This work was supported by grants R01DE018138 from the National Institutes of Health (PX) and in part, by Virginia Commonwealth University Presidential Research Incentive Program (PRIP) 144602-3 (PX). We thank Drs. Lei Chen, Yuetan Dou and Xiaojing Wang for assisting with the construction of genome wide mutants. We also thank the DNA Core Facility at Virginia Commonwealth University for DNA sequencing.

1. Primer Design
<ol>
	<li>Primers are designed using in house scripts based on the S. sanguinis SK36 genome sequence. Three sets of primers, F1/R1, F2/R2, and F3/R3 are designed for amplification of the 1-kb upstream sequence of the target gene, the aphA-3 gene encoding kanamycin resistance (Kmr) protein3 and the 1-kb downstream sequence of the target gene, respectively (Figure 1). Among these primers, F1 and R3 are designed using ePrimer3 in the EMBOSS suite of programs (<a href="http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html" target="_blank">http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html</a>) to amplify flanking regions upstream or downstream of the target gene. Gene specific primers, R1 and F3, are designed based upon the 5' and 3' sequences of the target gene. R1 and F3 primers contain 25-bp adaptor sequences at their 5' end that are complementary to the aphA-3 gene. The melting temperatures of each primer were designed to be as close as possible to 60 &deg;C to enable use of a uniform annealing temperature for all PCR reactions in 96-well format.</li>
	<li>F1, R1, F3 and R3 primers are synthesized in 96-well plates based on a gene order. Each plate contains one type of primers in the same gene order. Dilute the primers in 96-well working primer plate to a final concentration of 10 &mu;M for PCR amplification using a multichannel pipette.</li>
</ol>
2. High-throughput PCR Amplification and Purification
<ol>
	<li>To high-throughput amplify 1-kb upstream or downstream of the target S. sanguinis genes, assemble a PCR cocktail mixture on ice in a 15-ml conical tube containing 1640 &mu;l ddH2O, 250 &mu;l 10xHigh Fidelity PCR Buffer, 200 &mu;l of 10 mM dNTP mixture, 100 &mu;l of 50 mM MgSO4, 100 &mu;l of 10 ng/ &mu;l S. sanguinis SK36 genomic DNA and 10 &mu;l Platinum Taq DNA polymerase high fidelity and transfer 23 &mu;l of the mixture into each well on 96-well PCR plate using a multichannel pipette. Transfer 1 &mu;l of each F1 and R1 (or F3 and R3) from the 10 &mu;M working primer plates to the PCR plate using multichannel pipette. Seal the PCR plate and perform amplification at 94 &deg;C for 1 min, and 30 cycles of 94 &deg;C for 30 sec, 54 &deg;C for 30 sec and 68 &deg;C for 1.5 min.</li>
	<li>Prepare 1% agarose gel containing ethidium bromide with 48 wells fitting multichannel pipette loading. Mix 4 &mu;l PCR product with 1 &mu;l of 5xDNA loading buffer on 96-well plate and load the samples on agarose gel using a 10-&mu;l multichannel pipette. Run electrophoresis at 135 V for 30 min. Examine the band on gel under UVP documentation and analysis system.</li>
	<li>Purify the PCR products by PureLink 96 PCR purification kit using centrifugation according to the manufacturer's instruction. For eluting DNA, add 40 &mu;l sterile ddH2O to the well of the binding plate.</li>
	<li>Randomly pick several purified amplicons on the plate to examine the DNA concentrations using NanoDrop spectrophotometer. Adjust the concentration of amplicons on plate to ~10 ng/&mu;l.</li>
	<li>A plasmid containing Kmr cassette is digested using EcoRI as PCR template. The digested plasmid is purified by QIAquick PCR purification kit and the linear plasmid DNA is adjusted to final DNA concentration 10 ng/&mu;l. Assemble 25 &mu;l mixture for Kmr cassette amplicon including 16.4 &mu;l ddH2O, 2.5 &mu;l 10xHigh Fidelity PCR Buffer, 2 &mu;l of 10 mM dNTP mixture, 1 &mu;l of 50 mM Mg SO4, 1 &mu;l of 10 &mu;M F2, 1 &mu;l of 10 &mu;M R2, 1 &mu;l linear plasmid DNA and 0.1 &mu;l Platinum Taq DNA polymerase high fidelity. Perform PCR amplification at 94 &deg;C for 1 min, and 30 cycles of 94 &deg;C for 30 sec, 55 &deg;C for 30 sec and 68 &deg;C for 1 min. Examine the PCR product by gel electrophoresis on 1% agarose. Pool a bulk of the Kmr cassette amplicon from 10 individual PCR purified by QIAquick PCR purification kit. Adjust the amplicon concentration to 10 ng/&mu;l.</li>
	<li>To obtain the final linear recombinant PCR amplicon, three PCR amplicons are combined with each 1 &mu;l (in nearly equal-molar amounts) in one PCR plate well as the PCR template. Other PCR components is added including 14.4 &mu;l ddH2O, 2.5 &mu;l 10xHigh Fidelity PCR Buffer, 2 &mu;l of 10 mM dNTP mixture, 1 &mu;l of 50 mM Mg SO4, 1 &mu;l of 10 &mu;M F1, 1 &mu;l of 10 &mu;M R3, 0.1 &mu;l Platinum Taq DNA polymerase high fidelity. PCR amplification is performed at 94 &deg;C for 2 min, 30 cycles of 94 &deg;C for 30 sec 55 &deg;C for 30 sec and 68 &deg;C for 3.5 min, and finally 68 &deg;C for 4 min.</li>
	<li>Examine the PCR amplicons on agarose gel. Purify and quantify the PCR amplicons as described above. Freeze the recombined PCR amplicons at -20 &deg;C.</li>
</ol>
3. Competent Cells Preparation
<ol>
	<li>Todd Hewitt broth is prepared, adjusted pH to 7.6 using 10 N NaOH, heated to boil and then cooled to room temperature and sterilized using 0.22 &mu;m polystyrene filter4. Add 300 &mu;l heat-inactivated horse sera (final concentration to 2.5%) to 11.7 ml Todd Hewitt broth in 15-ml conical tube to make up TH+HS medium. Aliquot TH+HS medium into 2 ml and 10 ml in tubes.</li>
	<li>Inoculate 5 &mu;l of stock S. sanguinis SK36 frozen at -80 &deg;C into 2 ml TH+HS medium and incubate the culture overnight with capping tightly at 37 &deg;C, accompanied by pre-incubating the 10 ml-TH+HS tube.</li>
	<li>After overnight, transfer 50 &mu;l culture into 10 ml TH+HS and incubate the tube at 37 &deg;C for 3 hr (corresponding to OD660 of 0.07-0.08), immediately using for transformation.</li>
</ol>
4. Cell Transformation and Antibiotic Selection
<ol>
	<li>Add 2 &mu;l of 70 ng S. sanguinis SK36 competence stimulating peptide (CSP) and 2 &mu;l linear recombinant PCR amplicon (~50 ng) to Eppendorf tubes on 96-well block and pre-warm them at 37 &deg;C. Transfer 330 &mu;l of 3 hr-incubated SK36 culture into each tube. Incubate at 37 &deg;C for 1 hr. Replace DNA with sterile ddH2O as control.</li>
	<li>Place the block on ice and spread 100 &mu;l of each transformation on brain heart infusion (BHI) agar plate with 500 &mu;g/ml kanamycin. Incubate the plates at 37 &deg;C for 2 d under microaerobic conditions.</li>
</ol>
5. Mutant Confirmation and Storage
<ol>
	<li>For each replacement mutant, randomly pick up 2 individual colonies, inoculate the colony into 5 ml BHI containing 500 &mu;g/ml kanamycin and incubate the inoculum microaerobically overnight at 37 &deg;C. Cryopreserve each culture in 30% glycerol at -80 &deg;C</li>
	<li>To examine whether the mutant containing the expected gene replacement, perform colony PCR for each mutant using F1 and R3 primers in 96-well PCR plate. About 1-&mu;l overnight culture from individual colony is used as the DNA template in 25-&mu;l PCR-amplification reaction. PCR is performed at 94 &deg;C for 5 min, 35 cycles of 94 &deg;C for 30 sec, 55 &deg;C for 30 sec and 68 &deg;C for 3.5 min, and finally 68 &deg;C for 4 min.</li>
	<li>To precisely identify double-band mutants or contaminant PCR amplicon, examine the PCR amplicon by electrophoresis for 4 hr on &gt;12 cm long 2% agarose gel with ethidium bromide staining. Under this agarose gel electrophoresis condition, any amplicons with &ge; 100 bp difference were clearly identified. When bands resulting from amplification of the Kmr cassette and the wild-type gene are anticipated to differ by &lt; 100 bp, an internal T1 primer is used to determine whether a wild-type gene can be detected by PCR.</li>
	<li>To further confirm the deletion, the amplicons are purified by PureLink 96 PCR purification kit and sequenced using the P1 primer which binds to the Kmr cassette. Keep only correct mutants confirmed by sequencing.</li>
</ol>

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

No conflicts of interest declared.

