Novo Nordisk Vakfı Merkezi temel metabolik araştırma Kopenhag Üniversitesi kısmen sınırsız bir bağış Novo Nordisk Vakfı tarafından finanse edilen bir bağımsız araştırma merkezidir.

1. Restriksiyon enzimi tedavi
<ol><li>MtDNA insan mitokondriyal DNA'sını 14258 pozisyonda keser BamHI, Restriksiyon enzimi ile toplam insan DNA'sı kabul ederek linearize. Not: fare DNA için aynı koşullar altında Restriksiyon enzimi BglII aşağıdaki gibi kullanın.</li>
	<li>Her biri için mtDNA metilasyonu değerlendirilmesi, bir 0.2 mL tepki tüp hazırlamak ve (fluorometry tarafından sayısal), aşağıdaki mix: 3 μg genomik DNA eklemek için nerede 15 μL örnek tampon 3, 3 μL BamHI ve su ilâ 150 μL</li>
	<li>37 ° C'de 4 h için termal cycler tüplerde yer</li>
</ol>2. bisülfit dönüştürme
<ol><li>BamHI tedavi edilen DNA başka bir yerde29açıklandığı gibi Sodyum bisülfit kullanarak dönüştürmek.</li>
	<li>200-500 ng DNA BamHI tedavi edilen toplam hacmi 20 μL her dönüşüm reaksiyonu için kullanın. DNA kurtarma % 50-70 olduğunu.</li>
	<li>10 μL elüsyon arabelleği bisülfit dönüştürülmüş DNA elute.</li>
	<li>Tek iplikçikli DNA'fluorometry tarafından ölçmek.</li>
	<li>İsteğe bağlı: protokolü ile kalan geçmeden önce bisülfit dönüştürülmüş DNA-20 ° C'de depolayın. Uzun süreli depolama için bisülfit dönüştürülmüş DNA-80 ° C'de depolayın</li>
</ol>3. astar sıralama bisülfit tasarımını
<ol><li>Astarlar çevrimiçi araçlar Methprimer30 ve BiSearch31,32kullanarak bisülfit sıralama için tasarım. Not: Methprimer ve BiSearch astar bağlama dizileri genom dizileri aramak için nereye cytosines thymines, benzer şekilde sonrası bisülfit tedavi için dönüştürülür izin.</li>
	<li>İçin en uygun ve tarafsız güçlendirme, amplicon boyutu 100-300 bp arasında tasarım ve astar KSY dinucleotides kaçının.</li>
	<li>Tasarlanmış astar mitokondrial DNA'yı BiSearch'ın işlevini Astar aramakullanarak belirli olduğundan emin olun. Zaten tasarlanmış bisülfit dönüştürülmüş astar yerleştirin, tıkırtı belgili tanımlık bisülfit kutu ve başvuru genom ve PCR parametreleri de ekleyin. Not: Olası PCR ürünlerinin bir listesini görüntüler.</li>
	<li>1-5 astar dizileri üst kopyalayın ve oligonükleotid sentezi için bir sipariş formu içine yapıştırın. Not: İnsan listesini ve laboratuar ortamında doğrulandı fare mtDNA astar dizileri Tablo 1' de görüntülenir.</li>
	<li>Bisülfit kullanarak test astar 4. adımda açıklanan özel jel elektroforez izleyip PCR dönüştürülür. Test ve tüm astar çiftleri ayrı ayrı optimize etmek ve doğru amplicon boyutu üzerinde özel jel görünür sağlamak. Not: çoğullama astar gerekiyorsa, birden çok astar bir PCR reaksiyon tek ve özel jel elektroforez ya da, daha resolutive bir yöntem gibi benzer ürünlerin ayırt etmek için polyacrylamide Jel Elektroforez, PCR ürünlerde görselleştirmek ekleme boyutu.</li>
</ol>4. bisülfit PCR ve jel ayıklama dönüştürülür
<ol><li>Faiz bölgelerinde yükseltmek için PCR sıcak başlangıç Taq polimeraz kullanarak gerçekleştirin. Kısaca, DNA, 500 µM anlam ve anti-anlamda astar, 1 µL dNTP mix (her dNTP 10 µM) ve polimeraz 7.5 U/tepki olarak toplam hacmi 50 µL., mix 100 ng dönüştürülür çalıştırmak PCR ile aşağıdaki koşullar: 95 ° C'de 5 dk (60 s 94 ° C; 60 s 55 ° C *; 60 s 72 ° C) <img alt="arrow" src="/files/ftp_upload/57772/57772eq2.jpg"> 35 döngüleri; 10 dk 72 ° C. Astar ya da ayrı ayrı kullanın veya multiplexed.</li>
	<li>İsteğe bağlı: astar çoğullama zaman kullanım 200 ng DNA ve aşağıdaki Bisiklet koşullarını dönüştürülür: 5 min 95 ° C (60 s 94 ° C; 90 s 55 ° C *; 90 s 72 ° C) <img alt="arrow" src="/files/ftp_upload/57772/57772eq2.jpg"> 35 döngüleri; 10 dk 72 ° C. Not: Sıcaklık astar erime sıcaklığı bağlı olarak değişebilir.</li>
	<li>Konu PCR ürünleri üzerinde % 2 özel 100 volt Elektroforez jel.</li>
	<li>Nazik UV ışık altında PCR ürünleri bir neşter ile ayıklamak ve mikrotüpler için ekleyin. PCR ürünleri DNA hasarı önlemek için aşırı UV ışık için maruz bırakmayın. Pozlama süresi 30 'un üzerinde kaçının s.</li>
	<li>PCR ürünleri3daha önce açıklandığı gibi jel arıtma kullanarak arındırmak.</li>
	<li>4.5. adımdaki saf DNA ölçmek fluorometry kullanarak. Adım 5 ya da mağaza örnekleri-20 ° C'de geçin</li>
</ol>5. bisülfit Kütüphane hazırlık sıralama
<ol><li>Kütüphane hazırlık bisülfit dönüştürülmüş PCR ürünlerinin gerçekleştirin. İsteğe bağlı: Bu aşamada PCR ürünleri multiplex.</li>
	<li>Son onarım ilâ 100 kullanarak gerçekleştirmek ng PCR ürünü. 55,5 µL PCR ürünü 0.2 mL tüp içinde 3 µL son hazırlık enzim ve 6.5 µL son onarım tepki arabellek (10 x) ekleyin. Yerleştirin ve 65 ° C'de 30 dk ardından 20 ° C'de 30 dk için termal cycler tüpte kuluçkaya</li>
	<li>Sıralama adaptörleri 15 µL Blunt/TA ligaz ile karıştırın, 2.5 µL sonunda tamir DNA karıştırılarak ligate adaptör ve 1 µL ligasyonu artırıcı. Kullanıyorsanız < 100 ng PCR ürünü olarak giriş, seyreltik adaptör 10 kat.</li>
	<li>Bir termal cycler mix (adım 5.3) yerleştirin ve 20 ° C'de 15 dakika kuluçkaya Termal cycler duraklatmak ve 3 µl Kullanıcı eklemek tüp enzim. Mix ve tüp içinde geri termal cycler yerleştirin ve 37 ° C'de 15 dakika kuluçkaya</li>
	<li>Boyutu adaptör bakmaksızın DNA katı faz ters çevrilebilir immobilizasyon (SPRI) boncuk boncuk DNA PCR ürünü boyutuna bağlı olarak değişen oranlara sahip kullanarak seçin.</li>
	<li>13.5 µL H2O adaptör bakmaksızın DNA için adım 5.4 ve 55 resuspended µL SPRI boncuk ekleyin. 5 min ve yer tüp manyetik bir stand için oda sıcaklığında kuluçkaya. Çözüm açık olduğunda, süpernatant aktarmak için yeni bir tüp ve boru boncuk içeren atın. Not: Adaptör bakmaksızın DNA süpernatant içerir ve büyük istenmeyen parçaları için atılan boncuk bağlı.</li>
	<li>25 resuspended µL SPRI boncuk 5.6 adımından süpernatant için ekleyin, karıştırın ve oda sıcaklığında 5 min için kuluçkaya. Tüp manyetik sandalyesine koyun ve çözüm açık olduğunda süpernatant atın. Not: adaptör bakmaksızın DNA boncuk için bağlı olduğu, ancak atılan süpernatant istenmeyen DNA içerir.</li>
	<li>Tüp manyetik kürsüye olmakla birlikte, boncuk yıkamak için 200 µL % 80 etanol (taze hazırlanmış) ekleyin. 30 kuluçkaya s ve Kaldır ve atma süpernatant. Toplam 2 yıkama için bu adımı yineleyin.</li>
