We are grateful to the technical support from Ms. Hong Xian Hsing, Mr. Min Jeng Li, and Mr. Eric C. P. Wu. We express our appreciation to Miranda Loney for English editing.

1. Fixation and Embedding
<ol>
	<li>Reagent preparation
	<ol>
		<li>10x Phosphate-buffered saline (PBS)
		<ol>
			<li>Add 80 g NaCl, 2 g KCl, 14.4 g Na2HPO4, and 2.4 g KH2PO4 in 800 ml double distilled water (ddH2O) and adjust the pH to 7.4 with HCl. Add ddH2O to a total volume of 1 L, then add 1,000 &#181;l diethyl pyrocarbonate (DEPC) and shake vigorously. Store PBS overnight at room temperature and autoclave at 121 &#176;C for 20 min the following day.</li>
		</ol>
		</li>
		<li>1x PBS
		<ol>
			<li>Dilute the stock 10x PBS at 1:10 ratio in ddH2O to obtain a final concentration of 0.01 M Na2HPO4, 0.002 M KH2PO4, 0.003 M KCl, and 0.13 M NaCl.</li>
		</ol>
		</li>
		<li>Paraformaldehyde (PFA) fixative 
		Caution: Paraformaldehyde is toxic. Prepare it under a fume hood. Wear gloves.
		<ol>
			<li>To prepare 250 ml PFA fixative, heat 100 ml 1x PBS to 70 - 80 &#176;C and add 1,750 &#181;l of NaOH. Then add 10 g of paraformaldehyde and mix thoroughly until dissolved. Place the solution on ice and then adjust the pH to 7.2 with H2SO4 (260 - 270 &#181;l for 100 ml) after cooling.</li>
			<li>Adjust the volume to 250 ml with 1x PBS, add 625 &#181;l glutaraldehyde to a final concentration of 0.25%. Add 250 &#181;l Triton X-100 and 250 &#181;l Tween 20 to facilitate the infiltration of the fixative. 
			NOTE: The PFA fixative can be stored at 4 &#176;C for one month without losing its fixation ability.</li>
		</ol>
		</li>
		<li>Prepare different concentrations of ethanol (30%, 50%, 70%, 85%, and 95%) with DEPC-treated water.</li>
	</ol>
	</li>
	<li>Plant sample collection
	<ol>
		<li>Axillary buds
		<ol>
			<li>Use mature Phalaenopsis orchid plants at the four-leaf stage. Carefully remove leaves by tearing the leaf following the midrib using hands.</li>
			<li>Use a sharp scalpel to carefully remove axillary buds from the base of the third or fourth leaf on the monopodial stem.</li>
		</ol>
		</li>
		<li>Seed sample
		<ol>
			<li>Harvest mature orchid seed pods at 4 months after pollination. Cut seed pods longitudinally with a scalpel. Shake the opening seed pod gently and release the dry seeds on filter paper.</li>
		</ol>
		</li>
		<li>Protocorm
		<ol>
			<li>Sow mature orchid seeds on a 1/2x Murashige and Skoog agar plate, and grow in a tissue culture room in a 12 hr light period and constant temperature of 25 &#176;C. Sample green protocorm at 7 weeks after sowing.</li>
		</ol>
		</li>
		<li>Protocorm-like bodies (PLBs)
		<ol>
			<li>Grow orchid PLBs on T2 regenerating agar plates as described previously 10 and place under the same growth conditions as in the step 1.2.3.1. Collect 10 PLBs at a height of 5 - 8 mm.</li>
		</ol>
		</li>
		<li>Leaf sample
		<ol>
			<li>Collect leaf tissue from a mature Phalaenopsis orchid plant as described in step 1.2.1.1.</li>
			<li>Use a sharp scalpel to cut a small piece of leaf tissue (7 mm length x 5 mm width) from the second newly developed leaf.</li>
		</ol>
		</li>
		<li>Root sample
		<ol>
			<li>Using the same plant described in the step 1.2.1.1, dissect 1 cm length of root tip tissue using a sharp scalpel.</li>
		</ol>
		</li>
		<li>Young spike
		<ol>
			<li>Use a sharp scalpel to cut young spike tissue from the tip portion of the flower stalk 10 cm in length.</li>
		</ol>
		</li>
		<li>Flower bud
		<ol>
			<li>Excise a small flower bud of 5 mm in diameter from orchid flower stalk. Cut part of the flower bud tissue longitudinally (3 mm in thickness).</li>
		</ol>
		</li>
		<li>Leaf tissues and spikelet tissues of cereal crops
		<ol>
			<li>Cut 1 cm length leaf blade tissue from the first newly developed leaves from rice, wheat and maize plants.</li>
			<li>Collect 10 spikelets from plants (rice, wheat and maize) one day before anthesis.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Fixation
	<ol>
		<li>Fix plant samples immediately by transferring them into a glass scintillation vial containing 15 ml ice-cold PFA fixative.</li>
		<li>Apply a vacuum (~ 720 mm Hg) to plant samples in a 4 &#176;C cool room. Hold the vacuum for 15 - 20 min (small bubbles should be released from the samples). Repeat this step until most of the tissues sink after release of vacuum. Hold the vacuum overnight and release the vacuum slowly the next day.</li>
	</ol>
	</li>
	<li>Dehydration 
	NOTE: Use the same vial from the fixation through the infiltration steps. Pour or use a pipette to drain off the solution in the previous step and replace with 15 ml of new solution into the vial. Depending on the texture of tissues, treat harder tissues such as orchid axillary bud, seed, protocorm, and PLB, and the spikelet of rice, wheat, and maize for a longer time; treat softer tissues such as orchid flower bud, young spike, leaf and root, and the leaf of rice, wheat, and maize for a shorter time.
	<ol>
		<li>After fixation, immerse the sample in 15 ml 1x PBS for 10 min on ice.
		<ol>
			<li>Dehydrate samples in 15 ml ethanol series at room temperature as follows: 30% ethanol for 30 min, 50% ethanol for 30 min, 70% ethanol for 1 hr, 85% ethanol for 54 min for harder tissues and 30 min for softer tissues, 95% ethanol for 54 min for harder tissues and 30 min for softer tissues, and 100% ethanol twice for 54 min for harder tissues and 30 min for softer tissues. 
			NOTE: Plant samples can be stored in 70% ethanol at 4 &#176;C for several months.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Paraffin infiltration
	<ol>
		<li>Infiltrate samples with 15 ml ethanol and xylene substitute mixture for 54 min each for harder tissues and 30 min for softer tissues, at room temperature as follows: ethanol/xylene substitute (2:1, v/v), ethanol/xylene substitute (1:1, v/v), ethanol/xylene substitute (1:2, v/v), and pure xylene substitute twice. Caution: Xylene is toxic. Do this step in fume hood.</li>
		<li>Infiltrate sample in the vial with 15 ml xylene substitute and paraffin mixture in an oven at 60 &#176;C, overnight for harder tissues, and for 60 min for softer tissues as follows: xylene substitute/paraffin (2:1, v/v), xylene substitute/paraffin (1:1, v/v), and xylene substitute/paraffin (1:2, v/v).</li>
		<li>Infiltrate sample with 15 ml pure paraffin twice a day and incubate at 60 &#176;C in an oven.</li>
		<li>Repeat step 1.5.3 the next day.</li>
	</ol>
	</li>
	<li>Tissue embedding
	<ol>