To minimize the possible polar effects of the replacement of one targeted gene with exogenous antibiotics gene on neighboring genes, two steps are taken while initial primer designing. For most of deleted genes, the primers R1 and F3 are designed to delete the coding region from 6 bp following the start codon to 30 bp prior to the stop codon. The last 30 base pairs are retained to protect potential ribosomal binding site used by the adjacent downstream gene. The retained region between two neighboring genes is extended t...

<table border="1">
	<tbody>
 <tr>
 <td>Names</td>
 <td>Company</td>
 <td>Catalog#</td>
 <td>Comments (optional)</td>
 </tr>
 <tr>
 <td>Primer F2</td>
 <td>Integrated DNA Technologies</td>
 <td></td>
 <td>TGACTAACTAGGAGGAATAAATG GCTAAAATGAGAATAT</td>
 </tr>
 <tr>
 <td>Primer R2</td>
 <td>ibid</td>
 <td></td>
 <td>CATTATTCCCTCCAGGTACTAAAA CAATTCATCCAGT</td>
 </tr>
 <tr>
 <td>Primer F2p</td>
 <td>ibid</td>
 <td></td>
 <td>GATAAACCCAGCGAACCATTTGA</td>
 </tr>
 <tr>
 <td>Primer P1</td>
 <td>ibid</td>
 <td></td>
 <td>GCTTATATACCTTAGCAGGAGACA</td>
 </tr>
 <tr>
 <td>Primer P2</td>
 <td>ibid</td>
 <td></td>
 <td>GTATGACATTGCCTTCTGCGTCC</td>
 </tr>
 <tr>
 <td>Primer 5' end_R1_seq</td>
 <td>ibid</td>
 <td></td>
 <td>GCCATTTATTCCTCCTAGTTAGTCA</td>
 </tr>
 <tr>
 <td>Primer 5' end_F3_seq</td>
 <td>ibid</td>
 <td></td>
 <td>GTTTTAGTACCTGGAGGGAATAATG</td>
 </tr>
 <tr>
 <td>Primer 5' end_R1p_seq</td>
 <td>ibid</td>
 <td></td>
 <td>CCTCAAATGGTTCGCTGGGTTTATC</td>
 </tr>
 <tr>
 <td>CSP</td>
 <td>Synprep</td>
 <td></td>
 <td>Sequence:NH2-DLRGVPNPWGWIFGR-COOH</td>
 </tr>
 <tr>
 <td>DNA Polymerase </td>
 <td>Invitrogen</td>
 <td>11304-102</td>
 <td>Platinum Taq DNA Polymerase High Fidelity</td>
 </tr>
 <tr>
 <td>EcoRI</td>
 <td>New England Biolabs Inc</td>
 <td>R0101S</td>
 <td>Restriction enzyme</td>
 </tr>
 <tr>
 <td>Agar</td>
 <td>American Bioanalytical</td>
 <td>AB01185</td>
 <td></td>
 </tr>
 <tr>
 <td>Agarose</td>
 <td>Promega</td>
 <td>V3125</td>
 <td></td>
 </tr>
 <tr>
 <td>BHI</td>
 <td>BD Biosciences </td>
 <td>237500</td>
 <td>Brain Heart Infusion</td>
 </tr>
 <tr>
 <td>Horse serum</td>
 <td>Fisher Scientific</td>
 <td>SH3007403</td>
 <td>Horse serum</td>
 </tr>
 <tr>
 <td>Km</td>
 <td>Fisher Scientific</td>
 <td>BP906-5</td>
 <td>Kanamycin</td>
 </tr>
 <tr>
 <td>TH broth</td>
 <td>BD Biosciences </td>
 <td>249240</td>
 <td>Todd Hewitt broth</td>
 </tr>
 <tr>
 <td>PureLink 96</td>
 <td>Invitrogen</td>
 <td>K310096</td>
 <td>PureLink 96 PCR purification kit</td>
 </tr>
 <tr>
 <td>QIAquick</td>
 <td>Qiagen</td>
 <td>28106</td>
 <td>QIAquick PCR purification kit</td>
 </tr>
 <tr>
 <td>Filter</td>
 <td>Corning</td>
 <td>431117</td>
 <td>0.22 &mu;m polystyrene filter</td>
 </tr>
 <tr>
 <td>Anoxomat System</td>
 <td>Mart Microbiology b.v.</td>
 <td>Anoxomat Mark II</td>
 <td></td>
 </tr>
 <tr>
 <td>Benchtop centrifuge</td>
 <td>Thermo Scientific</td>
 <td>75004377</td>
 <td>Sorvall Legend RT Plus microplate rotor</td>
 </tr>
 <tr>
 <td>Gel Documentation</td>
 <td>UVP LLC</td>
 <td>BioDoc-It 210</td>
 <td></td>
 </tr>
 <tr>
 <td>Incubator</td>
 <td>Fisher Scientific</td>
 <td>11-690-625D</td>
 <td>Isotemp </td>
 </tr>
 <tr>
 <td>Labnet's Gel XL</td>
 <td>Labnet</td>
 <td>E0160</td>
 <td>Labnet's Gel XL</td>
 </tr>
 <tr>
 <td>Microcentrifuge</td>
 <td>Eppendorf</td>
 <td>22621408</td>
 <td>Microcentrifuge 5415 R</td>
 </tr>
 <tr>
 <td>Multichannel pipettes</td>
 <td>Thermo Scientfic</td>
 <td>4661040, 4661020</td>
 <td>Finnpipette F1</td>
 </tr>
 <tr>
 <td>Thermal Cycler</td>
 <td>Applied Biosystems Inc.</td>
 <td>N805-0200</td>
 <td>GeneAmp PCR system 9700</td>
 </tr>
	 </tbody>
 </table>

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.

After PCR amplification using primers F1 and R1, and F3 and R3, approximately 1-kb upstream and downstream of each S. sanguinis gene were obtained in 96-well format, respectively (Figure 2A). Under our PCR conditions and using designed primers, a specific product was amplified from S. sanguinis genomic DNA in each PCR reaction. This result indicated the primers were highly specific to the targets of S. sanguinis. Through PCR re-amplification using primers F1 and R3 and t...

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

genome-wide-gene-deletions-streptococcus-sanguinis-high-throughput

Research

JoVE Journal

Biology

16.4K Views.  Virginia Commonwealth University. An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.

Video: Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. elegans, gene function can be knocked down simply and efficiently by feeding worms with bacteria expressing a dsRNA corresponding to a specific gene 1. While the creation of libraries of RNAi clones covering most of the C. elegans genome 2,3 opened the way for true functional genomic studies (see for example 4-7), most established methods are laborious. Moy and colleagues have developed semi-automated protocols that facilitate genome-wide screens 8. The approach relies on microscopic imaging and image analysis. 
	Here we describe an alternative protocol for a high-throughput genome-wide screen, based on robotic handling of bacterial RNAi clones, quantitative analysis using the COPAS Biosort (Union Biometrica (UBI)), and an integrated software: the MBioLIMS (Laboratory Information Management System from Modul-Bio) a technology that provides increased throughput for data management and sample tracking. The method allows screens to be conducted on solid medium plates. This is particularly important for some studies, such as those addressing host-pathogen interactions in C. elegans, since certain microbes do not efficiently infect worms in liquid culture.
	We show how the method can be used to quantify the importance of genes in anti-fungal innate immunity in C. elegans. In this case, the approach relies on the use of a transgenic strain carrying an epidermal infection-inducible fluorescent reporter gene, with GFP under the control of the promoter of the antimicrobial peptide gene nlp 29 and a red fluorescent reporter that is expressed constitutively in the epidermis. The latter provides an internal control for the functional integrity of the epidermis and nonspecific transgene silencing9. When control worms are infected by the fungus they fluoresce green. Knocking down by RNAi a gene required for nlp 29 expression results in diminished fluorescence after infection. Currently, this protocol allows more than 3,000 RNAi clones to be tested and analyzed per week, opening the possibility of screening the entire genome in less than 2 months.

