Name: a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells
Uploaded: 2016-03-03T13:00:00
Description: Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

The skillful technical assistance of Jasmin Kresse is gratefully acknowledged.

1. Differentiation of Human ESC towards the Definitive Endoderm
<ol>
	<li>Cultivate human embryonic stem cells (ESCs) in an incubator at 37 &#176;C and 5% CO2.</li>
	<li>Coat a new 6-well cell culture plate with 1 ml of a basement membrane matrix and incubate the culture-ware for at least 30 min at RT. For specific details please turn to the respective manufacturer&#39;s instructions.</li>
	<li>Confirm that the cultured human ESCs have reached 80%-90% confluency under the microscope using a low magnification...

<ol>
	<li>Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+Highly+Purified+Cardiomyocytes+from+Human+Induced+Pluripotent+Stem+Cells+Using+Small+Molecule-modulated+Differentiation+and+Subsequent+Glucose+Starvation.">Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation.</a> J Vis Exp. (97), (2015).</li><li>Sgodda, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+hepatic+differentiation+strategies+for+human+induced+pluripotent+stem+cells.">Improved hepatic differentiation strategies for human induced pluripotent stem cells.</a> Curr Mol Med. 13 (5), 842-855 (2013).</li><li>Naujok, O., Burns, C., Jones, P. M., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin-producing+surrogate+beta-cells+from+embryonic+stem+cells:+are+we+there+yet.">Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet.</a> Mol Ther. 19 (10), 1759-1768 (2011).</li><li>Katsirntaki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bronchoalveolar+sublineage+specification+of+pluripotent+stem+cells:+effect+of+dexamethasone+plus+cAMP-elevating+agents+and+keratinocyte+growth+factor.">Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor.</a> Tissue Eng Part A. 21 (3-4), 669-682 (2015).</li><li>Abranches, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+differentiation+of+embryonic+stem+cells+in+vitro:+a+road+map+to+neurogenesis+in+the+embryo.">Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo.</a> PLoS One. 4 (7), e6286 (2009).</li><li>Naujok, O., Diekmann, U., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+generation+of+definitive+endoderm+from+human+embryonic+stem+cells+is+initially+independent+from+activin+A+but+requires+canonical+Wnt-signaling.">The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling.</a> Stem Cell Rev. 10 (4), 480-493 (2014).</li><li>D'Amour, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat Biotechnol. 24 (11), 1392-1401 (2006).</li><li>Diekmann, U., Lenzen, S., Naujok, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+and+efficient+protocol+for+human+pluripotent+stem+cell+differentiation+into+the+definitive+endoderm+based+on+dispersed+single+cells.">A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells.</a> Stem Cells Dev. 24 (2), 190-204 (2015).</li><li>Kim, P. T., Ong, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+definitive+endoderm+from+mouse+embryonic+stem+cells.">Differentiation of definitive endoderm from mouse embryonic stem cells.</a> Results Probl Cell Differ. 55, 303-319 (2012).</li><li>Katoh, M., Katoh, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomic+analyses+of+CXCR4:+transcriptional+regulation+of+CXCR4+based+on+TGFbeta,+Nodal,+Activin+signaling+and+POU5F1,+FOXA2,+FOXC2,+FOXH1,+SOX17,+and+GFI1+transcription+factors.">Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors.</a> Int J Oncol. 36 (2), 415-420 (2010).</li><li>Nostro, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+signaling+through+TGFbeta+family+members+and+WNT+regulates+patterning+and+pancreatic+specification+of+human+pluripotent+stem+cells.">Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells.</a> Development. 138 (5), 861-871 (2011).</li><li>Rezania, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+into+functional+islets+capable+of+treating+pre-existing+diabetes+in+mice.">Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice.</a> Diabetes. 61 (8), 2016-2029 (2012).</li><li>Bruin, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+and+function+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+in+macroencapsulation+devices+following+transplant+into+mice.">Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice.</a> Diabetologia. 56 (9), 1987-1998 (2013).</li><li>Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Residual+undifferentiated+cells+during+differentiation+of+induced+pluripotent+stem+cells+in+vitro+and+in+vivo.">Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo.</a> Stem Cells Dev. 21 (4), 521-529 (2012).</li><li>Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Teratoma+formation+by+human+embryonic+stem+cells:+evaluation+of+essential+parameters+for+future+safety+studies.">Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies.</a> Stem Cell Res. 2 (3), 198-210 (2009).</li><li>Herberts, C. A., Kwa, M. S., Hermsen, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Risk+factors+in+the+development+of+stem+cell+therapy.">Risk factors in the development of stem cell therapy.</a> J Transl Med. 9, 29 (2011).</li><li>Naujok, O., Kaldrack, J., Taivankhuu, T., J&#246;rns, A., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+removal+of+undifferentiated+embryonic+stem+cells+from+differentiation+cultures+through+HSV1+thymidine+kinase+and+ganciclovir+treatment.">Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment.</a> Stem Cell Rev. 6 (3), 450-461 (2010).</li><li>Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+FACS+approach+isolates+hESC+derived+endoderm+using+transcription+factors.">A new FACS approach isolates hESC derived endoderm using transcription factors.</a> PLoS One. 6 (3), 17536 (2011).</li></ol>