		<li>Switch on the power of the tissue embedding center 1 hr in advance to melt the wax in the paraffin reservoir before embedding tissues in a paraffin block.</li>
		<li>Warm up the metal molds (size of base 3.3 cm length x 2 cm width) on the warming tray at 62 &#176;C, and pour approximately 13 ml of molten wax into the mold base.</li>
		<li>Transfer one tissue sample from section 1.5.4 into the mold with warmed forceps and orient it into the desired position.</li>
		<li>Move the mold onto the cool plate carefully, and leave until the wax is solidified.</li>
	</ol>
	</li>
</ol>
2. Tissue Sectioning
<ol>
	<li>Paraffin sectioning method
	<ol>
		<li>Make a wax base by placing an embedding cassette on the top of a mold (same size in the section 1.6.2), fill with molten wax and remove the mold after the wax is solidified. 
		NOTE: The embedding cassette will form a wax base to anchor the sample paraffin block.</li>
		<li>Trim the paraffin block into an appropriate shape and size, and place some wax pieces on a flat spatula. Heat the wax pieces using an alcohol burner until the wax melts and then place the molten wax on the wax base in section 2.1.1 to adhere the block. Clamp it in the microtome.</li>
		<li>Place a new blade onto the microtome, and adjust the angle to 5 degrees to facilitate the sectioning in the microtome.</li>
		<li>Cut the sample paraffin block into thin slices (10 &#181;m), as described previously 11.</li>
	</ol>
	</li>
	<li>Hybrid-Cut sectioning method
	<ol>
		<li>Trim the sample paraffin block from step 1.6.4 to a column with a trapezoid surface at the top to an appropriate size using a razor blade.</li>
		<li>Add some Optimal Cutting Temperature compound (OCT) to the center of the cryostat stage. Attach the paraffin block to the cryostat stage and then quickly orient the tissue block into the desired position.</li>
		<li>Transfer the paraffin block/stage to a cryostat chamber. Allow OCT to solidify on quick freeze bar at -42 &#176;C for 10 min. Do not move the block during solidification of OCT (Figure 2C).</li>
		<li>Allow the cryostat adaptor and chamber temperature to cool down to -20 &#176;C and -16 &#176;C respectively before attaching the paraffin block/stage to the cryostat adaptor. Section tissues to 10 &#181;m in thickness.</li>
		<li>Pick tissue sections with forceps. Float the sections on 800 &#181;l DEPC-treated water in a Poly-L-lysine coated slide and transfer the slides onto a hot plate at 42 &#176;C.</li>
		<li>Allow the sections to flatten on DEPC-treated water at 42 &#176;C. Use filter paper to drain off the water from the edge.</li>
		<li>Mount tissue on the slide by placing the slide on a 42 &#176;C hot plate overnight.</li>
	</ol>
	</li>
</ol>
3. Tissue Staining
<ol>
	<li>Deparaffinization
	<ol>
		<li>Collect the slides from the hot plate and place them in a staining rack. Add 150 ml xylene into a staining jar in fume hood and immerse the rack in xylene for 5 min.</li>
	</ol>
	</li>
	<li>Rehydration
	<ol>
		<li>Prepare different concentrations of ethanol solutions (100%, 95%, 70%, 50%, and 30%) in DEPC-treated water and fill 150 ml of solution into distinct staining jars, respectively.</li>
		<li>Rehydrate the samples through a series of decreasing ethanol concentration, each step for 3 min at room temperature. Transfer the slides in the staining rack one jar to another jar containing different ethanol concentrations: 100% Ethanol, 95% Ethanol, 70% Ethanol, 50% Ethanol, and 30% Ethanol.</li>
		<li>After rehydration, immerse the specimens in ddH2O for 3 min.</li>
	</ol>
	</li>
	<li>Hematoxylin staining
	<ol>
		<li>Stain tissue samples by immersing tissue slides in hematoxylin solution for 1.5 min.</li>
		<li>Rinse briefly in ddH2O containing 1 - 2 drops of 12 N hydrochloric acid (HCl) for a few seconds, and then wash briefly in ddH2O.</li>
	</ol>
	</li>
	<li>Dehydration
	<ol>
		<li>Dehydrate the samples through a series of increasing ethanol concentrations for 3 min at room temperature: 30% Ethanol, 50% Ethanol, 70% Ethanol, 95% Ethanol, and 100% Ethanol. Clear the specimens with xylene in the fume hood for 5 min.</li>
	</ol>
	</li>
	<li>Mounting
	<ol>
		<li>Drop appropriately 600 &#956;l of xylene-based mounting medium onto slide. Carefully place a coverslip over the specimen. Avoid air bubbles forming to get good quality images.</li>
		<li>Allow the slides to air dry overnight. Observe the specimen under a microscope the next day. 
		Note: Images were captured at 25X to 400X magnification depending on the size of specimens.</li>
	</ol>
	</li>
</ol>
4. In Situ Hybridization
<ol>
	<li>Probe synthesis
	<ol>
		<li>Clone Phalaenopsis aphrodite Actin gene specific coding sequence using primers 5&#39;-GGCAGAGTATGATGAATCTGGTCC-3&#39; and 5&#39;- AGGACAGAAGTTCGGCTGGC -3&#39; (to get 242 bp PCR amplicon) and CyclinB1;1 gene specific coding sequence using primers 5&#39;-TCGTAGCAAGGTTGCTTGTG-3&#39; and 5&#39;- ATGAGCATGGCGCTAATACC-3&#39; (to get 327 bp PCR amplicon) as described 12.</li>
		<li>Ligate the specific coding sequences into vectors (e.g., pGEMT) according to the manufacturer&#39;s protocol.</li>
		<li>Generate digoxigenin (DIG) labeled sense and antisense probes using SP6/T7 DIG RNA labeling kit according to manufacturer&#39;s instructions.</li>
	</ol>
	</li>
	<li>In situ hybridization
	<ol>
		<li>Cut the 2nd and 3rd axillary bud tissue slices (10 &#181;m thickness) generated using the Hybrid-Cut method, and mount slices onto coated slide.</li>
		<li>Deparaffinize tissue sections in xylene (see 3.1.1), rehydrate in decreasing concentrations of ethanol (see 3.2.2), and digest with 2 mg/ml proteinase K at 37 &#176;C for 30 min.</li>
		<li>Perform in situ hybridization according to the protocol previously described 11,13 with some modifications, i.e., with hybridization temperature for Actin as 59 &#176;C and 60 &#176;C for CyclinB1;1. Hybridize slide with 40 ng DIG-labeled RNA probe.</li>