	<li>Tüp manyetik stand ile açık bir kapak açıkken kuru boncuk 5 min için hava.</li>
	<li>Tüp mıknatıs kaldırmak, DNA 23 µL elüsyon arabelleği elute ve karıştırın. 2 min için oda sıcaklığında kuluçkaya.</li>
	<li>Tüp manyetik bir stand üzerine yerleştirin ve çözüm açık olduğunda, pre-PCR güçlendirme (adım 5.14) için bir 96-şey PCR tabak 2 µL aktarmak.</li>
	<li>Geri kalan yaklaşık 21 µL PCR güçlendirme (adım 5.17) için yeni bir 0.2 mL tüp aktarın. Not: herhangi bir boncuk boncuk sonraki adımlar Enzimatik reaksiyonları inhibe olabilir gibi aktarmak değil emin olun.</li>
	<li>Adım 5,14 ya da mağaza örnekleri-20 ° C'de geçin</li>
	<li>Pre-PCR güçlendirme adaptör bakmaksızın DNA yükseltmek için gerekli devir sayısını tahmin etmek için RT-qPCR tarafından gerçekleştirin. 96-şey PCR sayfalarımızda plaka içeren 2 µL DNA (adım 5.11) tepki ekleyin: 0.4 µL Dizin astar, 0.4 µL evrensel PCR astar, 7.2 µL H2O, 10 µL RT-qPCR ana karışımı.</li>
	<li>Plaka bir gerçek zamanlı PCR makinesinde yerleştirin ve plaka için aşağıdaki koşullar Konu: 30 s 98 ° c (10 s 98 ° C; 75 s 65 ° C) <img alt="arrow" src="/files/ftp_upload/57772/57772eq2.jpg"> 20 döngüleri; 5 dk 65 ° c</li>
	<li>Her örnek için bir Ct-öncesi amplifikasyon RT-qPCR PCR reaksiyon doğrusal aşamasının sonuna karşılık gelen Ct değerini çıkararak gerekli amplifikasyon döngü sayısı tahmini.</li>
	<li>Adım 5.12 adaptör bakmaksızın DNA'dan karıştırılarak yükseltmek: 21 µL DNA, 25 µL PCR ana karışımı, 1 µL Dizin astar, 1 µL evrensel PCR astar ve 2 µL H2o Termal cycler içinde her örnek için aşağıdaki koşullar Konu: 30 s 98 ° c (10 s 98 ° C; 75 s 65 ° C) <img alt="arrow" src="/files/ftp_upload/57772/57772eq2.jpg"> [adım 5,16 hesaplanan Ct] döngüleri; 5 dk 65 ° c Not: yalnızca bir dizin astar örnek başına çoğullama için izin vermek için kullanmayı unutmayın. Dizin PCR sırasında eklenir.</li>
	<li>Güçlendirilmiş DNA SPRI boncuk arındırmak ve 22 µL elüsyon arabellekte elute.</li>
	<li>Kütüphane kalite jel elektroforez veya alternatif yöntemi tarafından kontrol. Doğru kitaplığa en yüksek boyutları (PCR ürün (ler) boyutu artı adaptör) arayın.</li>
	<li>Smear analizi ile Kütüphane ürün (ler) ortalama baz çifti boyutunu tahmin etmek: Gelişmiş genel ayarları'nda, "tablo" karalama analiz altında çift tıklatın. 100-1000 bp bölgesinden tanımlamak ve Tamam' ı tıklatın. Bölge tabloaltında tanımlanmış bölge görünür ve Kütüphane ortalama boyutu (bp) hesaplanır.</li>
	<li>Kütüphaneler tarafından fluorometry ölçmek. Adım 6 veya mağaza kitaplıklara-20 ° C'de devam</li>
</ol>6. sonraki üretimi sıralaması
<ol><li>NM konsantrasyon kütüphanelerin formülü kullanarak hesaplar: <img alt="Equation" src="/files/ftp_upload/57772/57772eq1.jpg">
</li>
	<li>Aynı nM konsantrasyon örneğin 2 nM için kitaplıklarına seyreltik (4 seçin nM, 2 nM, 1 nM veya 0.5 nM kitaplığına konsantrasyonları bağlı olarak). Bir havuz 2 nM kütüphanelerin elde etmek için tüm kitaplıkları havuz.</li>
	<li>Denatüre ve sıralama araç kılavuz aşağıdaki kütüphaneleri oranında seyreltin. Kısacası: 0.2 N NaOH ekleyerek 2 nM havuz tabiatını ve 5 dk. Dilute denatüre havuzun 10 de son bir seyreltme için oda sıcaklığında kuluçkaya. Denatüre ve 12: 17 son bir seyreltme için piyasada bulunan bir denetim kitaplığı oranında seyreltin. Yeni bir tüp 10 de havuzu % 20 12: 17 denetim kitaplığı ile karıştırın. Not: Bisülfit dönüşüm çok düşük karmaşıklık getirir. % 20 denetim kitaplığı spike-daha iyi sıralama kalitesinde neden olur.</li>
	<li>150 bp eşleştirilmiş uç sıralama derin sıralama aracı kullanarak çalıştırın.</li>
</ol>7. sayısal analiz - tahmin metilasyonu düzeyleri
<ol><li>.Fastq dosyaları (burada sample1_R1.fastq.gz ve sample1_R2.fastq.gz denir) oluşturmak, bismark dizini ilgi tüm genom kopyası oluştur (burada bismarkIndexadında bir klasör içinde) ve chrM genom dizisini fasta içinde kullanılabilir olduğundan emin olun biçimi (burada chrMadında bir klasör içinde).</li>
	<li>Okuma bağdaştırıcıları ve astar tarafından tanıtılan önyargı kaldırmak için ön işlemden: Trim_galore33aracını kullanın. İki nükleotid 5' sonundan ileriye ve geriye doğru okuma kaldırın. trim_galore--clip_R1 2 - clip_R2 2 -Ey. /--trim1--eşleştirilmiş sample1_R1.fastq.gz sample1_R2.fastq.gz</li>
	<li>Bismark34 kullanarak tüm genom önceden işlenmiş okuyan Hizala Bismark--kırlangıç--bam -ey. /. / bismarkIndex / -1 -2./sample1_R1_val_1.fq.gz./sample1_R2_val_2.fq.gz Not: başka bir aligner kullandıysanız, benzersiz olarak hizalanamaz okuma atılır emin olun.</li>
	<li>Özü kromozom M, burada Samtools35 kullanarak eşleme okur samtools -l 0 - O BAM -o sample1_sorted.bam sıralama sample1_R1_val_1_bismark_bt2_pe.bam samtools Dizin sample1_sorted.bam samtools göster -u sample1_sorted.bam chrM | samtools - n - O BAM -o sample1_chrM.bam sıralama</li>
	<li>Metilasyon bilgileri ayıklamak bismark_methylation_extractor -p--CX--cytosine_report--kapsamlı--genome_folder. / chrM./sample1_chrM.bam</li>
	<li>.bedgraph, .cov veya CX_report.txt dosyalar daha fazla çözümleme için kullanın. Sample1_chrM.CX_report.txt dosyasını, görselleştirme ve sınamak için kullanın.</li>
	<li>Birden çok bölge sorguya ve astar önyargı eşleme sırasında oluşturulan M-önyargı parsellerde görülebilir daha fazla önişleme adımda, kırpma gerçekleştirin. Daha fazla bilgi için Bismark belgelerine bakın.</li>
</ol>8. sayısal analiz - Test farklılıklar
<ol><li>CX_report.txt dosya için her C kromozom M üzerinde 7 sütunlar, kromozom (burada chrM), konumu, strand, metillenmiş okuma sayısı, bazlar okuma, C bağlam ve çevresindeki sıra, içerdiğinden emin olun.</li>
	<li>CX_report chrM tamamını kapsayan olarak güçlendirilmiş region(s) için alt küme küme kontrol edin.</li>
	<li>Parametrik olmayan testler örnekleri, bir balıkçılar'ın tam test bireysel C için veya bir bütün bölge için bir işareti test gibi arasındaki farklar için kullanın. Not: Miktar çoğu zaman neden normallik varsayarak uygun olmaması neden olduğu % 0 metilasyonu yakın olacaktır.</li>
	<li>Benzer şekilde, görselleştirme için quantil görselleştirmek veya binom oran güven aralıkları hesaplamak.</li>
</ol>

<ol><li>Falkenberg, M., Larsson, N. -G., Gustafsson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+replication+and+transcription+in+mammalian+mitochondria%5BTitle%5D)+AND+%22Annu+Rev+Biochem%22%5BJournal%5D)">DNA replication and transcription in mammalian mitochondria.</a> Annu Rev Biochem. 76, 679-699 (2007).</li>
<li>Kolesar, J. E., Wang, C. Y., Taguchi, Y. V., Chou, S. -H., Kaufman, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Two-dimensional+intact+mitochondrial+DNA+agarose+electrophoresis+reveals+the+structural+complexity+of+the+mammalian+mitochondrial+genome%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Two-dimensional intact mitochondrial DNA agarose electrophoresis reveals the structural complexity of the mammalian mitochondrial genome.</a> Nucleic Acids Res. 41 (4), e58(2013).</li>
<li>Mechta, M., Ingerslev, L. R., Fabre, O., Picard, M., Barres, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evidence+Suggesting+Absence+of+Mitochondrial+DNA+Methylation%5BTitle%5D)+AND+%22Front+Genet%22%5BJournal%5D)">Evidence Suggesting Absence of Mitochondrial DNA Methylation.</a> Front Genet. 8, 166(2017).</li>
<li>Ehrlich, M., Gama-Sosa, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Amount+and+distribution+of+5-methylcytosine+in+human+DNA+from+different+types+of+tissues+of+cells%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Amount and distribution of 5-methylcytosine in human DNA from different types of tissues of cells.</a> Nucleic Acids Res. 10 (8), 2709-2721 (1982).</li>
<li>Lister, R., Pelizzola, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Human+DNA+methylomes+at+base+resolution+show+widespread+epigenomic+differences%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Human DNA methylomes at base resolution show widespread epigenomic differences.</a> Nature. 462 (7271), 315-322 (2009).</li>
<li>Yan, J., Zierath, J. R., Barres, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evidence+for+non-CpG+methylation+in+mammals%5BTitle%5D)+AND+%22Exp+Cell+Res%22%5BJournal%5D)">Evidence for non-CpG methylation in mammals.</a> Exp Cell Res. 317 (18), 2555-2561 (2011).</li>
<li>Patil, V., Ward, R. L., Hesson, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+evidence+for+functional+non-CpG+methylation+in+mammalian+cells%5BTitle%5D)+AND+%22Epigenetics%22%5BJournal%5D)">The evidence for functional non-CpG methylation in mammalian cells.</a> Epigenetics. 9 (6), 823-828 (2014).</li>
<li>Nass, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Differential+methylation+of+mitochondrial+and+nuclear+DNA+in+cultured+mouse%2C+hamser+and+virus+trasnforemd+hamser+cells+in+vivo+and+in+vitro+methylation%5BTitle%5D)+AND+%22J+Mol+Biol%22%5BJournal%5D)">Differential methylation of mitochondrial and nuclear DNA in cultured mouse, hamser and virus trasnforemd hamser cells in vivo and in vitro methylation.</a> J Mol Biol. 80 (1), 155-175 (1973).</li>
<li>Shock, L. S., Thakkar, P. V., Peterson, E. J., Moran, R. G., Taylor, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+methyltransferase+1%2C+cytosine+methylation%2C+and+cytosine+hydroxymethylation+in+mammalian+mitochondria%5BTitle%5D)+AND+%22PNAS%22%5BJournal%5D)">DNA methyltransferase 1, cytosine methylation, and cytosine hydroxymethylation in mammalian mitochondria.</a> PNAS. 108 (9), 3630-3635 (2011).</li>
<li>Bellizzi, D., D'Aquila, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+Control+Region+of+Mitochondrial+DNA+Shows+an+Unusual+CpG+and+Non-CpG+Methylation+Pattern%5BTitle%5D)+AND+%22DNA+Res%22%5BJournal%5D)">The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern.</a> DNA Res. 20 (6), 537-547 (2013).</li>
<li>Jia, Y., Li, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Maternal+Low-Protein+Diet+Affects+Epigenetic+Regulation+of+Hepatic+Mitochondrial+DNA+Transcription+in+a+Sex-Specific+Manner+in+Newborn+Piglets+Associated+with+GR+Binding+to+Its+Promoter%5BTitle%5D)+AND+%22PLoS+ONE%22%5BJournal%5D)">Maternal Low-Protein Diet Affects Epigenetic Regulation of Hepatic Mitochondrial DNA Transcription in a Sex-Specific Manner in Newborn Piglets Associated with GR Binding to Its Promoter.</a> PLoS ONE. 8 (5), e63855(2013).</li>
<li>Jia, Y., Song, H., Gao, G., Cai, D., Yang, X., Zhao, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Maternal+Betaine+Supplementation+during+Gestation+Enhances+Expression+of+mtDNA-Encoded+Genes+through+D-Loop+DNA+Hypomethylation+in+the+Skeletal+Muscle+of+Newborn+Piglets%5BTitle%5D)+AND+%22J+Agric+Food+Chem%22%5BJournal%5D)">Maternal Betaine Supplementation during Gestation Enhances Expression of mtDNA-Encoded Genes through D-Loop DNA Hypomethylation in the Skeletal Muscle of Newborn Piglets.</a> J Agric Food Chem. 63 (46), 10152-10160 (2015).</li>
<li>Infantino, V., Castegna, A., Iacobazzi, F., Spera, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Impairment+of+methyl+cycle+affects+mitochondrial+methyl+availability+and+glutathione+level+in+Down%27s+syndrome%5BTitle%5D)+AND+%22Mol+Genet+Metab%22%5BJournal%5D)">Impairment of methyl cycle affects mitochondrial methyl availability and glutathione level in Down's syndrome.</a> Mol Genet Metab. 102 (3), 378-382 (2011).</li>
<li>Chen, H., Dzitoyeva, S., Manev, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Effect+of+valproic+acid+on+mitochondrial+epigenetics%5BTitle%5D)+AND+%22Eur+J+Pharmacol%22%5BJournal%5D)">Effect of valproic acid on mitochondrial epigenetics.</a> Eur J Pharmacol. 690 (1-3), 51-59 (2012).</li>
<li>Dzitoyeva, S., Chen, H., Manev, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Effect+of+aging+on+5-hydroxymethylcytosine+in+brain+mitochondria%5BTitle%5D)+AND+%22Neurobiol+Aging%22%5BJournal%5D)">Effect of aging on 5-hydroxymethylcytosine in brain mitochondria.</a> Neurobiol Aging. 33 (12), 2881-2891 (2012).</li>
<li>Menga, A., Palmieri, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SLC25A26+overexpression+impairs+cell+function+via+mtDNA+hypermethylation+and+rewiring+of+methyl+metabolism%5BTitle%5D)+AND+%22FEBS+J%22%5BJournal%5D)">SLC25A26 overexpression impairs cell function via mtDNA hypermethylation and rewiring of methyl metabolism.</a> FEBS J. 284 (6), 967-984 (2017).</li>
<li>Frommer, M., McDonald, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+genomic+sequencing+protocol+that+yields+a+positive+display+of+5-methylcytosine+residues+in+individual+DNA+strands%5BTitle%5D)+AND+%22PNAS%22%5BJournal%5D)">A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands.</a> PNAS. 89 (5), 1827-1831 (1992).</li>
<li>Byun, H. -M., Panni, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Effects+of+airborne+pollutants+on+mitochondrial+DNA+Methylation%5BTitle%5D)+AND+%22Part+Fibre+Toxicol%22%5BJournal%5D)">Effects of airborne pollutants on mitochondrial DNA Methylation.</a> Part Fibre Toxicol. 10 (1), 1(2013).</li>
<li>Janssen, B. G., Byun, H. -M., Gyselaers, W., Lefebvre, W., Baccarelli, A. A., Nawrot, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Placental+mitochondrial+methylation+and+exposure+to+airborne+particulate+matter+in+the+early+life+environment%3A+An+ENVIRONAGE+birth+cohort+study%5BTitle%5D)+AND+%22Epigenetics%22%5BJournal%5D)">Placental mitochondrial methylation and exposure to airborne particulate matter in the early life environment: An ENVIRONAGE birth cohort study.</a> Epigenetics. 10 (6), 536-544 (2015).</li>
<li>Zheng, L. D., Linarelli, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Insulin+resistance+is+associated+with+epigenetic+and+genetic+regulation+of+mitochondrial+DNA+in+obese+humans%5BTitle%5D)+AND+%22Clin+Epigenetics%22%5BJournal%5D)">Insulin resistance is associated with epigenetic and genetic regulation of mitochondrial DNA in obese humans.</a> Clin Epigenetics. 7 (1), 1739(2015).</li>
<li>Byun, H. -M., Colicino, E., Trevisi, L., Fan, T., Christiani, D. C., Baccarelli, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Effects+of+Air+Pollution+and+Blood+Mitochondrial+DNA+Methylation+on+Markers+of+Heart+Rate+Variability%5BTitle%5D)+AND+%22J+Am+Heart+Assoc%22%5BJournal%5D)">Effects of Air Pollution and Blood Mitochondrial DNA Methylation on Markers of Heart Rate Variability.</a> J Am Heart Assoc. 5 (4), (2016).</li>
<li>Bianchessi, V., Vinci, M. C., et al. Mitochondrion. MITOCH. 27 (C), 40-47 (2016).</li>
<li>Wijst, M. G. P., van Tilburg, A. Y., Ruiters, M. H. J., Rots, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Experimental+mitochondria-targeted+DNA+methylation+identifies+GpC+methylation%2C+not+CpG+methylation%2C+as+potential+regulator+of+mitochondrial+gene+expression%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">Experimental mitochondria-targeted DNA methylation identifies GpC methylation, not CpG methylation, as potential regulator of mitochondrial gene expression.</a> Sci Rep. 7 (1), 177(2017).</li>
<li>Wong, M., Gertz, B., Chestnut, B. A., Martin, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mitochondrial+DNMT3A+and+DNA+methylation+in+skeletal+muscle+and+CNS+of+transgenic+mouse+models+of+ALS%5BTitle%5D)+AND+%22Front+cellr+Neurosci%22%5BJournal%5D)">Mitochondrial DNMT3A and DNA methylation in skeletal muscle and CNS of transgenic mouse models of ALS.</a> Front cellr Neurosci. 7, 279(2013).</li>
<li>Dawid, I. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((5-methylcytidylic+acid%3A+absence+from+mitochondrial+DNA+of+frogs+and+HeLa+cells%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">5-methylcytidylic acid: absence from mitochondrial DNA of frogs and HeLa cells.</a> Science. 184 (4132), 80-81 (1974).</li>
<li>Gama-Sosa, M. A. <a target="_blank" href="http://www.worldcat.org/title/levels-and-distribution-of-5-methylcytosine-in-chordate-dna/oclc/15059352">Levels and distribution of 5-methylcytosine in Chordate DNA</a>. , 1-201 (1985).</li>
<li>Hong, E. E., Okitsu, C. Y., Smith, A. D., Hsieh, C. -L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Regionally+specific+and+genome-wide+analyses+conclusively+demonstrate+the+absence+of+CpG+methylation+in+human+mitochondrial+DNA%5BTitle%5D)+AND+%22Mol+Cell+Biol%22%5BJournal%5D)">Regionally specific and genome-wide analyses conclusively demonstrate the absence of CpG methylation in human mitochondrial DNA.</a> Mol Cell Biol. 33 (14), 2683-2690 (2013).</li>
<li>Liu, B., Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CpG+methylation+patterns+ofhuman+mitochondrial+DNA%5BTitle%5D)+AND+%22Nature+Publishing+Group%22%5BJournal%5D)">CpG methylation patterns ofhuman mitochondrial DNA.</a> Nature Publishing Group. , 1-10 (2016).</li>
<li>Donkin, I., Versteyhe, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Obesity+and+Bariatric+Surgery+Drive+Epigenetic+Variation+of+Spermatozoa+in+Humans%5BTitle%5D)+AND+%22Cell+Metab%22%5BJournal%5D)">Obesity and Bariatric Surgery Drive Epigenetic Variation of Spermatozoa in Humans.</a> Cell Metab. 23 (2), 369-378 (2016).</li>
<li>Li, L. C., Dahiya, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((MethPrimer%3A+designing+primers+for+methylation+PCRs%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">MethPrimer: designing primers for methylation PCRs.</a> Bioinformatics. 18 (11), 1427-1431 (2002).</li>
<li>Tusnády, G. E., Simon, I., Váradi, A., Arányi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((BiSearch%3A+primer-design+and+search+tool+for+PCR+on+bisulfite-treated+genomes%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">BiSearch: primer-design and search tool for PCR on bisulfite-treated genomes.</a> Nucleic Acids Res. 33 (1), e9(2005).</li>
<li>Arányi, T., Váradi, A., Simon, I., Tusnády, G. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+BiSearch+web+server%5BTitle%5D)+AND+%22BMC+bioinformatics%22%5BJournal%5D)">The BiSearch web server.</a> BMC bioinformatics. 7, 431(2006).</li>
<li>Krueger, F. Trim Galore!. , Available from:
 <a target="_blank" href="http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/">http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/</a> (2018).</li>
<li>Krueger, F., Andrews, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Bismark%3A+a+flexible+aligner+and+methylation+caller+for+Bisulfite-Seq+applications%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">Bismark: a flexible aligner and methylation caller for Bisulfite-Seq applications.</a> Bioinformatics. 27 (11), 1571-1572 (2011).</li>
<li>Li, H., Handsaker, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+Sequence+Alignment%2FMap+format+and+SAMtools%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li>
<li>Ramos, A., Barbena, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nuclear+insertions+of+mitochondrial+origin%3A+Database+updating+and+usefulness+in+cancer+studies%5BTitle%5D)+AND+%22Mitochondrion%22%5BJournal%5D)">Nuclear insertions of mitochondrial origin: Database updating and usefulness in cancer studies.</a> Mitochondrion. 11 (6), 946-953 (2011).</li>
<li>Warnecke, P. M., Stirzaker, C., Song, J., Grunau, C., Melki, J. R., Clark, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+and+resolution+of+artifacts+in+bisulfite+sequencing%5BTitle%5D)+AND+%22Methods+%28San+Diego%2C+Calif%29%22%5BJournal%5D)">Identification and resolution of artifacts in bisulfite sequencing.</a> Methods (San Diego, Calif). 27 (2), 101-107 (2002).</li>
</ol>

Yazarlar bildirmek için rakip hiçbir mali ilgi alanlarına sahip.

Burada, biz mtDNA metilasyonu sorguya çekmek için özel olarak tasarlanmış bir bisülfit-sıralama iletişim kuralı sağlar. Genomik DNA örneği almak için kullanılan bisülfit-sıralama iletişim kuralları ile farklılıklar bir önceki Restriksiyon enzimi sindirim adım ve bioinformatic analiz kullanımı dışarı yanlış pozitif NUMT dizileri kaynaklanan iktidar yatıyor.
MtDNA metilasyonu soruşturma bisülfit-sıralama yapıları önlemek için bir protokol sağlar. Yanlış-mutlak için önde gelen bisülfit sıralama eserler daha önce raporlanmış37idi. DNA aksesuar proteinler İndinavir K olmuştur tarafından yetersiz kaldırılması37nitelendirdi. Eksik denatürasyon veya kısmi reannealing eksik dönüşüm, menziller için muhtemelen bisülfit tek iplikçikli DNA37, erişim düşürerek yol açabilir. Daha sonra yapının nerede bir ikincil yapı cytosines erişim zarar mtDNA oyunda olabilir. Bizim bilgi en iyi şekilde, Restriksiyon enzimi sindirim adım mtDNA metilasyonu tahmin etme, içeriğinde bisülfit dönüştürmeden önce eklenmesi ilk 20163,28yılında bildirilmiştir. Elimizde çok, bir tek-kesici Restriksiyon enzimi ile önceki sindirim önemli ölçüde Dönüştürülmeyen cytosines3,28tespiti indirdi.
Burada, bir bioinformatic boru hattı bisülfit sıralama sonuçları analiz etmek ve bütün mitokondrial genom bisülfit sıralama Bağlamında bisülfit sıralama yapıları algılamak için sağlamak. Bu yöntem bizim gözlem bu mtDNA kaynaklı olmayan dönüşüm oranı ters derinliği3,28sıralama ile ilişkili. Bu gözlem mtDNA ikincil ve hatta üçüncül yapısı mtDNA özel bölgeler, parçalanma sıralama kitaplıkları inşaatı sırasında bozar ve ayrıca Sodyum bisülfit mtDNA için tam erişim zarar göstermektedir. Sindirim bir kesici enzim ile ikincil ve üçüncül yapıları bültenleri beri bizim sonuçları mtDNA yapısı bisülfit artifakı kaynağıdır ve sitozin metilasyonu mtDNA içinde miktar için burada açıklanan yöntemleri doğrulamak gösterir.
Nükleer DNA Mitokondrial hazırlık kaçınılmaz kirlenme bir meydan okuma kabul ettiğiniz anlamına gelir. Bu bile performans hedef bağlandığınızda mtDNA, sitozin metilasyonu tahmini önyargı sıralama okuma içinde NUMT dizileri kirlenme ve bütün mitokondrial genom bisülfit sıralama yol açar. Böyle önyargı önlemek için NUMTs adlı metilasyonu ile kirlenme dışlamak için benzersiz bisülfit sıralama astar tasarımı sağlar. Belirli bölgeler insan ve fare mitokondrial genom % 100 kimlik ile NUMTs yayılan ve bu, bu nedenle, belirli mtDNA bölgelerde, benzersiz astar tasarım mümkün değildir. Bütün mitokondrial genom bisülfit sıralama, uzun sıralama işlemi sırasında okuma mtDNA ve NUMTs arasında ayrımcılık dindirebilirim. Benzersiz olarak mitokondriyal genom eşlenen okuma daha da fazla tüm genom ve tek kullanım kaydırılmasını okuma algılama mtDNA metilasyon olun.
Son olarak, bu protokol mitokondrial genom Örneğin, burada DNA'ın ikincil yapısı yapı potansiyel bir kaynak gösterir bisülfit sıralama diğer durumlarda kullanılabilir. Derneğin metilasyon düzeyleri ile sıralama derinlik bisülfit sıralama öncesinde Restriksiyon enzimi ile sindirim karmaşık DNA dizilerinin ihtiyacını değerlendirmek için soruşturma olması.

Mitokondrial genom yaklaşık 16,5-kilo Bankası (kb) dairesel, Çift iplikçikli yapısını uzun, bir ağır ve hafif bir tel adıyla aynıdır. Mitokondrial genom her hücresi olarak maternally-miras, birden çok kopya mevcut ve solunum zinciri kompleksleri1temel bileşenlerine kodlar. Benzer bakteriyel genom ve nükleer genom aksine, mitokondriyal genom sayısız ikincil ve üçüncül yapılarını gibi sarmal ve supercoiled yapıları2erişim sırasında sıralama zor hale getirebilir, düzenlenmiştir deneyler3.
Çekirdeğinde, DNA metilasyonu Gen ifadesinin düzenlenmesinde başta olmak üzere çok sayıda süreçlerde bir rol oynayan bir kapsamlı okudu epigenetik işaretidir. Memeli genleri içinde DNA metilasyonu öncelikle deoxycytidines, CG dinucleotides (ya da KSY) üzerinde çoğunlukla pirimidin halka 5 konumunu oluşuyor. Sitozin metilasyonu tüm CpG % 70'i somatik hücreler ve hesapları için toplam % ~ 1 genomu DNA4üsleri bulunur. DNA methylations da EBM, CpT ve TBM gibi sigara CpG bağlamlarda tarif edilmiştir ve embriyonik kök hücre5,6,7tüm metillenmiş cytosines % 25'e kadar değerler ile nükleer DNA çeşitli miktarlarda bulunmaktadır.
Sitozin metilasyonu nükleer genom kopyası yaygın olarak kabul ederken, mitokondriyal DNA (mtDNA) metilasyonu varlığını hala tartışmalıdır. İlk çalışma araştıran mtDNA metilasyonu nerede mtDNA metilasyonu kolayca tespit edildi, kültürlü hücrelerde nükleer DNA8' e göre daha alt düzeylerde rağmen gerçekleştirildi. İnsan ve fare hücrelerinde mtDNA metilasyonu de düşük düzeyde (% 2-5) tespit edilmiştir. 5 metilsitozin yakalama tarafından kantitatif PCR takip metillenmiş DNA immunoprecipitation (MeDIP) gibi güvenerek deneyleri kullanarak, mtDNA metilasyonu ayrıca çeşitli fare ve insan algılandı ve çizgiler9,10, hücre 11,12. 5-metilsitozin ELISA tahlil veya kütle spektrometresi karşı antikor kullanarak, DNA metilasyonu önemli düzeyde saf mitokondriyal kesirler13,14,15, tespit edildi 16. ancak, yukarıda belirtilen çalışmalar deneyleri tek Bankası çözünürlükte DNA metilasyon mutlak miktar sağlamak için tasarlanmamıştır teknikleri kullanılır.
Nicel ve resolutive DNA metilasyonu Analizi urasil tek iplikçikli DNA bağlam17 bazlar sitozin dönüştürmek için Sodyum bisülfit mülkiyeti yararlanır "bisülfit sıralama", adlı bir teknik elde edilebilir . Bisülfit sıralama kullanarak, bir takımyıldızı yönünde çalışmaların sitozin metilasyonu çeşitli düzeylerde varlığı tespit etti. D-loop bölgesi, 12'leri veya 16S bölge metilasyonu mtDNA kolayca insan18,19,20,21,22,23 ve fare24 ' te algılandı doku ve hücreler, ancak, ilginç bir değişkenliği çalışmalar genelinde toplam cytosines % 1-20'si ile.
Bu çok sayıda çalışmalar ile karşılaştırıldığında sadece birkaç çalışmalar bizim gruptan da dahil olmak üzere, mtDNA metilasyonu3,25,26,27 varlığı tartışmalı veya biyolojik alaka sorguladı mtDNA düzeyleri (% 2) aşağıda28çok az düzeyde. Son zamanlarda, biz bütün mitokondrial bisülfit sıralama3potansiyel bir bisülfit-sıralama artifakı gözlenmesi bildirdi. Biz böylece metilasyonu düzeyleri overestimating mitokondrial DNA'ın ikincil yapısı bisülfit sıralama, yanlış pozitif neden olabilir kanıt sağladı. Biz burada bir obje bisülfit-dönüşüm mtDNA önlemek için bir protokol sağlar. Bu iletişim kuralı bir basit enzimatik sindirim DNA'ın mtDNA ikincil yapılar bozmaya ve bisülfit sıralama protokol sonrası bisülfit tam erişime izin kullanır. Buna ek olarak, biz bisülfit sıralama analizi için bir eşlik eden bioinformatic boru hattı sağlar.

<table><tbody><tr><td>BamHI</td><td>New England BioLabs</td><td># R0136</td><td></td></tr><tr><td>EZ DNA methylation-lightning kit</td><td>Zymo Research</td><td># D5030&amp;nbsp;</td><td></td></tr><tr><td>Qubit ssDNA assay</td><td>Thermo Fisher Scientific</td><td># Q10212</td><td></td></tr><tr><td>Qubit assay tubes</td><td>Thermo Fisher Scientific</td><td># Q32856</td><td></td></tr><tr><td>HotStarTaq plus DNA polymerase kit</td><td>Qiagen</td><td># 203603&amp;nbsp;</td><td></td></tr><tr><td>QIAquick Gel Extraction Kit</td><td>Qiagen</td><td># 28704</td><td></td></tr><tr><td>NEBNext Ultra DNA Library Kit for Illumina</td><td>New England BioLabs</td><td># E7370S</td><td></td></tr><tr><td>NEBNext Multiplex Oligoes for Illumina</td><td>New England BioLabs</td><td># E7335S</td><td></td></tr><tr><td>AMPure XP Beads</td><td>Beckman Coulter</td><td># A63881</td><td></td></tr><tr><td>High Sensitivity DNA chip</td><td>Agilent</td><td># 5067-4626</td><td></td></tr><tr><td>Qubit high sensitivity dsDNA assay</td><td>Thermo Fisher Scientific</td><td># Q33230</td><td></td></tr><tr><td>MiSeq reagent kit v2 300 cycles</td><td>Illumina</td><td># MS-102-2003</td><td></td></tr><tr><td>PhiX control v3</td><td>Illumina</td><td># FC-110-3001</td><td></td></tr><tr><td>Sodium hydroxide&amp;nbsp;</td><td>Sigma</td><td># S5881</td><td></td></tr><tr><td>Thermal cycler C1000</td><td>Biorad</td><td># 1851148</td><td></td></tr><tr><td>CFX96 Real-Time PCR detection system</td><td>Biorad&amp;nbsp;</td><td>#1855195</td><td></td></tr><tr><td>Qubit Fluorometer</td><td>Thermo Fisher Scientific</td><td># Q33226</td><td></td></tr><tr><td>Bioanalyzer 2100</td><td>Agilent</td><td># G2939BA</td><td></td></tr><tr><td>MiSeq instrument</td><td>Illumina</td><td># SY-410-1003</td><td></td></tr></tbody></table>

methodology for accurate detection of mitochondrial dna methylation

Miktar DNA metilasyon kullanan glikozilasyonu sonunda, bir tek iplikçikli DNA bağlamda bazlar sitozin dönüştürmek için Sodyum bisülfit mülkiyeti yararlanır bisülfit sıralama elde edilebilir. Bisülfit sıralama olabilir (PCR kullanarak) hedef veya tüm genom üzerinde gerçekleştirilen ve sitozin metilasyonu tek Bankası çözünürlükte mutlak miktar sağlar. Nükleer ve mitokondrial DNA, farklı doğası özellikle ikincil yapısında göz önüne alındığında, adaptasyonlar bisülfit sıralama yöntemleri için mtDNA sitozin metilasyonu soruşturma yapılması gerekir. MtDNA ikincil ve üçüncül yapısı gerçekten yanlış-mutlak bisülfit tek iplikçikli DNA'için tamamlanmamış denatürasyon zavallı erişim nedeniyle önde gelen eserler sıralama bisülfit yol açabilir. Burada, DNA'ın bir enzimatik sindirim BamHI bioinformatic analiz boru hattı ile birleştiğinde ile doğru miktar sitozin metilasyonu seviyelerinde mtDNA izin vermek için bir iletişim kuralı'nı açıklar. Buna ek olarak, biz yönergeleri bisülfit sıralama astar için mtDNA belirli tasarlamak için istenmeyen nükleer mitokondrial bölümlerini hedeflemek önlemek için (NUMTs) nükleer genom eklenmiş.

Bu protokol iki adımda mtDNA metilasyonu soruşturma zaman önemlidir. 1) 2) mitokondriyal DNA özgü astar tasarım ve ikincil yapı açılmasına.
İnsan genomik DNA Restriksiyon enzimi BamHI (Şekil 1) ile sindirerek, mitokondriyal DNA yapısı nükleotit konumda 14,258 kesilir ve ikincil yapı açılacak.
Bisülfit dönüşüm bir bozulmamış mtDNA ikincil yapı ile olası bozulma mtDNA unconversion oranı abartma muhtemeldir. Bisülfit sıralama tarafından mtDNA unconversion oranı araştırıldı, sindirilmemiş ve toplam DNA Mitokondrial genom 5 farklı bölgelerinde, insan iskelet kas hücrelerinden sindirmek: deplasman döngü (D-Loop), tRNA Fenilalanin ve 12'leri ribozom (tRNA - F + 12'leri), 16S ribozom (16S), NADH dehidrogenaz 5 (ND5) ve sitokrom b (CYTB) mRNA kodlama gen (Şekil 2). Unconversion oranı 0'dan - değişiyordu %15,1 karşıdan karşıya tüm incelenen bölge sindirilmemiş mtDNA için. DNA bisülfit dönüşüm önce sindirilmiş, ancak, unconversion oranı en fazla % 1'için tüm bölgeler (Şekil 3) arasında düştü. Böylece, BamHI sindirim tahmindi mtDNA metilasyon düzeyi önlemek için bisülfit dönüştürmeden önce önemini gösteren.
Kirlenme nükleer DNA Mitokondrial genom yalıtma zaman kaçınılmazdır ve neredeyse tüm mitokondrial genom nükleer genom çoğaltıldıktan sonra bu nükleer olarak adlandırdığı mitokondrial genom nükleer eklemeleri için rise verdi Mitokondrial kesimleri (NUMTs)36. Analiz DNA metilasyonu düzeyleri mitokondrial DNA ve değil NUMTs karşılık gelen emin olmak için mitokondriyal genom özgü astar tasarlamak için en dıştaki önem taşıyor. Şekil 4 astar özgüllük ve Tablo 1 görüntüler insan ve fare mtDNA astar dizileri kontrol etmek için nasıl gösterir.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Adı</td>
			<td colspan="3">Sıra</td>
			<td>Pozisyon</td>
			<td>Amplicon boyutu</td>
			<td>Tavlama sıcaklığı</td>
			<td>Strand</td>
		</tr>
<tr>
<td>İnsan</td>
			<td colspan="3"></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>D-Loop</td>
			<td colspan="3">F: AAATCTATCACCCTATTAAC</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: GTGGAAATTTTTTGTTATGATGT</td>
			<td>6-298</td>
			<td>292</td>
			<td>55° C</td>
			<td>Antisens</td>
		</tr>
<tr>
<td>D-Loop</td>
			<td colspan="3">F: CATAACAAAAAATTTCCACCAAAC</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: GGGAAAATAATGTGTTAGTT</td>
			<td>279-458</td>
			<td>179</td>
			<td>55° C</td>
			<td>Antisens</td>
		</tr>
<tr>
<td>12'LERİ + TF</td>
			<td colspan="3">F: TTTATATAACTTACCTCCTC</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: GTGTTTGATGTTTGTTTTTTTTG</td>
			<td>577-765</td>
			<td>188</td>
			<td>55° C</td>
			<td>Antisens</td>
		</tr>
<tr>
<td>466</td>
			<td colspan="3">F: AATAAATTTATAGGTTTTTAAATTATTAAAT</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: TAACTAATAAAATCTTAACATATACTACTC</td>
			<td>2763-2873</td>
			<td>110</td>
			<td>53° C</td>
			<td>Anlamda</td>
		</tr>
<tr>
<td>CYTB</td>
			<td colspan="3">F: GGTATTATTTTTTTGTTTGTAATTATAGTA</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: CCTCAAATTCATTAAACTAAATCTATCC</td>
			<td>15091-15243</td>
			<td>152</td>
			<td>55° C</td>
			<td>Anlamda</td>
		</tr>
<tr>
<td>Fare</td>
			<td colspan="3"></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>12'LERİ</td>
			<td colspan="3">F: ACACATACAAACCTCCATAAAC</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: GAGGTATAATTTAGTTAAAT</td>
			<td>111-287</td>
			<td>176</td>
			<td>53° C</td>
			<td>Antisens</td>
		</tr>
<tr>
<td>466</td>
			<td colspan="3">F: AAATTCCAATTCTCCAAACATAC</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: TTTGGATTTTTTTTTTAGGT</td>
			<td>1749-1896</td>
			<td>147</td>
			<td>53° C</td>
			<td>Antisens</td>
		</tr>
<tr>
<td>CYTB</td>
			<td colspan="3">F: CTACAAAAACACCTAATAACAAAC</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: AGTGTATGGTTAAGAAAAGA</td>
			<td>14129 14307</td>
			<td>178</td>
			<td>55° C</td>
			<td>Antisens</td>
		</tr>
<tr>
<td>466</td>
			<td colspan="3">F: AGAGAAATAGAGTTATTTTATAAATAAG</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: CTAAAAACAAAATTTTAAATCTTAC</td>
			<td>2576-2727</td>
			<td>151</td>
			<td>55° C</td>
			<td>Anlamda</td>
		</tr>
<tr>
<td>ND5</td>
			<td colspan="3">F: TTAAGTTAATTAGGTTTGATAATAGTGA</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: TAAAACCCTATTAAAAATAATATTCCTATA</td>
			<td>12659-12910</td>
			<td>251</td>
			<td>55° C</td>
			<td>Anlamda</td>
		</tr>
<tr>
<td>CYTB</td>
			<td colspan="3">F: TGGGTTTTTTTTAGGAGTTTGTTTA</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: CAATAAAAATACTCCAATATTTCAAATTTC</td>
			<td>14242-14504</td>
			<td>262</td>
			<td>55° C</td>
			<td>Anlamda</td>
		</tr>
</tbody></table>Tablo 1: astar dizileri için insan ve fare mtDNA. PCR sıcaklıklarında tavlama astar astar erime sıcaklık farklılıkları nedeniyle değişiklik unutmayın.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57772/57772fig1.jpg"> Resim 1 : Jel Elektroforez BamHI sindirilmiş veya sindirilmemiş DNA'ın. İnsan iskelet kas genomik DNA tedavi edilmediği veya 4 h 37 ° C için BamHI ile tedavi ve jel elektroforez % 1.5 özel jel üzerinde çalıştırıldı. <a href="/files/ftp_upload/57772/57772fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57772/57772fig2.jpg"> Resim 2 : İnsan mitokondriyal genom haritası. Bisülfit sıralama ve BamHI Restriksiyon enzimi site tarafından araştırıldı mitokondri genom kopyası bölgeleri görüntülenir. Mitokondrial DNA 13 mRNA'ların, 2 ribozomal RNA ve 22 transfer RNA'lar içerir. Kısaltmalar: PH1: ağır iplikçikli organizatörü 1; PH2: ağır iplikçikli teşvik 2; PL: ışık-strand organizatörü; OH: Kökeni ağır iplikçikli çoğaltmada; EyL: ışık-strand çoğaltmada kökeni. <a href="/files/ftp_upload/57772/57772fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57772/57772fig3v2.jpg"> Şekil 3 : BamHI sindirim bisülfit dönüştürmeden önce insan iskelet kas hücreleri mtDNA unconversion ücretine azaltır. Sindirilmemiş ve sindirilmiş mitokondrial DNA unconversion yüzde bisülfit sıralama tarafından sorguya, beş farklı bölgeleri insan iskelet kas hücrelerindeki mitokondri genom kopyası (N= 3). Tam kare CpG siteleri ve açık Meydanı CpG olmayan siteleri temsil eder. Sonuçlar en az en fazla aralığı ile sunulur ve bir işareti test önemli unconversion farklar için test etmek için kullanılmıştır. D-Loop (6-298) P1.83E =-42; D-Loop (279-458): P4.55E =-13; tRNA - F + 12'leri: P8.38E =-16; 16s: P5.91E =-06; ND5: P1.70E =-05; CYTB: P2.69E =-10. D-Loop (6-298) çoğaltma kaynağı içerir ve ağır strand organizatörü 2 tRNA - F + 12'leri içerir. Bu veriler olmuştur başka bir yerde 3yayınlandı. <a href="/files/ftp_upload/57772/57772fig3v2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57772/57772fig4.jpg"> Şekil 4 : Bisearch astar özgüllük mitokondrial genom doğru doğrulamak için kullanımı. A) bisülfit dönüştürülmüş astar dizileri BiSearch işlevine astar arama (http://bisearch.enzim.hu/?m=genompsearch) eklenir. Bisülfit kutusunu işaretli ve başvuru genom seçilir. B) anlam ve antisens zincirleri üzerinde oluşturulan potansiyel PCR ürünleri örneği. <a href="/files/ftp_upload/57772/57772fig4large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>

Watch this Scientific Journal Video about Methodology for Accurate Detection of Mitochondrial DNA Methylation at JoVE.com

Methodology for Accurate Detection of Mitochondrial DNA Methylation

Burada, mitokondriyal DNA (mtDNA) metilasyon doğru miktar bir iletişim kuralını mevcut. Bu protokol için bir enzimatik sindirim DNA BamHI tahmindi mtDNA metilasyon düzeyi mtDNA ikincil yapı tarafından neden önlemek için kullanılan bioinformatic analiz boru hattı ile birleştiğinde ile açıklanmaktadır.

Mitokondrial DNA metilasyonu doğru algılanması için metodoloji

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert ...

methodology-for-accurate-detection-of-mitochondrial-dna-methylation

Nanyang Technological University

Research

JoVE Journal

Genetics

13.3K Görüntüleme.  University of Copenhagen. Burada, mitokondriyal DNA (mtDNA) metilasyon doğru miktar bir iletişim kuralını mevcut. Bu protokol için bir enzimatik sindirim DNA BamHI tahmindi mtDNA metilasyon düzeyi mtDNA ikincil yapı tarafından neden önlemek için kullanılan bioinformatic analiz boru hattı ile birleştiğinde ile açıklanmaktadır.

Video: Methodology for Accurate Detection of Mitochondrial DNA Methylation

Methylated DNA Immunoprecipitation

The identification of DNA methylation patterns is a common procedure in the study of epigenetics, as methylation is known to have significant effects on gene expression, and is involved with normal development as well as disease 1-4. Thus, the ability to discriminate between methylated DNA and non-methylated DNA is essential for generating methylation profiles for such studies. Methylated DNA immunoprecipitation (MeDIP) is an efficient technique for the extraction of methylated DNA from a sample of interest 5-7. A sample of as little as 200 ng of DNA is sufficient for the antibody, or immunoprecipitation (IP), reaction. DNA is sonicated into fragments ranging in size from 300-1000 bp, and is divided into immunoprecipitated (IP) and input (IN) portions. IP DNA is subsequently heat denatured and then incubated with anti-5'mC, allowing the monoclonal antibody to bind methylated DNA. After this, magnetic beads containing a secondary antibody with affinity for the primary antibody are added, and incubated. These bead-linked antibodies will bind the monoclonal antibody used in the first step. DNA bound to the antibody complex (methylated DNA) is separated from the rest of the DNA by using a magnet to pull the complexes out of solution. Several washes using IP buffer are then performed to remove the unbound, non-methylated DNA. The methylated DNA/antibody complexes are then digested with Proteinase K to digest the antibodies leaving only the methylated DNA intact. The enriched DNA is purified by phenol:chloroform extraction to remove the protein matter and then precipitated and resuspended in water for later use. PCR techniques can be used to validate the efficiency of the MeDIP procedure by analyzing the amplification products of IP and IN DNA for regions known to lack and known to contain methylated sequences. The purified methylated DNA can then be used for locus-specific (PCR) or genome-wide (microarray and sequencing) methylation studies, and is particularly useful when applied in conjunction with other research tools such as gene expression profiling and array comparative genome hybridization (CGH) 8. Further investigation into DNA methylation will lead to the discovery of new epigenetic targets, which in turn, may be useful in developing new therapeutic or prognostic research tools for diseases such as cancer that are characterized by aberrantly methylated DNA 2, 4, 9-11.

This video demonstrates the protocol for methylated DNA immunoprecipitation (MeDIP). MeDIP is a two day procedure that selectively extracts methylated DNA fragments from a genomic DNA sample using antibodies with specificity for 5 -methylcytosine (anti-5 mC).

Metillenmiş DNA Immunoprecipitation

The identification of DNA methylation patterns is a common procedure in the study of epigenetics, as methylation is known to have significant effects on ...

Biyoloji

Optimized Analysis of DNA Methylation and Gene Expression from Small, Anatomically-defined Areas of the Brain

Exposure to diet, drugs and early life adversity during sensitive windows of life 1,2 can lead to lasting changes in gene expression that contribute to the display of physiological and behavioural phenotypes. Such environmental programming is likely to increase the susceptibility to metabolic, cardiovascular and mental diseases 3,4.
DNA methylation and histone modifications are considered key processes in the mediation of the gene-environment dialogue and appear also to underlay environmental programming 5. In mammals, DNA methylation typically comprises the covalent addition of a methyl group at the 5-position of cytosine within the context of CpG dinucleotides.
CpG methylation occurs in a highly tissue- and cell-specific manner making it a challenge to study discrete, small regions of the brain where cellular heterogeneity is high and tissue quantity limited. Moreover, because gene expression and methylation are closely linked events, increased value can be gained by comparing both parameters in the same sample.
Here, a step-by-step protocol (Figure 1) for the investigation of epigenetic programming in the brain is presented using the 'maternal separation' paradigm of early life adversity for illustrative purposes. The protocol describes the preparation of micropunches from differentially-aged mouse brains from which DNA and RNA can be simultaneously isolated, thus allowing DNA methylation and gene expression analyses in the same sample.

A streamlined workflow to study DNA methylation and gene expression changes upon early-life stress is shown. Starting from maternal separation of newborn mice and isolation of discrete brain tissues, we represent a protocol to simultaneously isolate DNA and RNA from brain tissue punches for subsequent bisulfite sequencing and RT-PCR analysis.

Beyin Küçük, Anatomik tanımlı alanları DNA metilasyon ve Gen İfade Optimize Analizi

Exposure to diet, drugs and early life adversity during sensitive windows of life 1,2 can lead to lasting changes in gene expression that contribute to ...

Nörobilim

Continuous Fluorescence-Based Endonuclease-Coupled DNA Methylation Assay to Screen for DNA Methyltransferase Inhibitors

DNA methylation, a form of epigenetic gene regulation, is important for normal cellular function. In cells, proteins called DNA methyltransferases (DNMTs) establish and maintain the DNA methylation pattern. Changes to the normal DNA methylation pattern are linked to cancer development and progression, making DNMTs potential cancer drug targets. Thus, identifying and characterizing novel small molecule inhibitors of these enzymes is of great importance. This paper presents a protocol that can be used to screen for DNA methyltransferase inhibitors. The continuous coupled kinetics assay allows for initial velocities of DNA methylation to be determined in the presence and absence of potential small molecule inhibitors. The assay uses the methyl-sensitive endonuclease Gla I to couple methylation of a hemimethylated DNA substrate to fluorescence generation.
This continuous assay allows for enzyme activity to be monitored in real time. Conducting the assay in small volumes in microtiter plates reduces the cost of reagents. Using this assay, a small example screen was conducted for inhibitors of DNMT1, the most abundant DNMT isozyme in humans. The highly substituted anthraquinone natural product, laccaic acid A, is a potent, DNA-competitive inhibitor of DNMT1. Here, we examine three potential small molecule inhibitors &#8212; anthraquinones or anthraquinone-like molecules with one to three substituents &#8212; at two concentrations to describe the assay protocol. Initial velocities are used to calculate the percent activity observed in the presence of each molecule. One of three compounds examined exhibits concentration-dependent inhibition of DNMT1 activity, indicating that it is a potential inhibitor of DNMT1.

DNA methyltransferases are potential cancer drug targets. Here, a protocol is presented to assess small molecules for DNA methyltransferase inhibition. This assay utilizes an endonuclease to couple DNA methylation to fluorescence generation and allows for enzyme activity to be monitored in real time.&#160;

DNA Metiltransferaz İnhibitörlerini Taramak için Sürekli Floresan Bazlı Endonükleaz Bağlantılı DNA Metilasyon Testi

DNA methylation, a form of epigenetic gene regulation, is important for normal cellular function. In cells, proteins called DNA methyltransferases (DNMTs) ...

Biyokimya

mtDNA'nın sentezi ve dağılımının yüksek verimli miktar tayini

High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells produce most of their ATP in the mitochondria by oxidative phosphorylation. Mitochondria are unique organelles because they have their own genome that is replicated and passed on to the next generation of cells. In contrast to the nuclear genome, there are multiple copies of the mitochondrial genome in the cell. The detailed study of the mechanisms responsible for the replication, repair, and maintenance of the mitochondrial genome is essential for understanding the proper functioning of mitochondria and whole cells under both normal and disease conditions. Here, a method that allows the high-throughput quantification of the synthesis and distribution of mitochondrial DNA (mtDNA) in human cells cultured in vitro is presented. This approach is based on the immunofluorescence detection of actively synthesized DNA molecules labeled by 5-bromo-2'-deoxyuridine (BrdU) incorporation and the concurrent detection of all the mtDNA molecules with anti-DNA antibodies. Additionally, the mitochondria are visualized with specific dyes or antibodies. The culturing of cells in a multi-well format and the utilization of an automated fluorescence microscope make it easier to study the dynamics of mtDNA and the morphology of mitochondria under a variety of experimental conditions in a relatively short time.

Yazar Spotlight: Mitokondriyal DNA Sentezi ve Dağılımının Yüksek Verimli Görüntü Tabanlı Miktar Tayini  

A procedure for studying the dynamics of mitochondrial DNA (mtDNA) metabolism in cells using a multi-well plate format and automated immunofluorescence imaging to detect and quantify mtDNA synthesis and distribution is described. This can be further used to investigate the effects of various inhibitors, cellular stresses, and gene silencing on mtDNA metabolism.

Mitokondriyal DNA Sentezi ve Dağılımının Yüksek Verimli Görüntü Tabanlı Nicelleştirilmesi

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells ...