Currently used differentiation protocols rarely result in 100% differentiated cells. For reasons that still have to be addressed some cells resist the differentiation process. Depending on the efficiency of the used differentiation protocol and the propensity of the ESC line a certain number of residual pluripotent cells are commonly observed even after differentiation into the definitive endoderm. These residual cells may impair downstream differentiations or further analysis such as transcriptomics, proteomics, and miR...

Pluripotent stem cells such as embryonic stem cells (ESCs) have the capability to differentiate into virtually any cell type of the human body. Thus, in vitro differentiation protocols can be used to generate numerous adult cell types such as cardiomyocytes1, hepatocytes2, beta cells3, lung epithelial4 or neuronal cells5. This makes ESCs a valuable tool for the potential treatment of various degenerative diseases3.
The in vitro differentiation of ESCs towards adult tissues of the lung, liver and pancreas requires a pseudo-gastrulation into cells reminiscent of the definitive endoderm (DE)6. Since downstream differentiation towards the aforementioned somatic cell types is significantly less efficient, an optimal endoderm differentiation is regarded as rate-limiting7. Cells that are committed towards the endoderm lineage undergo characteristic changes in their gene expression profile. Pluripotency master regulator genes are down regulated, whereas the expression of other transcription factors such as FOXA2, SOX17, HNF1B, members of the GATA family and the surface receptor CXCR4 is highly upregulated6, 8, 9. CXCR4 is known to be transactivated by SMAD2/3, downstream of Nodal/TGF-&#946; signaling and SOX17 due to specific binding sites in its promoter region10. Thus it is a very suitable marker used in a number of reports6, 8, 11-13. These expression changes reflects a pseudo-gastrulation event, in which ESCs first acquire characteristics of a primitive streak-like cell population and subsequently commit into the endoderm germ layer6.
However, differentiation protocols are rarely 100% efficient as a few cells may resist the differentiation process or differentiate towards other unintended lineages14. These cells may negatively influence further differentiation. Furthermore, residual undifferentiated cells harbor great risks for later transplantation experiments and may give rise to teratomas15-17.
To remove these unwanted cells early-on the surface marker CXCR4 can be used for the purification of cells that are committed towards the DE18. Here, we describe a method for the positive selection of CXCR4+ cells from DE differentiation cultures. For this, the surface marker CXCR4 is bound by an antibody which then in turn binds to magnetic microbeads. Unlike the harsh conditions during FACS sorting, the magnetically labeled DE-like cells can then easily be purified in a benchtop format using a gentle purification method. This protocol provides a straightforward method for the removal of cell populations that resisted the DE differentiation process.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >Hues8 human embryonic stem cell line</td>
			<td >Harvard Department of stem cell &#38; regenerative biology</td>
			<td >NA</td>
			<td >Suitable cell line for endoderm generation</td>
		</tr>
		<tr >
			<td >Hes3 human embryonic stem cell line</td>
			<td >ES Cell International</td>
			<td >NA</td>
			<td >Suitable and robust cell line for endoderm generation</td>
		</tr>
		<tr >
			<td >mTeSR1</td>
			<td >Stemcell Technologies</td>
			<td >5850</td>