		<li>Use nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) solution to detect hybridization signals as described 11.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Fischer, A. H., Jacobson, K. A., Rose, J., Zeller, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryosectioning+tissues.">Cryosectioning tissues.</a> Cold Spring Harb Protoc. 3, 1-2 (2008).</li><li>Knox, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Freeze-sectioning+of+plant+tissues.">Freeze-sectioning of plant tissues.</a> Stain Technol. 45, 265-272 (1970).</li><li>Ruan, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+cryosection+method+for+polyethylene+glycol+hydrogels+used+in+tissue+engineering.">An improved cryosection method for polyethylene glycol hydrogels used in tissue engineering.</a> Tissue Eng.: Part C Methods. 19, 794-801 (2013).</li><li>Prychid, C. J., Rudall, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+oxalate+crystals+in+monocotyledons:+A+review+of+their+structure+and+systematics.">Calcium oxalate crystals in monocotyledons: A review of their structure and systematics.</a> Ann Bot. 84, 725-739 (1999).</li><li>Prychid, C. J., Rudall, P. J., Gregory, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematics+and+biology+of+silica+bodies+in+monocotyledons.">Systematics and biology of silica bodies in monocotyledons.</a> Bot. Rev. 69 (4), 377-440 (2004).</li><li>Arnott, H. J., Pautard, F. G. E., Steinfink, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+of+calcium+oxalate+monohydrate.">Structure of calcium oxalate monohydrate.</a> Nature. 208, 1197-1198 (1965).</li><li>Mitani, N., Yamaji, N., Ma, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+maize+silicon+influx+transporters.">Identification of maize silicon influx transporters.</a> Plant Cell Physiol. 50, 5-12 (2009).</li><li>Hayasaka, T., Fujii, H., Ishiguro, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+silicon+in+preventing+appressorial+penetration+by+the+rice+blast+fungus.">The role of silicon in preventing appressorial penetration by the rice blast fungus.</a> Phytopathology. 98, 1038-1044 (2008).</li><li>Ma, J. F., Yamaji, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silicon+uptake+and+accumulation+in+higher+plants.">Silicon uptake and accumulation in higher plants.</a> Trends Plant Sci. 11, 392-397 (2006).</li><li>Chen, W., Tang, C., YL, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ploidy+doubling+by+in+vitro+culture+of+excised+protocorms+or+protocorm-like+bodies+in+Phalaenopsis+species.">Ploidy doubling by in vitro culture of excised protocorms or protocorm-like bodies in Phalaenopsis species.</a> Plant Cell Tiss Org. 98, 229-239 (2009).</li><li>Javelle, M., Marco, C. F., Timmermans, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Situ+Hybridization+for+the+Precise+Localization+of+Transcripts+in+Plants.">In Situ Hybridization for the Precise Localization of Transcripts in Plants.</a> J. Vis. Exp. (57), e3328 (2011).</li><li>Park, D. J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+Protocols.">PCR Protocols.</a> Methods in Molecular Biology. 687, (2011).</li><li>Lin, H. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+annotation,+expression+profiling,+and+protein+interaction+studies+of+the+core+cell-cycle+genes+in+Phalaenopsis+aphrodite.">Genome-wide annotation, expression profiling, and protein interaction studies of the core cell-cycle genes in Phalaenopsis aphrodite.</a> Plant Mol Biol. 84, 203-226 (2014).</li><li>Lee, Y. -. I., Yeung, E. C., Lee, N., Chung, M. -. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryology+of+Phalaenopsis+amabilis+var.+formosa:+embryo+development.">Embryology of Phalaenopsis amabilis var. formosa: embryo development.</a> Bot Stud. 49, 139-146 (2008).</li><li>Endo, M., Ikusima, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diurnal+rhythm+and+characteristics+of+photosynthesis+and+respiration+in+the+leaf+and+root+of+a+Phalaenopsis+plant.">Diurnal rhythm and characteristics of photosynthesis and respiration in the leaf and root of a Phalaenopsis plant.</a> Plant Cell Physiol. 30, 43-47 (1989).</li><li>Guo, W. J., Lee, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+leaf+and+plant+age,+and+day/night+temperature+on+net+CO2+uptake+in+Phalaenopsis+amabilis+var.+formosa.">Effect of leaf and plant age, and day/night temperature on net CO2 uptake in Phalaenopsis amabilis var. formosa.</a> J. Amer. Soc. Hort. Sci. 131, 320-326 (2006).</li><li>Lewin, J., Reimann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silicon+and+plant+growth.">Silicon and plant growth.</a> Ann. Rev. of Plant Physiol. 20, 289-304 (1969).</li><li>Kaufman, P. B., Simpson, T. L., Valcani, B. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silica+in+shoots+of+higher+plants.">Silica in shoots of higher plants.</a> Silicon and siliceous structures in biological systems. , 409-449 (1981).</li><li>Lundgren, M. R., Osborne, C. P., Christin, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deconstructing+Kranz+anatomy+to+understand+C4+evolution.">Deconstructing Kranz anatomy to understand C4 evolution.</a> J Exp Bot. 65, 3357-3369 (2014).</li><li>Liu, W. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anatomical+and+transcriptional+dynamics+of+maize+embryonic+leaves+during+seed+germination.">Anatomical and transcriptional dynamics of maize embryonic leaves during seed germination.</a> Proc Natl Acad Sci U S A. 110, 3979-3984 (2013).</li><li>Driscoll, S. P., Prins, A., Olmos, E., Kunert, K. J., Foyer, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specification+of+adaxial+and+abaxial+stomata,+epidermal+structure+and+photosynthesis+to+CO2+enrichment+in+maize+leaves.">Specification of adaxial and abaxial stomata, epidermal structure and photosynthesis to CO2 enrichment in maize leaves.</a> J Exp Bot. 57, 381-390 (2006).</li><li>Karlgren, A., Carlsson, J., Gyllenstrand, N., Lagercrantz, U., Sundstr&#246;m, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-radioactive+in+situ+Hybridization+Protocol+Applicable+for+Norway+Spruce+and+a+Range+of+Plant+Species.">Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species.</a> J. Vis. Exp. (26), (2009).</li><li>Hejatko, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization+technique+for+mRNA+detection+in+whole+mount+Arabidopsis+samples.">In situ hybridization technique for mRNA detection in whole mount Arabidopsis samples.</a> Nat Protoc. 1, 1939-1946 (2006).</li><li>Javelle, M., Timmermans, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+localization+of+small+RNAs+in+plants+by+using+LNA+probes.">In situ localization of small RNAs in plants by using LNA probes.</a> Nat Protoc. 7, 533-541 (2012).</li><li>Drea, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+analysis+of+gene+expression+in+plants.">In situ analysis of gene expression in plants.</a> Methods Mol Biol. 513, 229-242 (2009).</li><li>Drea, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+method+for+systematic,+high+resolution+in+situ+analysis+of+mRNA+distribution+in+plants.">A streamlined method for systematic, high resolution in situ analysis of mRNA distribution in plants.</a> Plant Methods. 1, 8 (2005).</li></ol>

No conflicts of interest declared.

Plant cells have rigid cell walls, tough fibers, crystals, and high water content that cause tissue tearing problems during plant tissue sectioning. Even though paraffin-based sectioning is frequently used for plant tissues, the endogenous crystals often lacerate the plant tissue during sectioning (Figure 1). Because of the inherently high water content within the plant cells, cryostat-based sectioning often causes broken cells and cracked tissue sections.
In the present study, a combined paraffin-embedding and cryosection protocol named Hybrid-Cut was developed and good quality tissue sections were obtained. This protocol resolves the problem associated with high water content by introducing paraffin embedding, and reduces the tearing effect by hardening paraffin wax under low temperature during sectioning (Figure 3). Therefore, this modified protocol is advantageous over either paraffin-based sectioning or cryosectioning for preserving plant tissue integrity.
This manuscript demonstrates that the Hybrid-Cut method preserves tissue integrity in many tissues of Phalaenopsis orchid such as axillary bud, seed, and PLB, etc. that contain high levels of crystals (Figures 3-4). Moreover, this protocol is amenable to cereal crops such as reproductive organs and leaves of rice, maize, and wheat that contain high silica (Figures 5-6). Presumably, this protocol may be applied to woody plants containing high fiber.
In general, fixing tissue thoroughly is very important for Hybrid-Cut. We found that formaldehyde-alcohol-acidic acid (FAA) fixative is better than PFA to preserve the tissue integrity of some recalcitrant tissues such as axially buds, roots, etc. However, PFA works better than FAA in preserving the RNA integrity. Therefore PFA is recommended to fix sample for in situ hybridization (ISH) work. The protocol described here is designed for RNA ISH experiment. Therefore, all reagents were prepared to avoid RNA degradation by eliminating RNase contamination by DEPC treatment. If Hybrid-Cut section is for anatomical studies, regular reverse osmosis (RO) water and its derived buffer or reagents are acceptable.
Reducing specimen size and thickness to less than 3 mm is helpful for infiltration. Moreover, increasing immersion time for dehydration and infiltration are necessary for hard texture tissues. Limitation of this protocol might due to problems caused by inadequate fixation, dehydration, and infiltration of specimen. Therefore, adjustment of processing time for each step is critical to produce good quality paraffin block. Normally, harder tissue needs longer processing time than softer tissue.
In addition, we showed that Hybrid-Cut worked successfully in combination with ISH to provide spatial distribution of the selected transcripts (Figure 7). In summary, this protocol is useful for the study of plant anatomy and provides a tissue-specific RNA map of the selected genes. In addition it may be applied to other molecular studies such as terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay, fluorescence in situ hybridization (FISH), and immunostaining techniques. In conclusion, this improved tissue sectioning protocol is both useful and helpful for researchers in plant communities.

The paraffin-based sectioning method is a widely-used technique for anatomical studies. Preservation of intact tissue anatomy is important for morphological and biological studies. The paraffin-embedded sectioning technique is advantageous because paraffin-embedding retains cell and tissue morphology. In addition, paraffin blocks can be stored conveniently for long periods of time. However, paraffin-embedded sectioning is not suitable for plant tissues containing intracellular crystals. Crystals within the cells often tear paraffin ribbons and damage tissue integrity during sectioning.
Unlike paraffin sectioning, cryosectioning is relatively fast and sections can be obtained without fixation, serial dehydration or embedding medium infiltration 1. Cryosections are compatible with many applications such as immunohistochemistry, in-situ hybridization, and enzyme histochemistry. The other advantage of cryosectioning is that this method does not go through a potential denaturation processes such as high temperature and chemical treatments, so cellular molecules are well preserved within the tissue sections 2. Cryosectioning is generally preferred over paraffin-based sectioning for studies in animal tissues. However, cryosectioning is not the first choice in plants because freezing temperature sometimes causes formation of ice crystals that affect the quality of section integrity. Although osmoregulation such as sucrose solutions, polyethylene glycol (PEG), or glycerol 3 have been reported to reduce crystal ice formation under freezing conditions, the improvement is less than optimal.
To adapt to different environments, different plants often have distinct tissue texture and plant cells have evolved to form rigid cell walls, tough fibers, and crystals 4,5. For example, insoluble calcium oxalate crystals and silica bodies are fairly common in plants 6. Silicate bodies/crystals have been reported to help maintain plant architecture, erectness, and prevent disease or pest in cereal plants 7-9.
The potted orchids and cut-flower orchid market is flourishing and it is a growing industry. Phalaenopsis aphrodite (moth orchid) is one of the most important export ornamental plants in Taiwan. Significant efforts have been made to understand the morphological and physiological changes of the flowering processes in Phalaenopsis orchids. Floral spikes of Phalaenopsis orchids are initiated from axillary buds at the leaf base. After a period of cool ambient temperature (approximately one and half months), axillary buds enlarge, break dormancy, and protrude from the leaf base to develop into young floral spikes. To understand the physiological, cellular, and molecular processes of spike initiation, it is essential to develop a robust anatomical technique to visualize tissues or markers in a timely manner. However, the presence of ubiquitous crystals in orchid tissues, particularly in axillary buds, makes anatomical work difficult.
Here we sought to improve section integrity of recalcitrant plant tissues that have been hitherto regarded as technically challenging. Here we show an improved protocol named Hybrid-Cut. It is a paraffin-based sectioning method that is performed using a cryostat. Paraffin embedding resolves high water content in plant tissue. Sectioning under low temperature hardens the paraffin block, reduces crystal tearing problem, and improves tissue integrity significantly. This protocol significantly improves tissue integrity for recalcitrant plant samples.

<table border="0" cellpadding="0" cellspacing="0" width="734">
	<tbody>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Embedding Center model EC780-1</td>
			<td style="width:127px;">CSA</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Microtome model RM2255</td>
			<td style="width:127px;">Leica</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Cryostat model CM 1950</td>
			<td style="width:127px;">Leica</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Axio Scope A1 microscope&#160;</td>
			<td style="width:127px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Murashige &#38; Skoog medium including vitamins</td>
			<td style="width:127px;">Duchefa Biochemia</td>
			<td style="width:119px;">M0222.0050</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">RNase free surface decontaminant</td>
			<td style="width:127px;">Apex</td>
			<td style="width:119px;">10-228</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Diethyl pyrocarbonate (DEPC)</td>
			<td style="width:127px;">Bio Basic Inc.&#160;</td>
			<td style="width:119px;">D801154</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Sodium chloride (NaCl)</td>
			<td style="width:127px;">MDBio, Inc.</td>
			<td style="width:119px;">101-7647-14-5</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:321px;">Potassium chloride, crystal (KCl)</td>
			<td style="width:127px;">J.T. Baker</td>
			<td style="width:119px;">7447-40-7</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:321px;">Sodium phosphate dibasic (NA2HPO4)</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">7558-79-4</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:321px;">Potassium phosphate monobasic (KH2PO4)</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">7778-77-0</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Paraformaldehyde (PFA)</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">16005</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Sodium hydroxide (NaOH)</td>
			<td style="width:127px;">Showa</td>
			<td style="width:119px;">19430160</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:321px;">Sulfuric acid (H2SO4)</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">7664-93-9</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Glutaraldehyde solution</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">111-30-8</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Polyoxyethylene 20 sorbitan monolaurate (Tween 20)</td>
			<td style="width:127px;">J.T. Baker</td>
			<td style="width:119px;">9005-64-5</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Octyl Phenol Ethoxylate (Triton X100)</td>
			<td style="width:127px;">J.T. Baker</td>
			<td style="width:119px;">9002-93-1</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Glass scintillation vials</td>
			<td style="width:127px;">Newastar</td>
			<td style="width:119px;">DG60805-00020</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:321px;">Desiccator vacuum</td>
			<td style="width:127px;">Violet Bioscience Inc.</td>
			<td style="width:119px;">TS-402030</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Rotary vane pump RZ2.5</td>
			<td style="width:127px;">Vacuubrand</td>
			<td style="width:119px;">36149406</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Ethanol</td>
			<td style="width:127px;">J.T. Baker</td>
			<td style="width:119px;">64-17-5</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Sub-X&#160;</td>
			<td style="width:127px;">Leica Surgipath</td>
			<td style="width:119px;">3803670</td>
			<td style="width:167px;">Xylene substitute</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Paraplast Plus&#160;</td>
			<td style="width:127px;">Leica Surgipath</td>
			<td style="width:119px;">39602004</td>
			<td style="width:167px;">Tissue embedding paraffin</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">SUPERFROST micro slide glass</td>
			<td style="width:127px;">Matsunami</td>
			<td style="width:119px;">S7441</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:321px;">FSC 22 Clear&#160;</td>
			<td style="width:127px;">Leica Surgipath</td>
			<td style="width:119px;">3801480</td>
			<td style="width:167px;">Optimal Cutting Temperature compound (OCT)&#160;</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Xylenes, Purified</td>
			<td style="width:127px;">Leica Surgipath</td>
			<td style="width:119px;">3803665</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Hematoxylin</td>
			<td style="width:127px;">Merck</td>
			<td style="width:119px;">HX305311</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Hydrochloric acid (HCl)</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">7647-01-0</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Micromount</td>
			<td style="width:127px;">Leica Surgipath</td>
			<td style="width:119px;">3801731</td>
			<td style="width:167px;">Mounting medium</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">pGEM T-easy vector</td>
			<td style="width:127px;">Promega</td>
			<td style="width:119px;">A1360</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Proteinase K</td>
			<td style="width:127px;">Roche</td>
			<td style="width:119px;">3115879001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">SP6/T7 DIG RNA Labeling Kit</td>
			<td style="width:127px;">Roche</td>
			<td style="width:119px;">11175025910</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">NBT/BCIP stock solution</td>
			<td style="width:127px;">Roche</td>
			<td style="width:119px;">11681451001</td>
			<td style="width:167px;"></td>
		</tr>
	</tbody>
</table>

hybrid-cut: an improved sectioning method for recalcitrant plant tissue samples

Maintaining plant section integrity is essential for studying detailed anatomical structures at the cellular, tissue, or even organ level. However, some plant cells have rigid cell walls, tough fibers and crystals (calcium oxalate, silica, etc.), and high water content that often disrupt tissue integrity during plant tissue sectioning.
This study establishes a simple Hybrid-Cut tissue sectioning method. This protocol modifies a paraffin-based sectioning technique and improves the integrity of tissue sections from different plants. Plant tissues were embedded in paraffin before sectioning in a cryostat at -16 &#176;C. Sectioning under low temperature hardened the paraffin blocks, reduced tearing and scratching, and improved tissue integrity significantly. This protocol was successfully applied to calcium oxalate-rich Phalaenopsis orchid tissues as well as recalcitrant tissues such as reproductive organs and leaves of rice, maize, and wheat. In addition, the high quality of tissue sections from Hybrid-Cut could be used in combination with in situ hybridization (ISH) to provide spatial expression patterns of genes of interest. In conclusion, this protocol is particularly useful for recalcitrant plant tissue containing high crystal or silica content. Good quality tissue sections enable morphological and other biological studies.

