion to generate a single cell mixed cell suspension, followed by positive magnetic bead selection. Our tissue digestion protocol does not cleave surface markers, which allows phenotypical and functional analysis of DCs in the steady state, without overnight incubation or cell activation. This protocol can be adapted for the isolation of other immune cell types or isolation of DCs from other tissues.

We describe here a method to isolate and purify dendritic cells from different anatomical compartments in the human female reproductive tract for the evaluation of their phenotypical and functional characteristics. This method can be adapted to isolate other immune cells or dendritic cells from other mucosal tissues.

İnsan dişi üreme yolu dendritik hücreler yalıtım Phenotypical ve fonksiyonel çalışmaları için

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low ...

Isolation, Expansion, and Adipogenic Induction of CD34+CD31+ Endothelial Cells from Human Omental and Subcutaneous Adipose Tissue

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor response to insulin, local hypoxia, and inflammation. By stimulating the differentiation of functional white adipocytes from progenitors, radical hypertrophy of the adipocyte population can be prevented and, consequently, the metabolic health of adipose tissue can be improved along with a reduction of inflammation. Also, by stimulating a differentiation of beige/brown adipocytes, the total body energy expenditure can be increased, resulting in weight loss. This approach could prevent the development of obesity co-morbidities such as type 2 diabetes and cardiovascular disease.
This paper describes the isolation, expansion, and differentiation of white and beige adipocytes from a subset of human adipose tissue endothelial cells that co-express the CD31 and CD34 markers. The method is relatively cheap and is not labor-intensive. It requires access to human adipose tissue and the subcutaneous depot is suitable for sampling. For this protocol, fresh adipose tissue samples from morbidly obese subjects [body mass index (BMI) &#62;35] are collected during bariatric surgery procedures. Using a sequential immunoseparation from the stromal vascular fraction, enough cells are produced from as little as 2&#8211;3 g of fat. These cells can be expanded in culture over 10&#8211;14 days, can be cryopreserved, and retain their adipogenic properties with passaging up to passage 5&#8211;6. The cells are treated for 14 days with an adipogenic cocktail using a combination of human insulin and the PPAR&#947; agonist-rosiglitazone.
This methodology can be used for obtaining proof of concept experiments on molecular mechanisms that drive adipogenic responses in adipose endothelial cells, or for screening new drugs that can enhance the adipogenic response directed either towards white or beige/brown adipocyte differentiation. Using small subcutaneous biopsies, this methodology can be used to screen out non-responder subjects for clinical trials aimed to stimulate beige/brown and white adipocytes for the treatment of obesity and co-morbidities.

The differentiation of white and beige adipocytes from adipose tissue vascular progenitors bears potential for metabolic improvement in obesity. We describe protocols for a CD34+CD31+ endothelial cell isolation from human fat and for a subsequent in vitro expansion and differentiation into white and beige adipocytes. Several downstream applications are discussed.

Yalıtım, genişleme ve Adipojenik indüksiyon CD34 + CD31 + insan Omental ve deri altı yağ dokusu endotel hücrelerden

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor ...