Novo Nordisk Vakfı Merkezi temel metabolik araştırma Kopenhag Üniversitesi kısmen sınırsız bir bağış Novo Nordisk Vakfı tarafından finanse edilen bir bağımsız araştırma merkezidir.

1. Restriksiyon enzimi tedavi
<ol><li>MtDNA insan mitokondriyal DNA'sını 14258 pozisyonda keser BamHI, Restriksiyon enzimi ile toplam insan DNA'sı kabul ederek linearize. Not: fare DNA için aynı koşullar altında Restriksiyon enzimi BglII aşağıdaki gibi kullanın.</li>
	<li>Her biri için mtDNA metilasyonu değerlendirilmesi, bir 0.2 mL tepki tüp hazırlamak ve (fluorometry tarafından sayısal), aşağıdaki mix: 3 μg genomik DNA eklemek için nerede 15 μL örnek tampon 3, 3 μL BamHI ve su ilâ 150 μL</li>
	<li>37 ° C'de 4 h için termal cycler tüplerde yer</li>
</ol>2. bisülfit dönüştürme
<ol><li>BamHI tedavi edilen DNA başka bir yerde29açıklandığı gibi Sodyum bisülfit kullanarak dönüştürmek.</li>
	<li>200-500 ng DNA BamHI tedavi edilen toplam hacmi 20 μL her dönüşüm reaksiyonu için kullanın. DNA kurtarma % 50-70 olduğunu.</li>
	<li>10 μL elüsyon arabelleği bisülfit dönüştürülmüş DNA elute.</li>
	<li>Tek iplikçikli DNA'fluorometry tarafından ölçmek.</li>
	<li>İsteğe bağlı: protokolü ile kalan geçmeden önce bisülfit dönüştürülmüş DNA-20 ° C'de depolayın. Uzun süreli depolama için bisülfit dönüştürülmüş DNA-80 ° C'de depolayın</li>
</ol>3. astar sıralama bisülfit tasarımını
<ol><li>Astarlar çevrimiçi araçlar Methprimer30 ve BiSearch31,32kullanarak bisülfit sıralama için tasarım. Not: Methprimer ve BiSearch astar bağlama dizileri genom dizileri aramak için nereye cytosines thymines, benzer şekilde sonrası bisülfit tedavi için dönüştürülür izin.</li>
	<li>İçin en uygun ve tarafsız güçlendirme, amplicon boyutu 100-300 bp arasında tasarım ve astar KSY dinucleotides kaçının.</li>
	<li>Tasarlanmış astar mitokondrial DNA'yı BiSearch'ın işlevini Astar aramakullanarak belirli olduğundan emin olun. Zaten tasarlanmış bisülfit dönüştürülmüş astar yerleştirin, tıkırtı belgili tanımlık bisülfit kutu ve başvuru genom ve PCR parametreleri de ekleyin. Not: Olası PCR ürünlerinin bir listesini görüntüler.</li>
	<li>1-5 astar dizileri üst kopyalayın ve oligonükleotid sentezi için bir sipariş formu içine yapıştırın. Not: İnsan listesini ve laboratuar ortamında doğrulandı fare mtDNA astar dizileri Tablo 1' de görüntülenir.</li>
	<li>Bisülfit kullanarak test astar 4. adımda açıklanan özel jel elektroforez izleyip PCR dönüştürülür. Test ve tüm astar çiftleri ayrı ayrı optimize etmek ve doğru amplicon boyutu üzerinde özel jel görünür sağlamak. Not: çoğullama astar gerekiyorsa, birden çok astar bir PCR reaksiyon tek ve özel jel elektroforez ya da, daha resolutive bir yöntem gibi benzer ürünlerin ayırt etmek için polyacrylamide Jel Elektroforez, PCR ürünlerde görselleştirmek ekleme boyutu.</li>
</ol>4. bisülfit PCR ve jel ayıklama dönüştürülür
<ol><li>Faiz bölgelerinde yükseltmek için PCR sıcak başlangıç Taq polimeraz kullanarak gerçekleştirin. Kısaca, DNA, 500 µM anlam ve anti-anlamda astar, 1 µL dNTP mix (her dNTP 10 µM) ve polimeraz 7.5 U/tepki olarak toplam hacmi 50 µL., mix 100 ng dönüştürülür çalıştırmak PCR ile aşağıdaki koşullar: 95 ° C'de 5 dk (60 s 94 ° C; 60 s 55 ° C *; 60 s 72 ° C) <img alt="arrow" src="/files/ftp_upload/57772/57772eq2.jpg"> 35 döngüleri; 10 dk 72 ° C. Astar ya da ayrı ayrı kullanın veya multiplexed.</li>
	<li>İsteğe bağlı: astar çoğullama zaman kullanım 200 ng DNA ve aşağıdaki Bisiklet koşullarını dönüştürülür: 5 min 95 ° C (60 s 94 ° C; 90 s 55 ° C *; 90 s 72 ° C) <img alt="arrow" src="/files/ftp_upload/57772/57772eq2.jpg"> 35 döngüleri; 10 dk 72 ° C. Not: Sıcaklık astar erime sıcaklığı bağlı olarak değişebilir.</li>
	<li>Konu PCR ürünleri üzerinde % 2 özel 100 volt Elektroforez jel.</li>
	<li>Nazik UV ışık altında PCR ürünleri bir neşter ile ayıklamak ve mikrotüpler için ekleyin. PCR ürünleri DNA hasarı önlemek için aşırı UV ışık için maruz bırakmayın. Pozlama süresi 30 'un üzerinde kaçının s.</li>
	<li>PCR ürünleri3daha önce açıklandığı gibi jel arıtma kullanarak arındırmak.</li>
	<li>4.5. adımdaki saf DNA ölçmek fluorometry kullanarak. Adım 5 ya da mağaza örnekleri-20 ° C'de geçin</li>
</ol>5. bisülfit Kütüphane hazırlık sıralama
<ol><li>Kütüphane hazırlık bisülfit dönüştürülmüş PCR ürünlerinin gerçekleştirin. İsteğe bağlı: Bu aşamada PCR ürünleri multiplex.</li>
	<li>Son onarım ilâ 100 kullanarak gerçekleştirmek ng PCR ürünü. 55,5 µL PCR ürünü 0.2 mL tüp içinde 3 µL son hazırlık enzim ve 6.5 µL son onarım tepki arabellek (10 x) ekleyin. Yerleştirin ve 65 ° C'de 30 dk ardından 20 ° C'de 30 dk için termal cycler tüpte kuluçkaya</li>
	<li>Sıralama adaptörleri 15 µL Blunt/TA ligaz ile karıştırın, 2.5 µL sonunda tamir DNA karıştırılarak ligate adaptör ve 1 µL ligasyonu artırıcı. Kullanıyorsanız < 100 ng PCR ürünü olarak giriş, seyreltik adaptör 10 kat.</li>
	<li>Bir termal cycler mix (adım 5.3) yerleştirin ve 20 ° C'de 15 dakika kuluçkaya Termal cycler duraklatmak ve 3 µl Kullanıcı eklemek tüp enzim. Mix ve tüp içinde geri termal cycler yerleştirin ve 37 ° C'de 15 dakika kuluçkaya</li>
	<li>Boyutu adaptör bakmaksızın DNA katı faz ters çevrilebilir immobilizasyon (SPRI) boncuk boncuk DNA PCR ürünü boyutuna bağlı olarak değişen oranlara sahip kullanarak seçin.</li>
	<li>13.5 µL H2O adaptör bakmaksızın DNA için adım 5.4 ve 55 resuspended µL SPRI boncuk ekleyin. 5 min ve yer tüp manyetik bir stand için oda sıcaklığında kuluçkaya. Çözüm açık olduğunda, süpernatant aktarmak için yeni bir tüp ve boru boncuk içeren atın. Not: Adaptör bakmaksızın DNA süpernatant içerir ve büyük istenmeyen parçaları için atılan boncuk bağlı.</li>
	<li>25 resuspended µL SPRI boncuk 5.6 adımından süpernatant için ekleyin, karıştırın ve oda sıcaklığında 5 min için kuluçkaya. Tüp manyetik sandalyesine koyun ve çözüm açık olduğunda süpernatant atın. Not: adaptör bakmaksızın DNA boncuk için bağlı olduğu, ancak atılan süpernatant istenmeyen DNA içerir.</li>
	<li>Tüp manyetik kürsüye olmakla birlikte, boncuk yıkamak için 200 µL % 80 etanol (taze hazırlanmış) ekleyin. 30 kuluçkaya s ve Kaldır ve atma süpernatant. Toplam 2 yıkama için bu adımı yineleyin.</li>