Hybrid-Cut Improves the Integrity of Tissue Sections
Understanding the anatomy of the reproductive floral structure is important for investigating the underlying mechanism of flower initiation in orchids. However, the accumulation of intracellular calcium oxalate crystals in Phalaenopsis orchids makes such studies a challenging task. To circumvent the problems associated with tearing caused by crystals during the sectioning process (Figure 1), we developed a system we named Hybrid-Cut. This protocol combines traditional paraffin embedding and cryosection techniques. We first tested Hybrid-Cut in axillary buds of Phalaenopsis orchid because they are notorious for tissue rigidity and high crystal content. Axillary bud tissue was fixed in 4% PFA (see Protocol, step 1.3). After serial ethanol dehydration and paraffin wax infiltration, the axillary bud was embedded in a paraffin block. The block was trimmed to a suitable size before sectioning (Figure 2A). A small amount of OCT was then applied to the center of the cryostat stage (Figure 2B). The paraffin block was then adhered to the stage via OCT. The stage was incubated in a cryostat for 10 min to allow complete solidification of OCT before sectioning (Figure 2C) and then cryosection was performed in a -16 &#176;C chamber (Figure 2D).
As a comparison, a paraffin block containing an axillary bud of Phalaenopsis orchid was subjected to regular microtome sectioning. As shown in Figure 1A, severe tearing of the paraffin ribbons was observed after microtome sectioning. The tissue integrity and cellular structure was also compromised (Figure 1B). Hybrid-Cut, on the other hand, produced intact tissue sections (Figure 3A) with preserved structural integrity (Figure 3B).
Application of Hybrid-Cut to Various Tissues of P. aphrodite
To further test the amenability of Hybrid-Cut, we tested different tissues of Phalaenopsis orchids. It is often difficult to obtain sections of seeds with good tissue integrity because of the hardened seed coats. Using this protocol, detailed structures of seeds were preserved after sectioning (Figure 4A). As shown in Figure 4A, protein bodies, the common storage products 14, could be clearly identified. Hybrid-Cut also worked successfully and showed the detailed structures of the shoot apical meristem of the one-month old protocorm (the germinated structure from a seed) (Figure 4B) and protocorm-like-bodies (PLBs, Figure 4C). The intracellular crystals were observed in sections of PLB. Phalaenopsis orchids have thick and succulent leaves and they perform Crassulacean acid metabolism (CAM)-type photosynthesis 15. The transverse section of leaf blade showed large mesophyll cells and vascular bundles containing xylem and phloem (Figure 4D). Few stomatal openings were observed on the abaxial leaf surface during the daytime (Figure 4D). In fact, CAM plants evolved to maximize carbon gain but simultaneously minimize water loss by opening their stomates in the night under arid conditions 15,16. The root apical meristem of P. aphrodite is shown in Figure 4E. The root tip cells appeared to contain a significant number of crystals, which were very well preserved after sectioning (Figure 4E). Longitudinal sections of young floral spikes provided information about the architecture of young floral primordials (Figure 4F). Moreover, sepals, petals, labellum, and pollinia could be clearly identified from the longitudinal section of young flower buds that have completed differentiation in this 5 mm flower bud (Figure 4G). Notice that crystals were accumulated in the sepals of young floral buds. In short, this protocol works consistently to maintain tissue integrity and produces intact morphology enabling anatomical and possible cellular studies.
Hybrid-Cut Preserves Tissue Integrity in Cereal Crops
We also tested Hybrid-Cut on cereal crops such as rice, wheat and maize that contain high silica content 17,18. As shown in Figure 5, the tissue integrity of transverse sections of rice, wheat, and maize leaves were significantly improved by the Hybrid-Cut method. Xylem, phloem, mesophyll cells, stomates, and bulliform cells that control rolling of the leaf blade to avoid water loss were clearly identified from sections of rice leaves. The Kranz anatomy, mesophyll cells, and vascular bundles of the maize leaf 19,20 were clearly identified. It was intriguing to find a high density of stomates on both the adaxial and abaxial sides of maize leaves (Figure 5). The ratio of adaxial and abaxial stomata of 0.7 in maize has been reported previously 21. In addition, this protocol also worked successfully to provide the detailed cell morphology of spikelets from rice, wheat, and maize (Figure 6). Spikelets are known to contain abundant silica 9. Normally, that causes difficulty in conducting tissue sectioning.
In Situ Hybridization
Genomic and transcriptomic approaches are commonly used to annotate the functions of genes. Providing spatial distribution of transcripts of the genes of interest in developmental or environmental contexts is important to add new insight into the possible functions of the genes. In-situ hybridization (ISH) has been developed to localize gene expression patterns at the tissue level 11,22-25. In addition, ISH can provide cellular, and in some cases sub-cellular, resolution of mRNA distribution in multicellular organisms 26. During ISH, RNA and tissue integrity is essential to obtain reliable spatial information about the selected transcript. We tested ISH using the Hybrid-Cut protocol. Actin gene (PATC157348) was cloned using primers 5&#39;-GGCAGAGTATGATGAATCTGGTCC-3&#39; and 5&#39;- AGGACAGAAGTTCGGCTGGC -3&#39; to get 242 bp PCR amplicon. Cyclin B1:1 (PATC146999) gene specific coding sequence using primers 5&#39;-TCGTAGCAAGGTTGCTTGTG-3&#39; and 5&#39;- ATGAGCATGGCGCTAATACC-3&#39; to get 327 bp PCR amplicon. After ISH, Actin and Cyclin B1:1 gene expression was monitored in young and mature axillary buds (Figure 7). Both genes were expressed in meristematic cells of 2nd and 3rd axillary buds, with stronger signals detected in 3rd axillary buds. These results demonstrated that Hybrid-Cut retain good anatomy and provide spatial gene expression pattern.
<img alt="Figure 1" src="/files/ftp_upload/54754/54754fig1.jpg" /> 
Figure 1: Traditional Paraffin Section Causes Severe Tearing of Tissue. A paraffin block containing an axillary bud of Phalaenopsis orchid was subjected to regular microtome sectioning. Severe tearing of the paraffin ribbons was observed after traditional microtome sectioning (A). The tissue integrity and cellular structure was also compromised (B). The arrows show the severe tearing of the tissue slice. Arrowhead shows the crystal bodies. Scale bar 100 &#181;m. <a href="http://cloudflare.jove.com/files/ftp_upload/54754/54754fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/54754/54754fig2.jpg" /> 
Figure 2: Hybrid-Cut Sectioning Method. An axillary bud tissue was fixed in PFA and tissues were dehydrated, infiltrated with paraffin wax, and embedded in a paraffin block. The paraffin block was trimmed to an appropriate size (A). Optimal Cutting Temperature compound (OCT) was applied to the center of the cryostat stage (B). The paraffin block was attached to the OCT on the cryostat stage. Under low temperature, the paraffin block was adhered to the cryostat stage via OCT (C). Tissue slices were sectioned in the cryostat chamber at -16 &#176;C (D). Scale bars represent 0.5 cm (A), and 1 cm (B-D). <a href="http://cloudflare.jove.com/files/ftp_upload/54754/54754fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/54754/54754fig3.jpg" /> 
Figure 3: Hybrid-Cut Improves Section Integrity. A paraffin block containing an axillary bud of Phalaenopsis orchid was subjected to Hybrid-Cut sectioning (A) and the Hybrid-Cut method produced sections with excellent tissue integrity (B). The arrowhead shows the endogenous crystal bodies embedded in the axillary bud tissue. Scale bar 100 &#181;m. <a href="http://cloudflare.jove.com/files/ftp_upload/54754/54754fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/54754/54754fig4.jpg" /> 
Figure 4: Application of Hybrid-Cut to Various Tissue Sections of Phalaenopsis orchid. Different orchid tissues were sectioned using the Hybrid-Cut method, such as longitudinal section of orchid seed during the mature stage (A), longitudinal section of protocorm (B), longitudinal section of protocorm-like bodies (PLB) (C), transverse section of leaf blade (D), longitudinal section of root (E), longitudinal section of young flower spike (F), and longitudinal section of young flower buds (G). Tissue sections were stained by hematoxylin. SC, seed coat; PB, protein body; M, meristem; MP, mother PLB; DP, daughter PLB; Ad, adaxial leaf surface; Ab, abaxial leaf surface; St, stomata; MC, mesophyll cell; VB, vascular bundle; RC, root cap; fb, flower bud; Se, sepal; Pe, petal; La, labellum; Po, pollinia; Ro, rostellum; Ca, callus. Arrowheads show crystals. Scale bars represent 20 &#181;m (A-E) and 200 &#181;m (F-G). <a href="http://cloudflare.jove.com/files/ftp_upload/54754/54754fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/54754/54754fig5.jpg" /> 
Figure 5: Hybrid-Cut Preserves Leaf Tissue Integrity in Several Cereal Crops. Comparison of leaf tissue using the traditional paraffin method (left-hand panel) and the Hybrid-Cut technique developed in this study (right-hand panel). Images show leaf transverse sections of rice, wheat, and maize. MC, mesophyll cell; Ph, phloem; St, stomata; BC, bulliform cell. Arrows show the tearing of tissue slice. Arrowheads show silica bodies. The blue dashed circles indicate Kranz anatomy in C4 maize. Scale bars 20 &#181;m. <a href="http://cloudflare.jove.com/files/ftp_upload/54754/54754fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" src="/files/ftp_upload/54754/54754fig6.jpg" /> 
Figure 6: Hybrid-Cut Preserves Spikelet Tissue Integrity in Several Cereal Crops. Comparison of tissue integrity of spikelet sections between traditional paraffin and Hybrid-Cut methods. Arrows show the tearing of tissue slice. Arrowheads indicate silica bodies. Scale bars 20 &#181;m (rice), and 200 &#181;m (wheat and maize). <a href="http://cloudflare.jove.com/files/ftp_upload/54754/54754fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 7" src="/files/ftp_upload/54754/54754fig7.jpg" /> 
Figure 7: In Situ Hybridization of Actin and CyclinB1;1 Expression Patterns in the Axillary Bud of Phalaenopsis orchid. Tissue slices of the 2nd axillary buds and 3rd axillary bud were prepared using the Hybrid-Cut method. A total of 40 ng of Actin and CyclinB1;1 dig-labeled probe were used for hybridization. The sense probe was used as a negative control. Arrows indicate the reproductive meristem of axillary bud. Scale bars 100 &#181;m. <a href="http://cloudflare.jove.com/files/ftp_upload/54754/54754fig7large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples at JoVE.com

Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples

This protocol describes a simple Hybrid-Cut tissue sectioning method that is useful for recalcitrant plant tissues. Good quality tissue sections enable anatomical studies and other biological studies including in situ hybridization (ISH).

Maintaining plant section integrity is essential for studying detailed anatomical structures at the cellular, tissue, or even organ level. However, some ...

hybrid-cut-an-improved-sectioning-method-for-recalcitrant-plant

Nanyang Technological University

Research

JoVE Journal

Biology

18.8K Views.  Academia Sinica. This protocol describes a simple Hybrid-Cut tissue sectioning method that is useful for recalcitrant plant tissues. Good quality tissue sections enable anatomical studies and other biological studies including in situ hybridization (ISH).

Video: Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples

Thin Sectioning of Slice Preparations for Immunohistochemistry

Many investigations in neuroscience, as well as other disciplines, involve studying small, yet macroscopic pieces or sections of tissue that have been preserved, freshly removed, or excised but kept viable, as in slice preparations of brain tissue.  Subsequent microscopic studies of this material can be challenging, as the tissue samples may be difficult to handle.  Demonstrated here is a method for obtaining thin cryostat sections of tissue with a thickness that may range from 0.2-5.0 mm.  We routinely cut 400 micron thick Vibratome brain slices serially into 5-10 micron coronal cryostat sections.  The slices are typically first used for electrophysiology experiments and then require microscopic analysis of the cytoarchitecture of the region from which the recordings were observed.  We have constructed a simple device that allows controlled and reproducible preparation and positioning of the tissue slice.  This device consists of a cylinder 5 cm in length with a diameter of 1.2 cm, which serves as a freezing stage for the slice.  A ring snugly slides over the cylinder providing walls around the slice allowing the tissue to be immersed in freezing compound (e.g., OCT).  This is then quickly frozen with crushed dry ice and the resulting  wafer  can be position easily for cryostat sectioning.  Thin sections can be thaw-mounted onto coated slides to allow further studies to be performed, such as various staining methods, in situ hybridization, or immunohistochemistry, as demonstrated here.

The present method allows reproducible cryostat sectioning of small, difficult-to-manage, tissue pieces, such as biopsies and brain slices. We utilize a simple aluminum freezing stage to facilitate handling of tissue and a standard cryostat to routinely produce 5-10 micron serial sections from 400 micron thick brain slices.

Many investigations in neuroscience, as well as other disciplines, involve studying small, yet macroscopic pieces or sections of tissue that have been ...

Testing Nicotine Tolerance in Aphids Using an Artificial Diet Experiment

Plants may upregulate the production of many different seconday metabolites in response to insect feeding. One of these metabolites, nicotine, is well know to have insecticidal properties. One response of tobacco plants to herbivory, or being gnawed upon by insects, is to increase the production of this neurotoxic alkaloid. Here, we will demonstrate how to set up an experiment to address this question of whether a tobacco-adapted strain of the green peach aphid, Myzus persicae, can tolerate higher levels of nicotine than the a strain of this insect that does not infest tobacco in the field.

In this video and assay is demonstrated that tests the tolerance of nicotine to two types of aphids one that infests tobacco plants in the field and one that does not.

Plants may upregulate the production of many different seconday metabolites in response to insect feeding. One of these metabolites, nicotine, is well ...

Agar-Block Microcosms for Controlled Plant Tissue Decomposition by Aerobic Fungi

The two principal methods for studying fungal biodegradation of lignocellulosic plant tissues were developed for wood preservative testing (soil-block; agar-block). It is well-accepted that soil-block microcosms yield higher decay rates, fewer moisture issues, lower variability among studies, and higher thresholds of preservative toxicity. Soil-block testing is thus the more utilized technique and has been standardized by American Society for Testing and Materials (ASTM) (method D 1413-07). The soil-block design has drawbacks, however, using locally-variable soil sources and in limiting the control of nutrients external (exogenous) to the decaying tissues. These drawbacks have emerged as a problem in applying this method to other, increasingly popular research aims. These modern aims include degrading lignocellulosics for bioenergy research, testing bioremediation of co-metabolized toxics, evaluating oxidative mechanisms, and tracking translocated elements along hyphal networks. Soil-blocks do not lend enough control in these applications. A refined agar-block approach is necessary.
Here, we use the brown rot wood-degrading fungus Serpula lacrymans to degrade wood in agar-block microcosms, using deep Petri dishes with low-calcium agar. We test the role of exogenous gypsum on decay in a time-series, to demonstrate the utility and expected variability. Blocks from a single board rip (longitudinal cut) are conditioned, weighed, autoclaved, and introduced aseptically atop plastic mesh. Fungal inoculations are at each block face, with exogenous gypsum added at interfaces. Harvests are aseptic until the final destructive harvest. These microcosms are designed to avoid block contact with agar or Petri dish walls. Condensation is minimized during plate pours and during incubation. Finally, inoculum/gypsum/wood spacing is minimized but without allowing contact. These less technical aspects of agar-block design are also the most common causes of failure and the key source of variability among studies. Video publication is therefore useful in this case, and we demonstrate low-variability, high-quality results.

This video demonstrates a controlled environment approach to study degradation of lignocellulosic plant tissues by aerobic fungi. The ability to control nutrient sources and moisture is a key advantage of agar-block microcosms, but the approach often yields mixed success. We address critical pitfalls to yield reproducible, low-variability results.

The two principal methods for studying fungal biodegradation of lignocellulosic plant tissues were developed for wood preservative testing (soil-block; ...

Genotyping of Plant and Animal Samples without Prior DNA Purification

The Direct PCR approach facilitates PCR amplification directly from small amounts of unpurified samples, and is demonstrated here for several plant and animal tissues (Figure 1). Direct PCR is based on specially engineered Thermo Scientific Phusion and Phire DNA Polymerases, which include a double-stranded DNA binding domain that gives them unique properties such as high tolerance of inhibitors.
PCR-based target DNA detection has numerous applications in plant research, including plant genotype analysis and verification of transgenes. PCR from plant tissues traditionally involves an initial DNA isolation step, which may require expensive or toxic reagents. The process is time consuming and increases the risk of cross contamination1, 2. Conversely, by using Thermo Scientific Phire Plant Direct PCR Kit the target DNA can be easily detected, without prior DNA extraction. In the model demonstrated here, an example of derived cleaved amplified polymorphic sequence analysis (dCAPS)3,4 is performed directly from Arabidopsis plant leaves. dCAPS genotyping assays can be used to identify single nucleotide polymorphisms (SNPs) by SNP allele-specific restriction endonuclease digestion3. 
Some plant samples tend to be more challenging when using Direct PCR methods as they contain components that interfere with PCR, such as phenolic compounds. In these cases, an additional step to remove the compounds is traditionally required2,5. Here, this problem is overcome by using a quick and easy dilution protocol followed by Direct PCR amplification (Figure 1). Fifteen year-old oak leaves are used as a model for challenging plants as the specimen contains high amounts of phenolic compounds including tannins. 
Gene transfer into mice is broadly used to study the roles of genes in development, physiology and human disease. The use of these animals requires screening for the presence of the transgene, usually with PCR. Traditionally, this involves a time consuming DNA isolation step, during which DNA for PCR analysis is purified from ear, tail or toe tissues6,7. However, with the Thermo Scientific Phire Animal Tissue Direct PCR Kit transgenic mice can be genotyped without prior DNA purification. In this protocol transgenic mouse genotyping is achieved directly from mouse ear tissues, as demonstrated here for a challenging example where only one primer set is used for amplification of two fragments differing greatly in size.