			<td >ESC culture medium</td>
		</tr>
		<tr >
			<td >FCS</td>
			<td >Biowest</td>
			<td >S1860</td>
			<td ></td>
		</tr>
		<tr >
			<td >Advanced RPMI 1640</td>
			<td >Life Technologies</td>
			<td >12633012</td>
			<td ></td>
		</tr>
		<tr >
			<td >CD184 (CXCR4)-APC, human</td>
			<td >Miltenyi Biotec</td>
			<td >130-098-357</td>
			<td ></td>
		</tr>
		<tr >
			<td >anti-APC MicroBeads</td>
			<td >Miltenyi Biotec</td>
			<td >130-090-855&#160;</td>
			<td ></td>
		</tr>
		<tr >
			<td >OctoMACS Separator</td>
			<td >Miltenyi Biotec</td>
			<td >130-042-109</td>
			<td >magnetic field</td>
		</tr>
		<tr >
			<td >Y-27632</td>
			<td >Selleck Chemicals</td>
			<td >S1049</td>
			<td >ROCK inhibitor</td>
		</tr>
		<tr >
			<td >CHIR-99021</td>
			<td >Tocris Bioscience</td>
			<td >4423</td>
			<td ></td>
		</tr>
		<tr >
			<td >Activin A</td>
			<td >Peprotech</td>
			<td >120-14</td>
			<td ></td>
		</tr>
		<tr >
			<td >Gentle Cell Dissociation Reagent</td>
			<td >Stemcell Technologies</td>
			<td >7174</td>
			<td >Enzyme-free passaging solution, alternative: Trypsin/EDTA</td>
		</tr>
		<tr >
			<td >Matrigel*</td>
			<td >Corning</td>
			<td >354277</td>
			<td >basement membrane matrix 
			 * solve and store in aliquots at -80 &#176;C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12. 
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature. 
Remove the matrigel and use immediately.
			</td>
		</tr>
		<tr >
			<td >MS Columns</td>
			<td >Miltenyi Biotec</td>
			<td >30-042-201</td>
			<td ></td>
		</tr>
		<tr >
			<td >MACS Separator</td>
			<td >Miltenyi Biotec</td>
			<td >130-042-302</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human FOXA2 FW gggagcggtgaagatgga</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human FOXA2 REV tcatgttgctcacggaggagta</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human GSC FW gaggagaaagtggaggtctggtt</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human GSC REV ctctgatgaggaccgcttctg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >SOX17 TaqMan assay</td>
			<td >Applied Biosystems</td>
			<td >Hs00751752_s1</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human SOX7 FW gatgctgggaaagtcgtggaagg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human SOX7 REV tgcgcggccggtacttgtag</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human POU5F1 FW cttgctgcagaagtgggtggagg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human POU5F1 REV ctgcagtgtgggtttcgggca</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human Nanog FW ccgagggcagacatcatcc</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human Nanog REV ccatccactgccacatcttct</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TBP FW caa cag cct gcc acc tta cgc tc</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TBP REV agg ctg tgg ggt cag tcc agt g</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TUBA1A FW ggc agt gtt tgt aga ctt gga acc c</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TUBA1A REV tgt gat aag ttg ctc agg gtg gaa g</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human G6PD FW agg ccg tca cca aga aca ttc a</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human G6PD REV cga tga tgc ggt tcc agc cta t
</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SOX2</td>
			<td >Santa Cruz Biotechnology</td>
			<td >sc-17320</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-FOXA2</td>
			<td >MerckMillipore</td>
			<td >07-633</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SOX17</td>
			<td >R&#38;D Systems</td>
			<td >AF1924</td>
			<td ></td>
		</tr>
	