	<li>Tüp manyetik stand ile açık bir kapak açıkken kuru boncuk 5 min için hava.</li>
	<li>Tüp mıknatıs kaldırmak, DNA 23 µL elüsyon arabelleği elute ve karıştırın. 2 min için oda sıcaklığında kuluçkaya.</li>
	<li>Tüp manyetik bir stand üzerine yerleştirin ve çözüm açık olduğunda, pre-PCR güçlendirme (adım 5.14) için bir 96-şey PCR tabak 2 µL aktarmak.</li>
	<li>Geri kalan yaklaşık 21 µL PCR güçlendirme (adım 5.17) için yeni bir 0.2 mL tüp aktarın. Not: herhangi bir boncuk boncuk sonraki adımlar Enzimatik reaksiyonları inhibe olabilir gibi aktarmak değil emin olun.</li>
	<li>Adım 5,14 ya da mağaza örnekleri-20 ° C'de geçin</li>
	<li>Pre-PCR güçlendirme adaptör bakmaksızın DNA yükseltmek için gerekli devir sayısını tahmin etmek için RT-qPCR tarafından gerçekleştirin. 96-şey PCR sayfalarımızda plaka içeren 2 µL DNA (adım 5.11) tepki ekleyin: 0.4 µL Dizin astar, 0.4 µL evrensel PCR astar, 7.2 µL H2O, 10 µL RT-qPCR ana karışımı.</li>
	<li>Plaka bir gerçek zamanlı PCR makinesinde yerleştirin ve plaka için aşağıdaki koşullar Konu: 30 s 98 ° c (10 s 98 ° C; 75 s 65 ° C) <img alt="arrow" src="/files/ftp_upload/57772/57772eq2.jpg"> 20 döngüleri; 5 dk 65 ° c</li>
	<li>Her örnek için bir Ct-öncesi amplifikasyon RT-qPCR PCR reaksiyon doğrusal aşamasının sonuna karşılık gelen Ct değerini çıkararak gerekli amplifikasyon döngü sayısı tahmini.</li>
	<li>Adım 5.12 adaptör bakmaksızın DNA'dan karıştırılarak yükseltmek: 21 µL DNA, 25 µL PCR ana karışımı, 1 µL Dizin astar, 1 µL evrensel PCR astar ve 2 µL H2o Termal cycler içinde her örnek için aşağıdaki koşullar Konu: 30 s 98 ° c (10 s 98 ° C; 75 s 65 ° C) <img alt="arrow" src="/files/ftp_upload/57772/57772eq2.jpg"> [adım 5,16 hesaplanan Ct] döngüleri; 5 dk 65 ° c Not: yalnızca bir dizin astar örnek başına çoğullama için izin vermek için kullanmayı unutmayın. Dizin PCR sırasında eklenir.</li>
	<li>Güçlendirilmiş DNA SPRI boncuk arındırmak ve 22 µL elüsyon arabellekte elute.</li>
	<li>Kütüphane kalite jel elektroforez veya alternatif yöntemi tarafından kontrol. Doğru kitaplığa en yüksek boyutları (PCR ürün (ler) boyutu artı adaptör) arayın.</li>
	<li>Smear analizi ile Kütüphane ürün (ler) ortalama baz çifti boyutunu tahmin etmek: Gelişmiş genel ayarları'nda, "tablo" karalama analiz altında çift tıklatın. 100-1000 bp bölgesinden tanımlamak ve Tamam' ı tıklatın. Bölge tabloaltında tanımlanmış bölge görünür ve Kütüphane ortalama boyutu (bp) hesaplanır.</li>
	<li>Kütüphaneler tarafından fluorometry ölçmek. Adım 6 veya mağaza kitaplıklara-20 ° C'de devam</li>
</ol>6. sonraki üretimi sıralaması
<ol><li>NM konsantrasyon kütüphanelerin formülü kullanarak hesaplar: <img alt="Equation" src="/files/ftp_upload/57772/57772eq1.jpg">
</li>
	<li>Aynı nM konsantrasyon örneğin 2 nM için kitaplıklarına seyreltik (4 seçin nM, 2 nM, 1 nM veya 0.5 nM kitaplığına konsantrasyonları bağlı olarak). Bir havuz 2 nM kütüphanelerin elde etmek için tüm kitaplıkları havuz.</li>
	<li>Denatüre ve sıralama araç kılavuz aşağıdaki kütüphaneleri oranında seyreltin. Kısacası: 0.2 N NaOH ekleyerek 2 nM havuz tabiatını ve 5 dk. Dilute denatüre havuzun 10 de son bir seyreltme için oda sıcaklığında kuluçkaya. Denatüre ve 12: 17 son bir seyreltme için piyasada bulunan bir denetim kitaplığı oranında seyreltin. Yeni bir tüp 10 de havuzu % 20 12: 17 denetim kitaplığı ile karıştırın. Not: Bisülfit dönüşüm çok düşük karmaşıklık getirir. % 20 denetim kitaplığı spike-daha iyi sıralama kalitesinde neden olur.</li>
	<li>150 bp eşleştirilmiş uç sıralama derin sıralama aracı kullanarak çalıştırın.</li>
</ol>7. sayısal analiz - tahmin metilasyonu düzeyleri
<ol><li>.Fastq dosyaları (burada sample1_R1.fastq.gz ve sample1_R2.fastq.gz denir) oluşturmak, bismark dizini ilgi tüm genom kopyası oluştur (burada bismarkIndexadında bir klasör içinde) ve chrM genom dizisini fasta içinde kullanılabilir olduğundan emin olun biçimi (burada chrMadında bir klasör içinde).</li>
	<li>Okuma bağdaştırıcıları ve astar tarafından tanıtılan önyargı kaldırmak için ön işlemden: Trim_galore33aracını kullanın. İki nükleotid 5' sonundan ileriye ve geriye doğru okuma kaldırın. trim_galore--clip_R1 2 - clip_R2 2 -Ey. /--trim1--eşleştirilmiş sample1_R1.fastq.gz sample1_R2.fastq.gz</li>
	<li>Bismark34 kullanarak tüm genom önceden işlenmiş okuyan Hizala Bismark--kırlangıç--bam -ey. /. / bismarkIndex / -1 -2./sample1_R1_val_1.fq.gz./sample1_R2_val_2.fq.gz Not: başka bir aligner kullandıysanız, benzersiz olarak hizalanamaz okuma atılır emin olun.</li>
	<li>Özü kromozom M, burada Samtools35 kullanarak eşleme okur samtools -l 0 - O BAM -o sample1_sorted.bam sıralama sample1_R1_val_1_bismark_bt2_pe.bam samtools Dizin sample1_sorted.bam samtools göster -u sample1_sorted.bam chrM | samtools - n - O BAM -o sample1_chrM.bam sıralama</li>
	<li>Metilasyon bilgileri ayıklamak bismark_methylation_extractor -p--CX--cytosine_report--kapsamlı--genome_folder. / chrM./sample1_chrM.bam</li>
	<li>.bedgraph, .cov veya CX_report.txt dosyalar daha fazla çözümleme için kullanın. Sample1_chrM.CX_report.txt dosyasını, görselleştirme ve sınamak için kullanın.</li>
	<li>Birden çok bölge sorguya ve astar önyargı eşleme sırasında oluşturulan M-önyargı parsellerde görülebilir daha fazla önişleme adımda, kırpma gerçekleştirin. Daha fazla bilgi için Bismark belgelerine bakın.</li>
</ol>8. sayısal analiz - Test farklılıklar
<ol><li>CX_report.txt dosya için her C kromozom M üzerinde 7 sütunlar, kromozom (burada chrM), konumu, strand, metillenmiş okuma sayısı, bazlar okuma, C bağlam ve çevresindeki sıra, içerdiğinden emin olun.</li>
	<li>CX_report chrM tamamını kapsayan olarak güçlendirilmiş region(s) için alt küme küme kontrol edin.</li>
	<li>Parametrik olmayan testler örnekleri, bir balıkçılar'ın tam test bireysel C için veya bir bütün bölge için bir işareti test gibi arasındaki farklar için kullanın. Not: Miktar çoğu zaman neden normallik varsayarak uygun olmaması neden olduğu % 0 metilasyonu yakın olacaktır.</li>
	<li>Benzer şekilde, görselleştirme için quantil görselleştirmek veya binom oran güven aralıkları hesaplamak.</li>
</ol>

<ol>
	<li>Falkenberg, M., Larsson, N. -. G., Gustafsson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+replication+and+transcription+in+mammalian+mitochondria.">DNA replication and transcription in mammalian mitochondria.</a> Annu Rev Biochem. 76, 679-699 (2007).</li><li>Kolesar, J. E., Wang, C. Y., Taguchi, Y. V., Chou, S. -. H., Kaufman, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two-dimensional+intact+mitochondrial+DNA+agarose+electrophoresis+reveals+the+structural+complexity+of+the+mammalian+mitochondrial+genome.">Two-dimensional intact mitochondrial DNA agarose electrophoresis reveals the structural complexity of the mammalian mitochondrial genome.</a> Nucleic Acids Res. 41 (4), e58 (2013).</li><li>Mechta, M., Ingerslev, L. R., Fabre, O., Picard, M., Barres, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+Suggesting+Absence+of+Mitochondrial+DNA+Methylation.">Evidence Suggesting Absence of Mitochondrial DNA Methylation.</a> Front Genet. 8, 166 (2017).</li><li>Ehrlich, M., Gama-Sosa, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amount+and+distribution+of+5-methylcytosine+in+human+DNA+from+different+types+of+tissues+of+cells.">Amount and distribution of 5-methylcytosine in human DNA from different types of tissues of cells.</a> Nucleic Acids Res. 10 (8), 2709-2721 (1982).</li><li>Lister, R., Pelizzola, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+DNA+methylomes+at+base+resolution+show+widespread+epigenomic+differences.">Human DNA methylomes at base resolution show widespread epigenomic differences.</a> Nature. 462 (7271), 315-322 (2009).</li><li>Yan, J., Zierath, J. R., Barres, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+non-CpG+methylation+in+mammals.">Evidence for non-CpG methylation in mammals.</a> Exp Cell Res. 317 (18), 2555-2561 (2011).</li><li>Patil, V., Ward, R. L., Hesson, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evidence+for+functional+non-CpG+methylation+in+mammalian+cells.">The evidence for functional non-CpG methylation in mammalian cells.</a> Epigenetics. 9 (6), 823-828 (2014).</li><li>Nass, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+methylation+of+mitochondrial+and+nuclear+DNA+in+cultured+mouse,+hamser+and+virus+trasnforemd+hamser+cells+in+vivo+and+in+vitro+methylation.">Differential methylation of mitochondrial and nuclear DNA in cultured mouse, hamser and virus trasnforemd hamser cells in vivo and in vitro methylation.</a> J Mol Biol. 80 (1), 155-175 (1973).</li><li>Shock, L. S., Thakkar, P. V., Peterson, E. J., Moran, R. G., Taylor, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+methyltransferase+1,+cytosine+methylation,+and+cytosine+hydroxymethylation+in+mammalian+mitochondria.">DNA methyltransferase 1, cytosine methylation, and cytosine hydroxymethylation in mammalian mitochondria.</a> PNAS. 108 (9), 3630-3635 (2011).</li><li>Bellizzi, D., D'Aquila, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Control+Region+of+Mitochondrial+DNA+Shows+an+Unusual+CpG+and+Non-CpG+Methylation+Pattern.">The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern.</a> DNA Res. 20 (6), 537-547 (2013).</li><li>Jia, Y., Li, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+Low-Protein+Diet+Affects+Epigenetic+Regulation+of+Hepatic+Mitochondrial+DNA+Transcription+in+a+Sex-Specific+Manner+in+Newborn+Piglets+Associated+with+GR+Binding+to+Its+Promoter.">Maternal Low-Protein Diet Affects Epigenetic Regulation of Hepatic Mitochondrial DNA Transcription in a Sex-Specific Manner in Newborn Piglets Associated with GR Binding to Its Promoter.</a> PLoS ONE. 8 (5), e63855 (2013).</li><li>Jia, Y., Song, H., Gao, G., Cai, D., Yang, X., Zhao, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+Betaine+Supplementation+during+Gestation+Enhances+Expression+of+mtDNA-Encoded+Genes+through+D-Loop+DNA+Hypomethylation+in+the+Skeletal+Muscle+of+Newborn+Piglets.">Maternal Betaine Supplementation during Gestation Enhances Expression of mtDNA-Encoded Genes through D-Loop DNA Hypomethylation in the Skeletal Muscle of Newborn Piglets.</a> J Agric Food Chem. 63 (46), 10152-10160 (2015).</li><li>Infantino, V., Castegna, A., Iacobazzi, F., Spera, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impairment+of+methyl+cycle+affects+mitochondrial+methyl+availability+and+glutathione+level+in+Down's+syndrome.">Impairment of methyl cycle affects mitochondrial methyl availability and glutathione level in Down's syndrome.</a> Mol Genet Metab. 102 (3), 378-382 (2011).</li><li>Chen, H., Dzitoyeva, S., Manev, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+valproic+acid+on+mitochondrial+epigenetics.">Effect of valproic acid on mitochondrial epigenetics.</a> Eur J Pharmacol. 690 (1-3), 51-59 (2012).</li><li>Dzitoyeva, S., Chen, H., Manev, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+aging+on+5-hydroxymethylcytosine+in+brain+mitochondria.">Effect of aging on 5-hydroxymethylcytosine in brain mitochondria.</a> Neurobiol Aging. 33 (12), 2881-2891 (2012).</li><li>Menga, A., Palmieri, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SLC25A26+overexpression+impairs+cell+function+via+mtDNA+hypermethylation+and+rewiring+of+methyl+metabolism.">SLC25A26 overexpression impairs cell function via mtDNA hypermethylation and rewiring of methyl metabolism.</a> FEBS J. 284 (6), 967-984 (2017).</li><li>Frommer, M., McDonald, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genomic+sequencing+protocol+that+yields+a+positive+display+of+5-methylcytosine+residues+in+individual+DNA+strands.">A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands.</a> PNAS. 89 (5), 1827-1831 (1992).</li><li>Byun, H. -. M., Panni, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+airborne+pollutants+on+mitochondrial+DNA+Methylation.">Effects of airborne pollutants on mitochondrial DNA Methylation.</a> Part Fibre Toxicol. 10 (1), 1 (2013).</li><li>Janssen, B. G., Byun, H. -. M., Gyselaers, W., Lefebvre, W., Baccarelli, A. A., Nawrot, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Placental+mitochondrial+methylation+and+exposure+to+airborne+particulate+matter+in+the+early+life+environment:+An+ENVIRONAGE+birth+cohort+study.">Placental mitochondrial methylation and exposure to airborne particulate matter in the early life environment: An ENVIRONAGE birth cohort study.</a> Epigenetics. 10 (6), 536-544 (2015).</li><li>Zheng, L. D., Linarelli, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin+resistance+is+associated+with+epigenetic+and+genetic+regulation+of+mitochondrial+DNA+in+obese+humans.">Insulin resistance is associated with epigenetic and genetic regulation of mitochondrial DNA in obese humans.</a> Clin Epigenetics. 7 (1), 1739 (2015).</li><li>Byun, H. -. M., Colicino, E., Trevisi, L., Fan, T., Christiani, D. C., Baccarelli, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+Air+Pollution+and+Blood+Mitochondrial+DNA+Methylation+on+Markers+of+Heart+Rate+Variability.">Effects of Air Pollution and Blood Mitochondrial DNA Methylation on Markers of Heart Rate Variability.</a> J Am Heart Assoc. 5 (4), (2016).</li><li>Bianchessi, V., Vinci, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrion.">Mitochondrion.</a> MITOCH. 27 (C), 40-47 (2016).</li><li>Wijst, M. G. P., van Tilburg, A. Y., Ruiters, M. H. J., Rots, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+mitochondria-targeted+DNA+methylation+identifies+GpC+methylation,+not+CpG+methylation,+as+potential+regulator+of+mitochondrial+gene+expression.">Experimental mitochondria-targeted DNA methylation identifies GpC methylation, not CpG methylation, as potential regulator of mitochondrial gene expression.</a> Sci Rep. 7 (1), 177 (2017).</li><li>Wong, M., Gertz, B., Chestnut, B. A., Martin, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNMT3A+and+DNA+methylation+in+skeletal+muscle+and+CNS+of+transgenic+mouse+models+of+ALS.">Mitochondrial DNMT3A and DNA methylation in skeletal muscle and CNS of transgenic mouse models of ALS.</a> Front cellr Neurosci. 7, 279 (2013).</li><li>Dawid, I. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=5-methylcytidylic+acid:+absence+from+mitochondrial+DNA+of+frogs+and+HeLa+cells.">5-methylcytidylic acid: absence from mitochondrial DNA of frogs and HeLa cells.</a> Science. 184 (4132), 80-81 (1974).</li><li>Gama-Sosa, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Levels and distribution of 5-methylcytosine in Chordate DNA. , 1-201 (1985).</li><li>Hong, E. E., Okitsu, C. Y., Smith, A. D., Hsieh, C. -. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regionally+specific+and+genome-wide+analyses+conclusively+demonstrate+the+absence+of+CpG+methylation+in+human+mitochondrial+DNA.">Regionally specific and genome-wide analyses conclusively demonstrate the absence of CpG methylation in human mitochondrial DNA.</a> Mol Cell Biol. 33 (14), 2683-2690 (2013).</li><li>Liu, B., Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CpG+methylation+patterns+ofhuman+mitochondrial+DNA.">CpG methylation patterns ofhuman mitochondrial DNA.</a> Nature Publishing Group. , 1-10 (2016).</li><li>Donkin, I., Versteyhe, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obesity+and+Bariatric+Surgery+Drive+Epigenetic+Variation+of+Spermatozoa+in+Humans.">Obesity and Bariatric Surgery Drive Epigenetic Variation of Spermatozoa in Humans.</a> Cell Metab. 23 (2), 369-378 (2016).</li><li>Li, L. C., Dahiya, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MethPrimer:+designing+primers+for+methylation+PCRs.">MethPrimer: designing primers for methylation PCRs.</a> Bioinformatics. 18 (11), 1427-1431 (2002).</li><li>Tusn&#225;dy, G. E., Simon, I., V&#225;radi, A., Ar&#225;nyi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BiSearch:+primer-design+and+search+tool+for+PCR+on+bisulfite-treated+genomes.">BiSearch: primer-design and search tool for PCR on bisulfite-treated genomes.</a> Nucleic Acids Res. 33 (1), e9 (2005).</li><li>Ar&#225;nyi, T., V&#225;radi, A., Simon, I., Tusn&#225;dy, G. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BiSearch+web+server.">The BiSearch web server.</a> BMC bioinformatics. 7, 431 (2006).</li><li>Krueger, F., Andrews, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bismark:+a+flexible+aligner+and+methylation+caller+for+Bisulfite-Seq+applications.">Bismark: a flexible aligner and methylation caller for Bisulfite-Seq applications.</a> Bioinformatics. 27 (11), 1571-1572 (2011).</li><li>Li, H., Handsaker, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Ramos, A., Barbena, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+insertions+of+mitochondrial+origin:+Database+updating+and+usefulness+in+cancer+studies.">Nuclear insertions of mitochondrial origin: Database updating and usefulness in cancer studies.</a> Mitochondrion. 11 (6), 946-953 (2011).</li><li>Warnecke, P. M., Stirzaker, C., Song, J., Grunau, C., Melki, J. R., Clark, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+resolution+of+artifacts+in+bisulfite+sequencing.">Identification and resolution of artifacts in bisulfite sequencing.</a> Methods (San Diego, Calif). 27 (2), 101-107 (2002).</li></ol>

Yazarlar bildirmek için rakip hiçbir mali ilgi alanlarına sahip.

Burada, biz mtDNA metilasyonu sorguya çekmek için özel olarak tasarlanmış bir bisülfit-sıralama iletişim kuralı sağlar. Genomik DNA örneği almak için kullanılan bisülfit-sıralama iletişim kuralları ile farklılıklar bir önceki Restriksiyon enzimi sindirim adım ve bioinformatic analiz kullanımı dışarı yanlış pozitif NUMT dizileri kaynaklanan iktidar yatıyor.
MtDNA metilasyonu soruşturma bisülfit-sıralama yapıları önlemek için bir protokol sağlar. Yanlış-mutlak için önde gelen bisülfit sıralama eserler daha önce raporlanmış37idi. DNA aksesuar proteinler İndinavir K olmuştur tarafından yetersiz kaldırılması37nitelendirdi. Eksik denatürasyon veya kısmi reannealing eksik dönüşüm, menziller için muhtemelen bisülfit tek iplikçikli DNA37, erişim düşürerek yol açabilir. Daha sonra yapının nerede bir ikincil yapı cytosines erişim zarar mtDNA oyunda olabilir. Bizim bilgi en iyi şekilde, Restriksiyon enzimi sindirim adım mtDNA metilasyonu tahmin etme, içeriğinde bisülfit dönüştürmeden önce eklenmesi ilk 20163,28yılında bildirilmiştir. Elimizde çok, bir tek-kesici Restriksiyon enzimi ile önceki sindirim önemli ölçüde Dönüştürülmeyen cytosines3,28tespiti indirdi.
Burada, bir bioinformatic boru hattı bisülfit sıralama sonuçları analiz etmek ve bütün mitokondrial genom bisülfit sıralama Bağlamında bisülfit sıralama yapıları algılamak için sağlamak. Bu yöntem bizim gözlem bu mtDNA kaynaklı olmayan dönüşüm oranı ters derinliği3,28sıralama ile ilişkili. Bu gözlem mtDNA ikincil ve hatta üçüncül yapısı mtDNA özel bölgeler, parçalanma sıralama kitaplıkları inşaatı sırasında bozar ve ayrıca Sodyum bisülfit mtDNA için tam erişim zarar göstermektedir. Sindirim bir kesici enzim ile ikincil ve üçüncül yapıları bültenleri beri bizim sonuçları mtDNA yapısı bisülfit artifakı kaynağıdır ve sitozin metilasyonu mtDNA içinde miktar için burada açıklanan yöntemleri doğrulamak gösterir.
Nükleer DNA Mitokondrial hazırlık kaçınılmaz kirlenme bir meydan okuma kabul ettiğiniz anlamına gelir. Bu bile performans hedef bağlandığınızda mtDNA, sitozin metilasyonu tahmini önyargı sıralama okuma içinde NUMT dizileri kirlenme ve bütün mitokondrial genom bisülfit sıralama yol açar. Böyle önyargı önlemek için NUMTs adlı metilasyonu ile kirlenme dışlamak için benzersiz bisülfit sıralama astar tasarımı sağlar. Belirli bölgeler insan ve fare mitokondrial genom % 100 kimlik ile NUMTs yayılan ve bu, bu nedenle, belirli mtDNA bölgelerde, benzersiz astar tasarım mümkün değildir. Bütün mitokondrial genom bisülfit sıralama, uzun sıralama işlemi sırasında okuma mtDNA ve NUMTs arasında ayrımcılık dindirebilirim. Benzersiz olarak mitokondriyal genom eşlenen okuma daha da fazla tüm genom ve tek kullanım kaydırılmasını okuma algılama mtDNA metilasyon olun.
Son olarak, bu protokol mitokondrial genom Örneğin, burada DNA'ın ikincil yapısı yapı potansiyel bir kaynak gösterir bisülfit sıralama diğer durumlarda kullanılabilir. Derneğin metilasyon düzeyleri ile sıralama derinlik bisülfit sıralama öncesinde Restriksiyon enzimi ile sindirim karmaşık DNA dizilerinin ihtiyacını değerlendirmek için soruşturma olması.

Mitokondrial genom yaklaşık 16,5-kilo Bankası (kb) dairesel, Çift iplikçikli yapısını uzun, bir ağır ve hafif bir tel adıyla aynıdır. Mitokondrial genom her hücresi olarak maternally-miras, birden çok kopya mevcut ve solunum zinciri kompleksleri1temel bileşenlerine kodlar. Benzer bakteriyel genom ve nükleer genom aksine, mitokondriyal genom sayısız ikincil ve üçüncül yapılarını gibi sarmal ve supercoiled yapıları2erişim sırasında sıralama zor hale getirebilir, düzenlenmiştir deneyler3.
Çekirdeğinde, DNA metilasyonu Gen ifadesinin düzenlenmesinde başta olmak üzere çok sayıda süreçlerde bir rol oynayan bir kapsamlı okudu epigenetik işaretidir. Memeli genleri içinde DNA metilasyonu öncelikle deoxycytidines, CG dinucleotides (ya da KSY) üzerinde çoğunlukla pirimidin halka 5 konumunu oluşuyor. Sitozin metilasyonu tüm CpG % 70'i somatik hücreler ve hesapları için toplam % ~ 1 genomu DNA4üsleri bulunur. DNA methylations da EBM, CpT ve TBM gibi sigara CpG bağlamlarda tarif edilmiştir ve embriyonik kök hücre5,6,7tüm metillenmiş cytosines % 25'e kadar değerler ile nükleer DNA çeşitli miktarlarda bulunmaktadır.
Sitozin metilasyonu nükleer genom kopyası yaygın olarak kabul ederken, mitokondriyal DNA (mtDNA) metilasyonu varlığını hala tartışmalıdır. İlk çalışma araştıran mtDNA metilasyonu nerede mtDNA metilasyonu kolayca tespit edildi, kültürlü hücrelerde nükleer DNA8' e göre daha alt düzeylerde rağmen gerçekleştirildi. İnsan ve fare hücrelerinde mtDNA metilasyonu de düşük düzeyde (% 2-5) tespit edilmiştir. 5 metilsitozin yakalama tarafından kantitatif PCR takip metillenmiş DNA immunoprecipitation (MeDIP) gibi güvenerek deneyleri kullanarak, mtDNA metilasyonu ayrıca çeşitli fare ve insan algılandı ve çizgiler9,10, hücre 11,12. 5-metilsitozin ELISA tahlil veya kütle spektrometresi karşı antikor kullanarak, DNA metilasyonu önemli düzeyde saf mitokondriyal kesirler13,14,15, tespit edildi 16. ancak, yukarıda belirtilen çalışmalar deneyleri tek Bankası çözünürlükte DNA metilasyon mutlak miktar sağlamak için tasarlanmamıştır teknikleri kullanılır.
Nicel ve resolutive DNA metilasyonu Analizi urasil tek iplikçikli DNA bağlam17 bazlar sitozin dönüştürmek için Sodyum bisülfit mülkiyeti yararlanır "bisülfit sıralama", adlı bir teknik elde edilebilir . Bisülfit sıralama kullanarak, bir takımyıldızı yönünde çalışmaların sitozin metilasyonu çeşitli düzeylerde varlığı tespit etti. D-loop bölgesi, 12'leri veya 16S bölge metilasyonu mtDNA kolayca insan18,19,20,21,22,23 ve fare24 ' te algılandı doku ve hücreler, ancak, ilginç bir değişkenliği çalışmalar genelinde toplam cytosines % 1-20'si ile.
Bu çok sayıda çalışmalar ile karşılaştırıldığında sadece birkaç çalışmalar bizim gruptan da dahil olmak üzere, mtDNA metilasyonu3,25,26,27 varlığı tartışmalı veya biyolojik alaka sorguladı mtDNA düzeyleri (% 2) aşağıda28çok az düzeyde. Son zamanlarda, biz bütün mitokondrial bisülfit sıralama3potansiyel bir bisülfit-sıralama artifakı gözlenmesi bildirdi. Biz böylece metilasyonu düzeyleri overestimating mitokondrial DNA'ın ikincil yapısı bisülfit sıralama, yanlış pozitif neden olabilir kanıt sağladı. Biz burada bir obje bisülfit-dönüşüm mtDNA önlemek için bir protokol sağlar. Bu iletişim kuralı bir basit enzimatik sindirim DNA'ın mtDNA ikincil yapılar bozmaya ve bisülfit sıralama protokol sonrası bisülfit tam erişime izin kullanır. Buna ek olarak, biz bisülfit sıralama analizi için bir eşlik eden bioinformatic boru hattı sağlar.

<table border="0" cellpadding="0" cellspacing="0" width="648">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:283px;">BamHI</td>
			<td style="width:164px;">New England BioLabs</td>
			<td style="width:113px;"># R0136</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EZ DNA methylation-lightning kit</td>
			<td>Zymo Research</td>
			<td># D5030&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Qubit ssDNA assay</td>
			<td>Thermo Fisher Scientific</td>
			<td># Q10212</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Qubit assay tubes</td>
			<td>Thermo Fisher Scientific</td>
			<td># Q32856</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HotStarTaq plus DNA polymerase kit</td>
			<td>Qiagen</td>
			<td># 203603&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAquick Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td># 28704</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NEBNext Ultra DNA Library Kit for Illumina</td>
			<td>New England BioLabs</td>
			<td># E7370S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NEBNext Multiplex Oligoes for Illumina</td>
			<td>New England BioLabs</td>
			<td># E7335S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">AMPure XP Beads</td>
			<td>Beckman Coulter</td>
			<td># A63881</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">High Sensitivity DNA chip</td>
			<td>Agilent</td>
			<td># 5067-4626</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Qubit high sensitivity dsDNA assay</td>
			<td>Thermo Fisher Scientific</td>
			<td># Q33230</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MiSeq reagent kit v2 300 cycles</td>
			<td>Illumina</td>
			<td># MS-102-2003</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PhiX control v3</td>
			<td>Illumina</td>
			<td># FC-110-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium hydroxide&#160;</td>
			<td>Sigma</td>
			<td># S5881</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Thermal cycler C1000</td>
			<td>Biorad</td>
			<td># 1851148</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CFX96 Real-Time PCR detection system</td>
			<td>Biorad&#160;</td>
			<td>#1855195</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Qubit Fluorometer</td>
			<td>Thermo Fisher Scientific</td>
			<td># Q33226</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Bioanalyzer 2100</td>
			<td>Agilent</td>
			<td># G2939BA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MiSeq instrument</td>
			<td>Illumina</td>
			<td># SY-410-1003</td>
			<td></td>
		</tr>
	</tbody>
</table>

methodology for accurate detection of mitochondrial dna methylation

Miktar DNA metilasyon kullanan glikozilasyonu sonunda, bir tek iplikçikli DNA bağlamda bazlar sitozin dönüştürmek için Sodyum bisülfit mülkiyeti yararlanır bisülfit sıralama elde edilebilir. Bisülfit sıralama olabilir (PCR kullanarak) hedef veya tüm genom üzerinde gerçekleştirilen ve sitozin metilasyonu tek Bankası çözünürlükte mutlak miktar sağlar. Nükleer ve mitokondrial DNA, farklı doğası özellikle ikincil yapısında göz önüne alındığında, adaptasyonlar bisülfit sıralama yöntemleri için mtDNA sitozin metilasyonu soruşturma yapılması gerekir. MtDNA ikincil ve üçüncül yapısı gerçekten yanlış-mutlak bisülfit tek iplikçikli DNA'için tamamlanmamış denatürasyon zavallı erişim nedeniyle önde gelen eserler sıralama bisülfit yol açabilir. Burada, DNA'ın bir enzimatik sindirim BamHI bioinformatic analiz boru hattı ile birleştiğinde ile doğru miktar sitozin metilasyonu seviyelerinde mtDNA izin vermek için bir iletişim kuralı'nı açıklar. Buna ek olarak, biz yönergeleri bisülfit sıralama astar için mtDNA belirli tasarlamak için istenmeyen nükleer mitokondrial bölümlerini hedeflemek önlemek için (NUMTs) nükleer genom eklenmiş.

Bu protokol iki adımda mtDNA metilasyonu soruşturma zaman önemlidir. 1) 2) mitokondriyal DNA özgü astar tasarım ve ikincil yapı açılmasına.
İnsan genomik DNA Restriksiyon enzimi BamHI (Şekil 1) ile sindirerek, mitokondriyal DNA yapısı nükleotit konumda 14,258 kesilir ve ikincil yapı açılacak.
Bisülfit dönüşüm bir bozulmamış mtDNA ikincil yapı ile olası bozulma mtDNA unconversion oranı abartma muhtemeldir. Bisülfit sıralama tarafından mtDNA unconversion oranı araştırıldı, sindirilmemiş ve toplam DNA Mitokondrial genom 5 farklı bölgelerinde, insan iskelet kas hücrelerinden sindirmek: deplasman döngü (D-Loop), tRNA Fenilalanin ve 12'leri ribozom (tRNA - F + 12'leri), 16S ribozom (16S), NADH dehidrogenaz 5 (ND5) ve sitokrom b (CYTB) mRNA kodlama gen (Şekil 2). Unconversion oranı 0'dan - değişiyordu %15,1 karşıdan karşıya tüm incelenen bölge sindirilmemiş mtDNA için. DNA bisülfit dönüşüm önce sindirilmiş, ancak, unconversion oranı en fazla % 1'için tüm bölgeler (Şekil 3) arasında düştü. Böylece, BamHI sindirim tahmindi mtDNA metilasyon düzeyi önlemek için bisülfit dönüştürmeden önce önemini gösteren.
Kirlenme nükleer DNA Mitokondrial genom yalıtma zaman kaçınılmazdır ve neredeyse tüm mitokondrial genom nükleer genom çoğaltıldıktan sonra bu nükleer olarak adlandırdığı mitokondrial genom nükleer eklemeleri için rise verdi Mitokondrial kesimleri (NUMTs)36. Analiz DNA metilasyonu düzeyleri mitokondrial DNA ve değil NUMTs karşılık gelen emin olmak için mitokondriyal genom özgü astar tasarlamak için en dıştaki önem taşıyor. Şekil 4 astar özgüllük ve Tablo 1 görüntüler insan ve fare mtDNA astar dizileri kontrol etmek için nasıl gösterir.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Adı</td>
			<td colspan="3">Sıra</td>
			<td>Pozisyon</td>
			<td>Amplicon boyutu</td>
			<td>Tavlama sıcaklığı</td>
			<td>Strand</td>
		</tr>
<tr>
<td>İnsan</td>
			<td colspan="3"></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>D-Loop</td>
			<td colspan="3">F: AAATCTATCACCCTATTAAC</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: GTGGAAATTTTTTGTTATGATGT</td>
			<td>6-298</td>
			<td>292</td>
			<td>55° C</td>
			<td>Antisens</td>
		</tr>
<tr>
<td>D-Loop</td>
			<td colspan="3">F: CATAACAAAAAATTTCCACCAAAC</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: GGGAAAATAATGTGTTAGTT</td>
			<td>279-458</td>
			<td>179</td>
			<td>55° C</td>
			<td>Antisens</td>
		</tr>
<tr>
<td>12'LERİ + TF</td>
			<td colspan="3">F: TTTATATAACTTACCTCCTC</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: GTGTTTGATGTTTGTTTTTTTTG</td>
			<td>577-765</td>
			<td>188</td>
			<td>55° C</td>
			<td>Antisens</td>
		</tr>
<tr>
<td>466</td>
			<td colspan="3">F: AATAAATTTATAGGTTTTTAAATTATTAAAT</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: TAACTAATAAAATCTTAACATATACTACTC</td>
			<td>2763-2873</td>
			<td>110</td>
			<td>53° C</td>
			<td>Anlamda</td>
		</tr>
<tr>
<td>CYTB</td>
			<td colspan="3">F: GGTATTATTTTTTTGTTTGTAATTATAGTA</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: CCTCAAATTCATTAAACTAAATCTATCC</td>
			<td>15091-15243</td>
			<td>152</td>
			<td>55° C</td>
			<td>Anlamda</td>
		</tr>
<tr>
<td>Fare</td>
			<td colspan="3"></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>12'LERİ</td>
			<td colspan="3">F: ACACATACAAACCTCCATAAAC</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: GAGGTATAATTTAGTTAAAT</td>
			<td>111-287</td>
			<td>176</td>
			<td>53° C</td>
			<td>Antisens</td>
		</tr>
<tr>
<td>466</td>
			<td colspan="3">F: AAATTCCAATTCTCCAAACATAC</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: TTTGGATTTTTTTTTTAGGT</td>
			<td>1749-1896</td>
			<td>147</td>
			<td>53° C</td>
			<td>Antisens</td>
		</tr>
<tr>
<td>CYTB</td>
			<td colspan="3">F: CTACAAAAACACCTAATAACAAAC</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: AGTGTATGGTTAAGAAAAGA</td>
			<td>14129 14307</td>
			<td>178</td>
			<td>55° C</td>
			<td>Antisens</td>
		</tr>
<tr>
<td>466</td>
			<td colspan="3">F: AGAGAAATAGAGTTATTTTATAAATAAG</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: CTAAAAACAAAATTTTAAATCTTAC</td>
			<td>2576-2727</td>
			<td>151</td>
			<td>55° C</td>
			<td>Anlamda</td>
		</tr>
<tr>
<td>ND5</td>
			<td colspan="3">F: TTAAGTTAATTAGGTTTGATAATAGTGA</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: TAAAACCCTATTAAAAATAATATTCCTATA</td>
			<td>12659-12910</td>
			<td>251</td>
			<td>55° C</td>
			<td>Anlamda</td>
		</tr>
<tr>
<td>CYTB</td>
			<td colspan="3">F: TGGGTTTTTTTTAGGAGTTTGTTTA</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td colspan="3">BİLGİ: CAATAAAAATACTCCAATATTTCAAATTTC</td>
			<td>14242-14504</td>
			<td>262</td>
			<td>55° C</td>
			<td>Anlamda</td>
		</tr>
</tbody></table>Tablo 1: astar dizileri için insan ve fare mtDNA. PCR sıcaklıklarında tavlama astar astar erime sıcaklık farklılıkları nedeniyle değişiklik unutmayın.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57772/57772fig1.jpg"> Resim 1 : Jel Elektroforez BamHI sindirilmiş veya sindirilmemiş DNA'ın. İnsan iskelet kas genomik DNA tedavi edilmediği veya 4 h 37 ° C için BamHI ile tedavi ve jel elektroforez % 1.5 özel jel üzerinde çalıştırıldı. <a href="/files/ftp_upload/57772/57772fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57772/57772fig2.jpg"> Resim 2 : İnsan mitokondriyal genom haritası. Bisülfit sıralama ve BamHI Restriksiyon enzimi site tarafından araştırıldı mitokondri genom kopyası bölgeleri görüntülenir. Mitokondrial DNA 13 mRNA'ların, 2 ribozomal RNA ve 22 transfer RNA'lar içerir. Kısaltmalar: PH1: ağır iplikçikli organizatörü 1; PH2: ağır iplikçikli teşvik 2; PL: ışık-strand organizatörü; OH: Kökeni ağır iplikçikli çoğaltmada; EyL: ışık-strand çoğaltmada kökeni. <a href="/files/ftp_upload/57772/57772fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57772/57772fig3v2.jpg"> Şekil 3 : BamHI sindirim bisülfit dönüştürmeden önce insan iskelet kas hücreleri mtDNA unconversion ücretine azaltır. Sindirilmemiş ve sindirilmiş mitokondrial DNA unconversion yüzde bisülfit sıralama tarafından sorguya, beş farklı bölgeleri insan iskelet kas hücrelerindeki mitokondri genom kopyası (N= 3). Tam kare CpG siteleri ve açık Meydanı CpG olmayan siteleri temsil eder. Sonuçlar en az en fazla aralığı ile sunulur ve bir işareti test önemli unconversion farklar için test etmek için kullanılmıştır. D-Loop (6-298) P1.83E =-42; D-Loop (279-458): P4.55E =-13; tRNA - F + 12'leri: P8.38E =-16; 16s: P5.91E =-06; ND5: P1.70E =-05; CYTB: P2.69E =-10. D-Loop (6-298) çoğaltma kaynağı içerir ve ağır strand organizatörü 2 tRNA - F + 12'leri içerir. Bu veriler olmuştur başka bir yerde 3yayınlandı. <a href="/files/ftp_upload/57772/57772fig3v2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57772/57772fig4.jpg"> Şekil 4 : Bisearch astar özgüllük mitokondrial genom doğru doğrulamak için kullanımı. A) bisülfit dönüştürülmüş astar dizileri BiSearch işlevine astar arama (http://bisearch.enzim.hu/?m=genompsearch) eklenir. Bisülfit kutusunu işaretli ve başvuru genom seçilir. B) anlam ve antisens zincirleri üzerinde oluşturulan potansiyel PCR ürünleri örneği. <a href="/files/ftp_upload/57772/57772fig4large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>

Watch this Scientific Journal Video about Methodology for Accurate Detection of Mitochondrial DNA Methylation at JoVE.com

Methodology for Accurate Detection of Mitochondrial DNA Methylation

Burada, mitokondriyal DNA (mtDNA) metilasyon doğru miktar bir iletişim kuralını mevcut. Bu protokol için bir enzimatik sindirim DNA BamHI tahmindi mtDNA metilasyon düzeyi mtDNA ikincil yapı tarafından neden önlemek için kullanılan bioinformatic analiz boru hattı ile birleştiğinde ile açıklanmaktadır.

Mitokondrial DNA metilasyonu doğru algılanması için metodoloji

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert ...

methodology-for-accurate-detection-of-mitochondrial-dna-methylation

Nanyang Technological University

Research

JoVE Journal

Genetics

13.2K Görüntüleme.  University of Copenhagen. Burada, mitokondriyal DNA (mtDNA) metilasyon doğru miktar bir iletişim kuralını mevcut. Bu protokol için bir enzimatik sindirim DNA BamHI tahmindi mtDNA metilasyon düzeyi mtDNA ikincil yapı tarafından neden önlemek için kullanılan bioinformatic analiz boru hattı ile birleştiğinde ile açıklanmaktadır.

Video: Methodology for Accurate Detection of Mitochondrial DNA Methylation

Methyl-binding DNA capture Sequencing for Patient Tissues

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable development and differentiation of different tissue types. Dysregulation of this process is often the hallmark of various diseases like cancer. Here, we outline one of the recent sequencing techniques, Methyl-Binding DNA Capture sequencing (MBDCap-seq), used to quantify methylation in various normal and disease tissues for large patient cohorts. We describe a detailed protocol of this affinity enrichment approach along with a bioinformatics pipeline to achieve optimal quantification. This technique has been used to sequence hundreds of patients across various cancer types as a part of the 1,000 methylome project (Cancer Methylome System).

Here we present a protocol to investigate genome wide DNA methylation in large scale clinical patient screening studies using the Methyl-Binding DNA Capture sequencing (MBDCap-seq or MBD-seq) technology and the subsequent bioinformatics analysis pipeline.

Hasta Dokularda metil-bağlayıcı DNA yakalama Dizi

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable ...

Genetik

Novel RNA-Binding Proteins Isolation by the RaPID Methodology

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern biology. Only a few in vitro and in vivo methods enable the identification of RBPs associated with a particular target mRNA. However, their main limitations are the identification of RBPs in a non-cellular environment (in vitro) or the low efficiency isolation of RNA of interest (in vivo). An RNA-binding protein purification and identification (RaPID) methodology was designed to overcome these limitations in yeast and enable efficient isolation of proteins that are associated in vivo. To achieve this, the RNA of interest is tagged with MS2 loops, and co-expressed with a fusion protein of an MS2-binding protein and a streptavidin-binding protein (SBP). Cells are then subjected to crosslinking and lysed, and complexes are isolated through streptavidin beads. The proteins that co-purify with the tagged RNA can then be determined by mass spectrometry. We recently used this protocol to identify novel proteins associated with the ER-associated PMP1 mRNA. Here, we provide a detailed protocol of RaPID, and discuss some of its limitations and advantages.

RNA-protein interactions lie at the heart of many cellular processes. Here, we describe an in vivo method to isolate specific RNA and identify novel proteins that are associated with it. This could shed new light on how RNAs are regulated in the cell.

Rapid Metodoloji tarafından Roman RNA Bağlayıcı Proteinler İzolasyon

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern ...

In Situ Labeling of Mitochondrial DNA Replication in Drosophila Adult Ovaries by EdU Staining

The mitochondrial genome is inherited exclusively through the maternal line. Understanding of how the mitochondrion and its genome are proliferated and transmitted from one generation to the next through the female oocyte is of fundamental importance. Because of the genetic tractability, and the elegant, ordered simplicity by which oocyte development proceeds, Drosophila oogenesis has become an invaluable system for mitochondrial study. An EdU (5-ethynyl-2&#180;-deoxyuridine) labeling method was utilized to detect mitochondrial DNA (mtDNA) replication in Drosophila ovaries. This method is superior to the BrdU (5-bromo-2'-deoxyuridine) labeling method in that it allows for good structural preservation and efficient fluorescent dye penetration of whole-mount tissues.
Here we describe a detailed protocol for labeling replicating mitochondrial DNA in Drosophila adult ovaries with EdU. Some technical solutions are offered to improve the viability of the ovaries, maintain their health during preparation, and ensure high-quality imaging. Visualization of newly synthesized mtDNA in the ovaries not only reveals the striking temporal and spatial pattern of mtDNA replication through oogenesis, but also allows for simple quantification of mtDNA replication under various genetic and pharmacological perturbations.

In Situ Labeling of Mitochondrial DNA Replication in Drosophila Adult Ovaries by EdU Staining

Drosophila oogenesis continues to be exceptionally useful in the study of mitochondrial proliferation and inheritance. This manuscript describes a detailed protocol used to label the replicating mitochondrial DNA (mtDNA) in Drosophila adult ovaries with 5-ethynyl-2&#180;-deoxyuridine (EdU), which facilitates uncovering mechanisms associated with mitochondrial inheritance that were previously debatable.

Edu Boyama tarafından Drosophila Yetişkin Yumurtalıkların Mitokondriyal DNA replikasyonu Yerinde Etiketlenmesi içinde

The mitochondrial genome is inherited exclusively through the maternal line. Understanding of how the mitochondrion and its genome are proliferated and ...

Detection of Copy Number Alterations Using Single Cell Sequencing

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and microbial populations. Traditional methods for assessing genetic heterogeneity have been limited by low resolution, low sensitivity, and/or low specificity. Single cell sequencing has emerged as a powerful tool for detecting genetic heterogeneity with high resolution, high sensitivity and, when appropriately analyzed, high specificity. Here we provide a protocol for the isolation, whole genome amplification, sequencing, and analysis of single cells. Our approach allows for the reliable identification of megabase-scale copy number variants in single cells. However, aspects of this protocol can also be applied to investigate other types of genetic alterations in single cells.

Single cell sequencing is an increasingly popular and accessible tool for addressing genomic changes at high resolution. We provide a protocol that uses single cell sequencing to identify copy number alterations in single cells.

Tek Hücre sıralama kullanarak Kopya sayısı Değişmeler Algılama

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Comprehensive DNA Methylation Analysis Using a Methyl-CpG-binding Domain Capture-based Method in Chronic Lymphocytic Leukemia Patients

The role of long noncoding RNAs (lncRNAs) in cancer is coming to the forefront due to growing interest in understanding their mechanistic functions during cancer development and progression. Despite this, the global epigenetic regulation of lncRNAs and repetitive sequences in cancer has not been well investigated, particularly in chronic lymphocytic leukemia (CLL). This study focuses on a unique approach: the immunoprecipitation-based capture of double-stranded, methylated DNA fragments using methyl-binding domain (MBD) proteins, followed by next-generation sequencing (MBD-seq). CLL patient samples belonging to two prognostic subgroups (5 IGVH mutated samples + 5 IGVH unmutated samples) were used in this study. Analysis revealed 5,800 hypermethylated and 12,570 hypomethylated CLL-specific differentially methylated genes (cllDMGs) compared to normal healthy controls. Importantly, these results identified several CLL-specific, differentially methylated lncRNAs, repetitive elements, and protein-coding genes with potential prognostic value. This work outlines a detailed protocol for an MBD-seq and bioinformatics pipeline developed for the comprehensive analysis of global methylation profiles in highly CpG-rich regions using CLL patient samples. Finally, a protein-coding gene and an lncRNA were validated using pyrosequencing, which is a highly quantitative method to analyze CpG methylation levels to further corroborate the findings from the MBD-seq protocol.

This work describes an optimized methyl-CpG-binding domain (MBD) sequencing protocol and a computational pipeline to identify differentially methylated CpG-rich regions in chronic lymphocytic leukemia (CLL) patients.

Kronik Lenfositik Lösemi Hastalarında Metil-CpG-Bağlayıcı Alan Yakalamaya Dayalı Bir Yöntem Kullanarak Kapsamlı DNA Metilasyon Analizi

The role of long noncoding RNAs (lncRNAs) in cancer is coming to the forefront due to growing interest in understanding their mechanistic functions during ...

Protocols for C-Brick DNA Standard Assembly Using Cpf1

CRISPR-associated protein Cpf1 cleaves double-stranded DNA under the guidance of CRISPR RNA (crRNA), generating sticky ends. Because of this characteristic, Cpf1 has been used for the establishment of a DNA assembly standard called C-Brick, which has the advantage of long recognition sites and short scars. On a standard C-Brick vector, there are four Cpf1 recognition sites &#8211; the prefix (T1 and T2 sites) and the suffix (T3 and T4 sites) &#8211; flanking biological DNA parts. The cleavage of T2 and T3 sites produces complementary sticky ends, which allow for the assembly of DNA parts with T2 and T3 sites. Meanwhile, a short &#34;GGATCC&#34; scar is generated between parts after assembly. As the newly formed plasmid once again contains the four Cpf1 cleavage sites, the method allows for the iterative assembly of DNA parts, which is similar to those of BioBrick and BglBrick standards. A procedure outlining the use of the C-Brick standard to assemble DNA parts is described here. The C-Brick standard can be widely used by scientists, graduate and undergraduate students, and even amateurs.

CRISPR-associated protein Cpf1 can be guided by a specially designed CRISPR RNA (crRNA) to cleave double-stranded DNA at desired sites, generating sticky ends. Based on this characteristic, a DNA assembly standard (C-Brick) was established, and a protocol detailing its use is described here.

Cpf1&#39;i Kullanarak C-Brick DNA Standart Montajı İçin Protokoller

CRISPR-associated protein Cpf1 cleaves double-stranded DNA under the guidance of CRISPR RNA (crRNA), generating sticky ends. Because of this ...

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral gene therapy studies, IS assays, in combination with next-generation sequencing, have been used as a cell-tracking tool to characterize clonal stem cell populations sharing the same IS. For the accurate comparison of repopulating stem cell clones within and across different samples, the detection sensitivity, data reproducibility, and high-throughput capacity of the assay are among the most important assay qualities. This work provides a detailed protocol and data analysis workflow for bidirectional IS analysis. The bidirectional assay can simultaneously sequence both upstream and downstream vector-host junctions. Compared to conventional unidirectional IS sequencing approaches, the bidirectional approach significantly improves IS detection rates and the characterization of integration events at both ends of the target DNA. The data analysis pipeline described here accurately identifies and enumerates identical IS sequences through multiple steps of comparison that map IS sequences onto the reference genome and determine sequencing errors. Using an optimized assay procedure, we have recently published the detailed repopulation patterns of thousands of Hematopoietic Stem Cell (HSC) clones following transplant in rhesus macaques, demonstrating for the first time the precise time point of HSC repopulation and the functional heterogeneity of HSCs in the primate system. The following protocol describes the step-by-step experimental procedure and data analysis workflow that accurately identifies and quantifies identical IS sequences.

This manuscript describes the experimental procedure and software analysis for a bidirectional integration site assay that can simultaneously analyze upstream and downstream vector-host junction DNA. Bidirectional PCR products can be used for any downstream sequencing platform. The resulting data are useful for a high-throughput, quantitative comparison of integrated DNA targets.

Çift Yönlü Retroviral Entegrasyon Sitesi PCR Metodolojisi ve Kantitatif Veri Analizi İş Akışı

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral ...

Immunostaining for DNA Modifications: Computational Analysis of Confocal Images

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of enzymatic oxidation of 5mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) as well as detection of N6-methyladenine (6mA) in the DNA of multicellular organisms provided additional degrees of complexity to the epigenetic research. According to a growing body of experimental evidence, these novel DNA modifications may play specific roles in different cellular and developmental processes. Importantly, as some of these marks (e. g. 5hmC, 5fC and 5caC) exhibit tissue- and developmental stage-specific occurrence in vertebrates, immunochemistry represents an important tool allowing assessment of spatial distribution of DNA modifications in different biological contexts. Here the methods for computational analysis of DNA modifications visualized by immunostaining followed by confocal microscopy are described. Specifically, the generation of 2.5 dimension (2.5D) signal intensity plots, signal intensity profiles, quantification of staining intensity in multiple cells and determination of signal colocalization coefficients are shown. Collectively, these techniques may be operational in evaluating the levels and localization of these DNA modifications in the nucleus, contributing to elucidating their biological roles in metazoans.

Newly discovered oxidized forms of 5-methylcytosine (oxi-mCs), 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) may represent distinct DNA modifications with unique functional roles. Here a semi-quantitative workflow for visualization of oxi-mCs' spatial distribution, signal intensity profiling and colocalization is described.

DNA değişiklikler için Immunostaining: Confocal görüntülerin sayısal analiz

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of ...

Rare Event Detection Using Error-corrected DNA and RNA Sequencing

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been used to analyze the spectrum of clonal mutations in malignancy. Though far more efficient than traditional Sanger methods, NGS struggles with identifying rare clonal and subclonal mutations due to its high error rate of ~0.5&#8211;2.0%. Thus, standard NGS has a limit of detection for mutations that are &#62;0.02 variant allele fraction (VAF). While the clinical significance for mutations this rare in patients without known disease remains unclear, patients treated for leukemia have significantly improved outcomes when residual disease is &#60;0.0001 by flow cytometry. In order to mitigate this artefactual background of NGS, numerous methods have been developed. Here we describe a method for Error-corrected DNA and RNA Sequencing (ECS), which involves tagging individual molecules with both a 16 bp random index for error-correction and an 8 bp patient-specific index for multiplexing. Our method can detect and track clonal mutations at variant allele fractions (VAFs) two orders of magnitude lower than the detection limit of NGS and as rare as 0.0001 VAF.

Next-generation sequencing (NGS) is a powerful tool for genomic characterization that is limited by the high error rate of the platform (~0.5&#8211;2.0%). We describe our methods of error-corrected sequencing that allow us to obviate the NGS error rate and detect mutations at variant allele fractions as rare as 0.0001.

Nadiren de olsa algılama hatası düzeltildi DNA ve RNA sıralama

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been ...

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that control the fidelity of transcription. To fill this gap in scientific knowledge, we recently optimized the circle-sequencing assay to detect transcription errors throughout the transcriptome of Saccharomyces cerevisiae, Drosophila melanogaster, and Caenorhabditis elegans. This protocol will provide researchers with a powerful new tool to map the landscape of transcription errors in eukaryotic cells so that the mechanisms that control the fidelity of transcription can be elucidated in unprecedented detail.

This protocol provides researchers with a new tool to monitor the fidelity of transcription in multiple model organisms.

Ökaryotlarda transkripsiyon hataları genom çapında gözetim

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that ...