DNA Methylation: Bisulphite Modification and Analysis

Epigenetics describes the heritable changes in gene function that occur independently to the DNA sequence. The molecular basis of epigenetic gene regulation is complex, but essentially involves modifications to the DNA itself or the proteins with which DNA associates. The predominant epigenetic modification of DNA in mammalian genomes is methylation of cytosine nucleotides (5-MeC). DNA methylation provides instruction to gene expression machinery as to where and when the gene should be expressed. The primary target sequence for DNA methylation in mammals is 5'-CpG-3' dinucleotides (Figure 1). CpG dinucleotides are not uniformly distributed throughout the genome, but are concentrated in regions of repetitive genomic sequences and CpG "islands" commonly associated with gene promoters (Figure 1). DNA methylation patterns are established early in development, modulated during tissue specific differentiation and disrupted in many disease states including cancer. To understand the biological role of DNA methylation and its role in human disease, precise, efficient and reproducible methods are required to detect and quantify individual 5-MeCs.
This protocol for bisulphite conversion is the "gold standard" for DNA methylation analysis and facilitates identification and quantification of DNA methylation at single nucleotide resolution. The chemistry of cytosine deamination by sodium bisulphite involves three steps (Figure 2). (1) Sulphonation: The addition of bisulphite to the 5-6 double bond of cytosine (2) Hydrolic Deamination: hydrolytic deamination of the resulting cytosine-bisulphite derivative to give a uracil-bisulphite derivative (3) Alkali Desulphonation: Removal of the sulphonate group by an alkali treatment, to give uracil. Bisulphite preferentially deaminates cytosine to uracil in single stranded DNA, whereas 5-MeC, is refractory to bisulphite-mediated deamination. Upon PCR amplification, uracil is amplified as thymine while 5-MeC residues remain as cytosines, allowing methylated CpGs to be distinguished from unmethylated CpGs by presence of a cytosine "C" versus thymine "T" residue during sequencing.
DNA modification by bisulphite conversion is a well-established protocol that can be exploited for many methods of DNA methylation analysis. Since the detection of 5-MeC by bisulphite conversion was first demonstrated by Frommer et al.1 and Clark et al.2, methods based around bisulphite conversion of genomic DNA account for the majority of new data on DNA methylation. Different methods of post PCR analysis may be utilized, depending on the degree of specificity and resolution of methylation required. Cloning and sequencing is still the most readily available method that can give single nucleotide resolution for methylation across the DNA molecule.

The gold standard for DNA methylation analysis is genomic sequencing of bisulphite converted DNA. This method takes advantage of the increased sensitivity of cytosine compared with 5-methylcytosine (5-MeC) to bisulphite deamination under acidic conditions. Unmethylated cytosines can be distinguished from methylated cytosines after PCR amplification of the target genomic DNA.

DNA Metilasyonu: bisülfit modifikasyonu ve Analiz

Epigenetics describes the heritable changes in gene function that occur independently to the DNA sequence. The molecular basis of epigenetic gene ...

Enhanced Reduced Representation Bisulfite Sequencing for Assessment of DNA Methylation at Base Pair Resolution

DNA methylation pattern mapping is heavily studied in normal and diseased tissues. A variety of methods have been established to interrogate the cytosine methylation patterns in cells. Reduced representation of whole genome bisulfite sequencing was developed to detect quantitative base pair resolution cytosine methylation patterns at GC-rich genomic loci. This is accomplished by combining the use of a restriction enzyme followed by bisulfite conversion. Enhanced Reduced Representation Bisulfite Sequencing (ERRBS) increases the biologically relevant genomic loci covered and has been used to profile cytosine methylation in DNA from human, mouse and other organisms. ERRBS initiates with restriction enzyme digestion of DNA to generate low molecular weight fragments for use in library preparation. These fragments are subjected to standard library construction for next generation sequencing. Bisulfite conversion of unmethylated cytosines prior to the final amplification step allows for quantitative base resolution of cytosine methylation levels in covered genomic loci. The protocol can be completed within four days. Despite low complexity in the first three bases sequenced, ERRBS libraries yield high quality data when using a designated sequencing control lane. Mapping and bioinformatics analysis is then performed and yields data that can be easily integrated with a variety of genome-wide platforms. ERRBS can utilize small input material quantities making it feasible to process human clinical samples and applicable in a range of research applications. The video produced demonstrates critical steps of the ERRBS protocol.

Enhanced Reduced Representation Bisulfite Sequencing is a method for the preparation of sequencing libraries for DNA methylation analysis based on restriction enzyme digestion combined with cytosine bisulfite conversion. This protocol requires 50 ng of starting material and yields base pair resolution data at GC-rich genomic regions.

Baz Çifti Çözünürlük DNA metilasyon Değerlendirme Temsil bisülfit sıralamayı İndirimli pekiştirilmiş

DNA methylation pattern mapping is heavily studied in normal and diseased tissues. A variety of methods have been established to interrogate the cytosine ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of particular interest for epigenetic studies as it has been demonstrated to be both a long lasting and a dynamic regulator of gene expression. Efforts to examine epigenetic changes in health and disease have been hindered by the lack of high-throughput, quantitatively accurate methods. With the advent and popularization of next-generation sequencing (NGS) technologies, these tools are now being applied to epigenomics in addition to existing genomic and transcriptomic methodologies. For epigenetic investigations of cytosine methylation where regions of interest, such as specific gene promoters or CpG islands, have been identified and there is a need to examine significant numbers of samples with high quantitative accuracy, we have developed a method called Bisulfite Amplicon Sequencing (BSAS). This method combines bisulfite conversion with targeted amplification of regions of interest, transposome-mediated library construction and benchtop NGS. BSAS offers a rapid and efficient method for analysis of up to 10 kb of targeted regions in up to 96 samples at a time that can be performed by most research groups with basic molecular biology skills. The results provide absolute quantitation of cytosine methylation with base specificity. BSAS can be applied to any genomic region from any DNA source. This method is useful for hypothesis testing studies of target regions of interest as well as confirmation of regions identified in genome-wide methylation analyses such as whole genome bisulfite sequencing, reduced representation bisulfite sequencing, and methylated DNA immunoprecipitation sequencing.

Bisulfite amplicon sequencing (BSAS) is a method for quantifying cytosine methylation in targeted genomic regions of interest. This method uses bisulfite conversion paired with PCR amplification of target regions prior to next-generation sequencing to produce absolute quantitation of DNA methylation at a base-specific level.

DNA Metilasyon Analizi nesil Dizilimine tarafından hedef

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

Measuring Single-Cell Mitochondrial DNA Copy Number and Heteroplasmy Using Digital Droplet Polymerase Chain Reaction

The mammalian mitochondrial (mt)DNA is a small, circular, double-stranded, intra-mitochondrial DNA molecule, encoding 13 subunits of the electron transport chain. Unlike the diploid nuclear genome, most cells contain many more copies of mtDNA, ranging from less than 100 to over 200,000 copies depending on cell type. MtDNA copy number is increasingly used as a biomarker for a number of age-related degenerative conditions and diseases, and thus, accurate measurement of the mtDNA copy number is becoming a key tool in both research and diagnostic settings. Mutations in the mtDNA, often occurring as single nucleotide polymorphisms (SNPs) or deletions, can either exist in all copies of the mtDNA within the cell (termed homoplasmy) or as a mixture of mutated and WT mtDNA copies (termed heteroplasmy). Heteroplasmic mtDNA mutations are a major cause of clinical mitochondrial pathology, either in rare diseases or in a growing number of common late-onset diseases such as Parkinson's disease. Determining the level of heteroplasmy present in cells is a critical step in the diagnosis of rare mitochondrial diseases and in research aimed at understanding common late-onset disorders where mitochondria may play a role. MtDNA copy number and heteroplasmy have traditionally been measured by quantitative (q)PCR-based assays or deep sequencing. However, the recent introduction of ddPCR technology has provided an alternative method for measuring both parameters. It offers several advantages over existing methods, including the ability to measure absolute mtDNA copy number and sufficient sensitivity to make accurate measurements from single cells even at low copy numbers. Presented here is a detailed protocol describing the measurement of mtDNA copy number in single cells using ddPCR, referred to as droplet generation PCR henceforth, with the option for simultaneous measurement of heteroplasmy in cells with mtDNA deletions. The possibility of expanding this method to measure heteroplasmy in cells with mtDNA SNPs is also discussed.

Here we present a protocol for measuring absolute mitochondrial (mt)DNA copy number and mtDNA deletion heteroplasmy levels in single cells.

Mitokondrial DNA metilasyonu doğru algılanması için metodoloji

Özet

Daha Fazla Video Keşfet

Metillenmiş DNA Immunoprecipitation

Beyin Küçük, Anatomik tanımlı alanları DNA metilasyon ve Gen İfade Optimize Analizi

DNA Metiltransferaz İnhibitörlerini Taramak için Sürekli Floresan Bazlı Endonükleaz Bağlantılı DNA Metilasyon Testi

Mitokondriyal DNA Sentezi ve Dağılımının Yüksek Verimli Görüntü Tabanlı Nicelleştirilmesi

Mitokondriyal DNA Sentezi ve Dağılımının Yüksek Verimli Görüntü Tabanlı Nicelleştirilmesi

Mitokondriyal DNA Sentezi ve Dağılımının Yüksek Verimli Görüntü Tabanlı Nicelleştirilmesi

DNA Metilasyonu: bisülfit modifikasyonu ve Analiz

Baz Çifti Çözünürlük DNA metilasyon Değerlendirme Temsil bisülfit sıralamayı İndirimli pekiştirilmiş

DNA Metilasyon Analizi nesil Dizilimine tarafından hedef

Dijital Damlacık Polimeraz Zincir Reaksiyonu Kullanarak Tek Hücreli Mitokondriyal DNA Kopya Sayısını ve Heteroplazmiyi Ölçme