		<tr >
			<td ></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr >
			<td >NA = not applicable</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell replacement therapies. Terminally differentiated cell types could be used for the treatment of various degenerative diseases. In vitro differentiation of these cells towards tissues of the lung, liver and pancreas requires as a first step the generation of definitive endodermal cells. This step is rate-limiting for further differentiation towards terminally matured cell types such as insulin-producing beta cells, hepatocytes or other endoderm-derived cell types. Cells that are committed towards the endoderm lineage highly express a multitude of transcription factors such as FOXA2, SOX17, HNF1B, members of the GATA family, and the surface receptor CXCR4. However, differentiation protocols are rarely 100% efficient. Here, we describe a method for the purification of a CXCR4+ cell population after differentiation into the DE by using magnetic microbeads. This purification additionally removes cells of unwanted lineages. The gentle purification method is quick and reliable and might be used to improve downstream applications and differentiations.

Upon differentiation ESCs undergo drastic changes in gene and protein expression. Figure 1 depicts typical marker genes that can be used to verify a successful endoderm differentiation. Prime targets for a gene expression analysis are GSC, FOXA2, and SOX17. In a relative gene expression analysis especially FOXA2 and SOX17 are increased by &#62; 2,000 fold when compared to undifferentiated ESCs. GSC is ...

Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Here, we describe a method for the purification of differentiated human embryonic stem cells that are committed towards the definitive endoderm for the improvement of downstream applications and further differentiations.

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell ...

The overall goal of this method is to purify endodermal cells generated from human embryonic stem or ES cells. This method can help answer key questions in the stem cell field about endodermal differentiation. The main advantage of this technique is that a pure endoderm cell population can be obtained after the removal of undifferentiated cells.Before beginning the procedure, coat six well cell culture plates with one milliliter of basement membrane matrix per well. For at least 30 minutes at room temperature. Then, to harvest the human ES cells, aspirate the medium from an 80 to 90%confluent human embryonic stem cell culture with a sterile glass Pasture pipette.And wash the cells with two milliliters of PBS per well. Shaking the plate and aspirating the saline to remove the dead cells and debris. Next, gently dissociate the cell clusters with one milliliter of enzyme-free passaging solution reagent, at 37 degrees Celsius and 5%carbon dioxide until the cells exhibit clear signs of disruption into smaller clusters.After about seven minutes, add one milliliter of DMMF12 medium to the wells. And pipette up and down a few times with a one milliliter pipette tip to detach the remaining cell aggregates into a single cell suspension. Using the same pipette, transfer the cells into a centrifugation tube and rinse the wells with one milliliter of fresh DMMF12 medium, pooling the washes in the tube.After spinning down the cells, re-suspend the pellet in five milliliters of ES cell culture medium supplemented with ROCK inhibitor. Count the cells and seed 1.5:4 times 10 to the fifth cells per well on the basement membrane matrix coated plates in culture medium supplemented with ROCK inhibitor to prevent apoptosis. Incubate the cells for approximately 24 hours.And then use a sterile, glass Pasteur pipette to replace the medium in each well with 2 milliliters of primitive streak induction medium. After 24 more hours of culture, replace the medium with endoderm induction medium for a 48 hour incubation with daily medium changes. On the last day of culture and at least one hour before harvesting the cells, add fresh ROCK inhibitor to the culture medium.Then use a sterile, glass Pasteur pipette to aspirate the medium from each of the wells and dissociate the cells with enzyme-free passaging solution reagent as just demonstrated. When a single-cell suspension has been achieved, count the cells and centrifuge them. Make sure that from this point on, all medium and buffers contain the ROCK inhibitor to prevent the cells from dying.Otherwise, they will not be attached properly after receding. Re-suspend the pellet in 100 microliters of PEB buffer, supplemented with ROCK inhibitor per 1 times 10 to the seventh cells. Then add CXCR4 APC antibody to the cells.Gently flicking the tube to mix. After 15 minutes at 4 degrees Celsius, wash the cells in one to two milliliters of PEB buffer and use a sterile, glass Pasteur pipette to aspirate the supernatant. Re-suspend the pellet in 80 microliters of PEB buffer per 1 times 10 to the seventh cells and add 20 microliters of anti-APC microbeads to the cells.Mix the sample with gentle flicking. Then incubate the cells at four degrees Celsius for 15 minutes. At the end of the incubation, wash the cells with one to two milliliters of PEB buffer supplemented with ROCK inhibitor.And re-suspend the pellet in 500 microliters of fresh PEB buffer plus inhibitor. To isolate the CXCR4+cells by magnetic bead separation, load a medium sized magnetic column onto an appropriately sized magnet and pre-rinse the column with 500 microliters PEB buffer plus ROCK inhibitor. When all of the wash has drained from the top of the column, apply the entire magnetic bead labeled cell volume to the column, collecting the flow through in a conical tube.Wash the column with three applications of 500 microliters of PEB buffer plus ROCK inhibitor. Then transfer the column from the magnet into a suitable collection tube. And plunge one milliliter of PEB buffer plus ROCK inhibitor through the column to collect the CXCR4+cells.Optionally, all of the flow through samples can be collected separately and 20 microliter aliquots from each sample can be used to determine the percentage of CXCR4+cells in each alouette by flow cytometry. This procedure can be repeated with the first flow through to collect cells that did not bind to the column. Then pool both allouted CXCR4+samples and centrifuge them.Finally, re-suspend the pellet in one milliliter of endoderm induction medium supplemented with ROCK inhibitor And seed the cells at the appropriate density in a basement membrane matrix coated cell culture container. Prior to their differentiation, human ES cells express high levels of the pluripotency marker SOX2. Whereas, the definitive endoderm marker, FOXA2 is not detected.Upon differentiation, the ES cells undergo drastic changes in their gene and protein expression. Indeed, after four days in differentiation medium, SOX17 and FOXA2 are co-expressed uniformly within the nuclei of many of the former ES cells, a hallmark of definitive endoderm commitment. Some cells resist the differentiation process, expressing neither of the two marker proteins.And in fact, retain their pluripotency marker SOX2 expression. In this representative experiment, on day three of differentiation, nearly 60%of the harvested ES cells expressed CXCR4, the purity of which was enriched to over 85%after magnetic bead sorting of the pluripotent and other unwanted lineage cells. After seeding the purified CXCR4+cells, only a few SOX2+cells are detected, with the majority of the seeded cells expressing FOXA2.Once mastered, this technique can be completed within two hours, if performed properly. Following this procedure, other like immune histochemistry or QPCR can be performed to answer additional questions about the differentiation process. After watching this video, you should have a good understanding of how to purify endoderm cells by magnetic bead sorting.

a-quick-efficient-method-for-purification-endoderm-cells-generated

Research

JoVE Journal

Developmental Biology

Efficient Derivation of Retinal Pigment Epithelium Cells from Stem Cells

No cure has been discovered for age-related macular degeneration (AMD), the leading cause of vision loss in people over the age of 55. AMD is complex multifactorial disease with an unknown etiology, although it is largely thought to occur due to death or dysfunction of the retinal pigment epithelium (RPE), a monolayer of cells that underlies the retina and provides critical support for photoreceptors. RPE cell replacement strategies may hold great promise for providing therapeutic relief for a large subset of AMD patients, and RPE cells that strongly resemble primary human cells (hRPE) have been generated in multiple independent labs, including our own. In addition, the uses for iPS-RPE are not limited to cell-based therapies, but also have been used to model RPE diseases. These types of studies may not only elucidate the molecular bases of the diseases, but also serve as invaluable tools for developing and testing novel drugs. We present here an optimized protocol for directed differentiation of RPE from stem cells. Adding nicotinamide and either Activin A or IDE-1, a small molecule that mimics its effects, at specific time points, greatly enhances the yield of RPE cells. Using this technique we can derive large numbers of low passage RPE in as early as three months.

Stem cell-derived retinal pigment epithelium (RPE) cells may be used for multiple applications including cell-based therapies for retinal degeneration, disease modeling, and drug studies. Here we present a simple protocol for reproducibly deriving RPE from stem cells.

No cure has been discovered for age-related macular degeneration  (AMD), the leading cause of vision loss in people over the age of 55. AMD is complex ...

The Production of Pluripotent Stem Cells from Mouse Amniotic Fluid Cells Using a Transposon System

Induced pluripotent stem (iPS) cells are generated from mouse and human somatic cells by forced expression of defined transcription factors using different methods. Here, we produced iPS cells from mouse amniotic fluid cells, using a non-viral-based transposon system. All obtained iPS cell lines exhibited characteristics of pluripotent cells, including the ability to differentiate toward derivatives of all three germ layers in vitro and in vivo. This strategy opens up the possibility of using cells from diseased fetuses to develop new therapies for birth defects.

In this study, we generate induced pluripotent stem cells from mouse amniotic fluid cells, using a non-viral-based transposon system.

Induced pluripotent stem (iPS) cells are generated from mouse and human somatic cells by forced expression of defined transcription factors using ...

Horizontal Whole Mount: A Novel Processing and Imaging Protocol for Thick, Three-dimensional Tissue Cross-sections of Skin

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality microscopic images is not entirely dependent upon the quality of the microscope, but also upon the methods of tissue processing, which often involve multiple critical actions or steps. Furthermore, mesenchymal cell types in the skin and other tissues represent a new challenge for tissue preparation and imaging. Here, we present a complete process, from tissue harvest to microscopy. Our technique, called &#34;horizontal whole mount,&#34; is one that novices can quickly become proficient in and that allows for antigen preservation and detection in 60-300 &#181;m-thick sections cut with a cryostat. Sections of this thickness provide enhanced visualization of tissue microarchitecture in a three-dimensional environment. In addition, the protocol preserves mesenchymal cells in a manner that enhances image quality when compared to standard cryostat or paraffin sections, thereby increasing the efficacy and reliability of immunostaining. We believe that this protocol will benefit all laboratories that visualize skin, and possibly other tissues and organs.

This work presents a novel processing and imaging protocol for thick, three-dimensional tissue cross-section analysis that enables the full exploitation of confocal imaging modalities. This protocol preserves antigenicity and represents a robust system to analyze skin histology and potentially other tissue types.

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality ...

Rapid, Directed Differentiation of Retinal Pigment Epithelial Cells from Human Embryonic or Induced Pluripotent Stem Cells

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing a detailed and thorough protocol is to clearly demonstrate each step and to make this readily available to researchers in the field. This protocol results in a homogenous layer of RPE with minimal or no manual dissection needed. The method presented here has been shown to be effective for induced pluripotent stem cells (iPSC) and human embryonic stem cells. Additionally, we describe methods for cryopreservation of intermediate cell banks that allow long-term storage. RPE generated using this protocol might be useful for iPSC disease-in-a-dish modeling or clinical application.

This protocol describes how to produce retinal pigment epithelial cells (RPE) from pluripotent stem cells. The method uses a combination of growth factors and small molecules to direct the differentiation of stem cells into immature RPE in fourteen days and mature, functional RPE after three months.

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing ...

Single-cell Photoconversion in Living Intact Zebrafish

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause disease when disrupted. Scientists have developed clever techniques to investigate characteristics and natural dynamics of these cells within intact tissue by expressing fluorescent proteins in subsets of cells. However, at times, experiments require more selected visualization of cells within the tissue, sometimes at the single-cell or population-of-cells manner. To achieve this and visualize single cells within a population of cells, scientists have utilized single-cell photoconversion of fluorescent proteins. To demonstrate this technique, we show here how to direct UV light to an Eos-expressing cell of interest in an intact, living zebrafish. We then image those photoconverted Eos+ cells 24 h later to determine how they changed in the tissue. We describe two techniques: single cell photoconversion and photoconversions of populations of cell. These techniques can be used to visualize cell-cell interactions, cell-fate and differentiation, and cell migrations, making it a technique that is applicable in numerous biological questions.

Here, we present a protocol to show how cell photoconversion is achieved through UV exposure to specific areas expressing the fluorescent protein, Eos, in living animals.

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and chromosome dynamics. While the germline is an excellent model, the analysis is often two dimensional due to the time and labor required for three-dimensional analysis. Major readouts in such studies are the number/position of nuclei and protein distribution within the germline. Here, we present a method to perform automated analysis of the germline using confocal microscopy and computational approaches to determine the number and position of nuclei in each region of the germline. Our method also analyzes germline protein distribution that enables the three-dimensional examination of protein expression in different genetic backgrounds. Further, our study shows variations in cytoskeletal architecture in distinct regions of the germline that may accommodate specific spatial developmental requirements. Finally, our method enables automated counting of the sperm in the spermatheca of each germline. Taken together, our method enables rapid and reproducible phenotypic analysis of the C. elegans germline.

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

We present an automated method for three-dimensional reconstruction of the Caenorhabditis elegans germline. Our method determines the number and position of each nucleus within the germline and analyses germline protein distribution and cytoskeletal structure.

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Efficient Differentiation of Human Pluripotent Stem Cells into Liver Cells

The liver detoxifies harmful substances, secretes vital proteins, and executes key metabolic activities, thus sustaining life. Consequently, liver failure&#8212;which can be caused by chronic alcohol intake, hepatitis, acute poisoning, or other insults&#8212;is a severe condition that can culminate in bleeding, jaundice, coma, and eventually death. However, approaches to treat liver failure, as well as studies of liver function and disease, have been stymied in part by the lack of a plentiful supply of human liver cells. To this end, this protocol details the efficient differentiation of human pluripotent stem cells (hPSCs) into hepatocyte-like cells, guided by a developmental roadmap that describes how liver fate is specified across six consecutive differentiation steps. By manipulating developmental signaling pathways to promote liver differentiation and to explicitly suppress the formation of unwanted cell fates, this method efficiently generates populations of human liver bud progenitors and hepatocyte-like cells by days 6 and 18 of PSC differentiation, respectively. This is achieved through the temporally-precise control of developmental signaling pathways, exerted by small molecules and growth factors in a serum-free culture medium. Differentiation in this system occurs in monolayers and yields hepatocyte-like cells that express characteristic hepatocyte enzymes and have the ability to engraft a mouse model of chronic liver failure. The ability to efficiently generate large numbers of human liver cells in vitro has ramifications for treatment of liver failure, for drug screening, and for mechanistic studies of liver disease.

This protocol details a monolayer, serum-free method to efficiently generate hepatocyte-like cells from human pluripotent stem cells (hPSCs) in 18 days. This entails six steps as hPSCs sequentially differentiate into intermediate cell-types such as the primitive streak, definitive endoderm, posterior foregut and liver bud progenitors before forming hepatocyte-like cells.

The liver detoxifies harmful substances, secretes vital proteins, and executes key metabolic activities, thus sustaining life. Consequently, liver ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give rise to multiple cell types, including the myotome (MYO), sclerotome (SCL), dermatome (D), and syndetome (SYN), which in turn develop into skeletal muscle, axial skeleton, dorsal dermis, and axial tendon/ligament, respectively. Therefore, the generation of SMs and their derivatives from human induced pluripotent stem cells (iPSCs) is critical to obtain pluripotent stem cells (PSCs) for application in regenerative medicine and for disease research in the field of orthopedic surgery. Although the induction protocols for MYO and SCL from PSCs have been previously reported by several researchers, no study has yet demonstrated the induction of SYN and D from iPSCs. Therefore, efficient induction of fully competent SMs remains a major challenge. Here, we recapitulate human SM patterning with human iPSCs in vitro by mimicking the signaling environment during chick/mouse SM development, and report on methods of systematic induction of SM derivatives (MYO, SCL, D, and SYN) from human iPSCs under chemically defined conditions through the presomitic mesoderm (PSM) and SM states. Knowledge regarding chick/mouse&#160;SM development was successfully applied to the induction of SMs with human iPSCs. This method could be a novel tool for studying human somitogenesis and patterning without the use of embryos and for cell-based therapy and disease modeling.

We present here a protocol for the differentiation of human induced pluripotent stem cells into each somite derivative (myotome, sclerotome, dermatome, and syndetome) in chemically defined conditions, which has applications in future disease modeling and cell-based therapies in orthopedic surgery.

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

A Static Self-Directed Method for Generating Brain Organoids from Human Embryonic Stem Cells

Human brain organoids differentiated from embryonic stem cells offer the unique opportunity to study complicated interactions of multiple cell types in a three-dimensional system. Here we present a relatively straightforward and inexpensive method that yields brain organoids. In this protocol human pluripotent stem cells are broken into small clusters instead of single cells and grown in basic media without a heterologous basement membrane matrix or exogenous growth factors, allowing the intrinsic developmental cues to shape the organoid&#39;s growth. This simple system produces a diversity of brain cell types including glial and microglial cells, stem cells, and neurons of the forebrain, midbrain, and hindbrain. Organoids generated from this protocol also display hallmarks of appropriate temporal and spatial organization demonstrated by brightfield images, histology, immunofluorescence and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR). Because these organoids contain cell types from various parts of the brain, they can be utilized for studying a multitude of diseases. For example, in a recent paper we demonstrated the use of organoids generated from this protocol for studying the effects of hypoxia on the human brain. This approach can be used to investigate an array of otherwise difficult to study conditions such as neurodevelopmental handicaps, genetic disorders, and neurologic diseases.

This protocol was generated as a means to produce brain organoids in a simplified, low cost manner without exogenous growth factors or basement membrane matrix while still maintaining the diversity of brain cell types and many features of cellular organization.

Human brain organoids differentiated from embryonic stem cells offer the unique opportunity to study complicated interactions of multiple cell types in a ...

Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells

In vitro differentiation of human embryonic stem cells (hESCs) has transformed the ability to study human development on both biological and molecular levels and provided cells for use in regenerative applications. Standard approaches for hESC culture using colony type culture to maintain undifferentiated hESCs and embryoid body (EB) and rosette formation for differentiation into different germ layers are inefficient and time-consuming. Presented here is a single-cell culture method using hESCs instead of a colony-type culture. This method allows maintenance of the characteristic features of undifferentiated hESCs, including expression of hESC markers at levels comparable to colony type hESCs. In addition, the protocol presents an efficient method for neural progenitor cell (NPC) generation from single-cell type hESCs that produces NPCs within 1 week. These cells highly express several NPC marker genes and can differentiate into various neural cell types, including dopaminergic neurons and astrocytes. This single-cell culture system for hESCs will be useful in investigating the molecular mechanisms of these processes, studies of certain diseases, and drug discovery screens.

Presented here is a protocol for the generation of a single-cell culture of human embryonic stem cells and their subsequent differentiation into neural progenitor cells. The protocol is simple, robust, scalable, and suitable for drug screening and regenerative medicine applications.

In vitro differentiation of human embryonic stem cells (hESCs) has transformed the ability to study human development on both biological and molecular ...