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

We describe a protocol using C. elegans and RNAi feeding libraries that allows automated measurement of multiple parameters such as fluorescence, size and opacity of individual worms in a population. We give one example of a screen to identify genes involved in anti-fungal innate immunity in C. elegans.

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. ...

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay (PCA) in Living Cells

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often depend on its interactions with other proteins. Here, we describe a protocol for the yeast protein-fragment complementation assay (PCA), a powerful method to detect direct and proximal associations between proteins in living cells. The interaction between two proteins, each fused to a dihydrofolate reductase (DHFR) protein fragment, translates into growth of yeast strains in presence of the drug methotrexate (MTX). Differential fitness, resulting from different amounts of reconstituted DHFR enzyme, can be quantified on high-density colony arrays, allowing to differentiate interacting from non-interacting bait-prey pairs. The high-throughput protocol presented here is performed using a robotic platform that parallelizes mating of bait and prey strains carrying complementary DHFR-fragment fusion proteins and the survival assay on MTX. This protocol allows to systematically test for thousands of protein-protein interactions (PPIs) involving bait proteins of interest and offers several advantages over other PPI detection assays, including the study of proteins expressed from their endogenous promoters without the need for modifying protein localization and for the assembly of complex reporter constructs.

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay PCA in Living Cells

Proteins interact with each other and these interactions determine in a large part their functions. Protein interaction partners can be identified at high-throughput in vivo using a yeast fitness assay based on the dihydrofolate reductase protein-fragment complementation assay (DHFR-PCA).

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

qPCRTag Analysis - A High Throughput, Real Time PCR Assay for Sc2.0 Genotyping

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic chromosome, synIII1, and one synthetic chromosome arm, synIXR2, have been constructed and their in vivo function validated in the absence of the corresponding wild type chromosomes. An important design feature of Sc2.0 chromosomes is the introduction of PCRTags, which are short, re-coded sequences within open reading frames (ORFs) that enable differentiation of synthetic chromosomes from their wild type counterparts. PCRTag primers anneal selectively to either synthetic or wild type chromosomes and the presence/absence of each type of DNA can be tested using a simple PCR assay. The standard readout of the PCRTag assay is to assess presence/absence of amplicons by agarose gel electrophoresis. However, with an average PCRTag amplicon density of one per 1.5 kb and a genome size of ~12 Mb, the completed Sc2.0 genome will encode roughly 8,000 PCRTags. To improve throughput, we have developed a real time PCR-based detection assay for PCRTag genotyping that we call qPCRTag analysis. The workflow specifies 500 nl reactions in a 1,536 multiwell plate, allowing us to test up to 768 PCRTags with both synthetic and wild type primer pairs in a single experiment.

Designer chromosomes of the Synthetic Yeast Genome project, Sc2.0, can be distinguished from their native counterparts using a PCR-based genotyping assay called PCRTagging, which has a presence/absence endpoint. Here we describe a high-throughput real time PCR detection method for PCRTag genotyping.

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to dose-limiting toxicity and many adverse side effects. Targeting the genome with sequence-specific small molecules may enable molecules with increased therapeutic index and fewer off-target effects. N-methylpyrrole/N-methylimidazole polyamides are molecules that can be rationally designed to target specific DNA sequences with exquisite precision. And unlike most natural transcription factors, polyamides can bind to methylated and chromatinized DNA without a loss in affinity. The sequence specificity of polyamides has been extensively studied in vitro with cognate site identification (CSI) and with traditional biochemical and biophysical approaches, but the study of polyamide binding to genomic targets in cells remains elusive. Here we report a method, the crosslinking of small molecules to isolate chromatin (COSMIC), that identifies polyamide binding sites across the genome. COSMIC is similar to chromatin immunoprecipitation (ChIP), but differs in two important ways: (1) a photocrosslinker is employed to enable selective, temporally-controlled capture of polyamide binding events, and (2) the biotin affinity handle is used to purify polyamide&#8211;DNA conjugates under semi-denaturing conditions to decrease DNA that is non-covalently bound. COSMIC is a general strategy that can be used to reveal the genome-wide binding events of polyamides and other genome-targeting chemotherapeutic agents.

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

Identifying the direct targets of genome-targeting molecules remains a major challenge. To understand how DNA-binding molecules engage the genome, we developed a method that relies on crosslinking of small molecules to isolate chromatin (COSMIC).

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...