The Direct PCR approach presented here facilitates PCR amplification directly from small amounts of unpurified plant and animal tissue.

The Direct PCR approach facilitates PCR amplification directly from small amounts of unpurified samples, and is demonstrated here for several plant and ...

An Improved Method for Accurate and Rapid Measurement of Flight Performance in Drosophila

Drosophila has proven to be a useful model system for analysis of behavior, including flight. The initial flight tester involved dropping flies into an oil-coated graduated cylinder; landing height provided a measure of flight performance by assessing how far flies will fall before producing enough thrust to make contact with the wall of the cylinder. Here we describe an updated version of the flight tester with four major improvements. First, we added a &#34;drop tube&#34; to ensure that all flies enter the flight cylinder at a similar velocity between trials, eliminating variability between users. Second, we replaced the oil coating with removable plastic sheets coated in Tangle-Trap, an adhesive designed to capture live insects. Third, we use a longer cylinder to enable more accurate discrimination of flight ability. Fourth we use a digital camera and imaging software to automate the scoring of flight performance. These improvements allow for the rapid, quantitative assessment of flight behavior, useful for large datasets and large-scale genetic screens.

An Improved Method for Accurate and Rapid Measurement of Flight Performance in Drosophila

Here we describe a method for rapid and accurate measurement of flight performance in Drosophila, enabling high-throughput screening.

Drosophila has proven to be a useful model system for analysis of behavior, including flight. The initial flight tester involved dropping flies into an ...

An Efficient Method for Quantitative, Single-cell Analysis of Chromatin Modification and Nuclear Architecture in Whole-mount Ovules in Arabidopsis

In flowering plants, the somatic-to-reproductive cell fate transition is marked by the specification of spore mother cells (SMCs) in floral organs of the adult plant. The female SMC (megaspore mother cell, MMC) differentiates in the ovule primordium and undergoes meiosis. The selected haploid megaspore then undergoes mitosis to form the multicellular female gametophyte, which will give rise to the gametes, the egg cell and central cell, together with accessory cells. The limited accessibility of the MMC, meiocyte and female gametophyte inside the ovule is technically challenging for cytological and cytogenetic analyses at single cell level. Particularly, direct or indirect immunodetection of cellular or nuclear epitopes is impaired by poor penetration of the reagents inside the plant cell and single-cell imaging is demised by the lack of optical clarity in whole-mount tissues.
Thus, we developed an efficient method to analyze the nuclear organization and chromatin modification at high resolution of single cell in whole-mount embedded Arabidopsis ovules. It is based on dissection and embedding of fixed ovules in a thin layer of acrylamide gel on a microscopic slide. The embedded ovules are subjected to chemical and enzymatic treatments aiming at improving tissue clarity and permeability to the immunostaining reagents. Those treatments preserve cellular and chromatin organization, DNA and protein epitopes. The samples can be used for different downstream cytological analyses, including chromatin immunostaining, fluorescence in situ hybridization (FISH), and DNA staining for heterochromatin analysis. Confocal laser scanning microscopy (CLSM) imaging, with high resolution, followed by 3D reconstruction allows for quantitative measurements at single-cell resolution.

An Efficient Method for Quantitative, Single-cell Analysis of Chromatin Modification and Nuclear Architecture in Whole-mount Ovules in Arabidopsis

We provide here an efficient and reliable protocol for immunostaining, Fluorescence in&#160;situ Hybridization, DNA staining followed by quantitative, high-resolution imaging in whole-mount Arabidopsis thaliana ovules. This method was successfully used to analyze chromatin modifications and nuclear architecture.

In flowering plants, the somatic-to-reproductive cell fate transition is marked by the specification of spore mother cells (SMCs) in floral organs of the ...

Method for Measuring the Activity of Deubiquitinating Enzymes in Cell Lines and Tissue Samples

The ubiquitin-proteasome system has recently been implicated in various pathologies including neurodegenerative diseases and cancer. In light of this, techniques for studying the regulatory mechanism of this system are essential to elucidating the cellular and molecular processes of the aforementioned diseases. The use of hemagglutinin derived ubiquitin probes outlined in this paper serves as a valuable tool for the study of this system. This paper details a method that enables the user to perform assays that give a direct visualization of deubiquitinating enzyme activity. Deubiquitinating enzymes control proteasomal degradation and share functional homology at their active sites, which allows the user to investigate the activity of multiple enzymes in one assay. Lysates are obtained through gentle mechanical cell disruption and incubated with active site directed probes. Functional enzymes are tagged with the probes while inactive enzymes remain unbound. By running this assay, the user obtains information on both the activity and potential expression of multiple deubiquitinating enzymes in a fast and easy manner. The current method is significantly more efficient than using individual antibodies for the predicted one hundred deubiquitinating enzymes in the human cell.

The current protocol details a method for measuring the activity of functionally homologous deubiquitinating enzymes. Specialized probes covalently modify the enzyme and allow for detection. This method holds the potential to identify new therapeutic targets.

The ubiquitin-proteasome system has recently been implicated in various pathologies including neurodegenerative diseases and cancer. In light of this, ...

A Fast Air-dry Dropping Chromosome Preparation Method Suitable for FISH in Plants

Preparation of chromosome spreads is a prerequisite for the successful performance of fluorescence in situ hybridization (FISH). Preparation of high quality plant chromosome spreads is challenging due to the rigid cell wall. One of the approved methods for the preparation of plant chromosomes is a so-called drop preparation, also known as drop-spreading or air-drying technique. Here, we present a protocol for the fast preparation of mitotic chromosome spreads suitable for the FISH detection of single and high copy DNA probes. This method is an improved variant of the air-dry drop method performed under a relative humidity of 50%-55%. This protocol comprises a reduced number of washing steps making its application easy, efficient and reproducible. Obvious benefits of this approach are well-spread, undamaged and numerous metaphase chromosomes serving as a perfect prerequisite for successful FISH analysis. Using this protocol we obtained high-quality chromosome spreads and reproducible FISH results for Hordeum vulgare, H. bulbosum, H. marinum, H. murinum, H. pubiflorum and Secale cereale.

A protocol is described for the preparation of high-quality mitotic plant chromosome spreads by a fast air-dry dropping method suitable for the FISH detection of single and high copy DNA probes.

Preparation of chromosome spreads is a prerequisite for the successful performance of fluorescence in situ hybridization (FISH). Preparation of high ...

Improved Swiss-rolling Technique for Intestinal Tissue Preparation for Immunohistochemical and Immunofluorescent Analyses

Understanding the role of factors that regulate intestinal epithelial homeostasis and response to injury and regeneration is important. The current literature describes several different methodological approaches to obtain images of intestinal tissues for data validation. In this paper, we delineate a common protocol relating to the derivation and processing of mouse intestinal tissues. Proper fixation of intestinal tissues and Swiss-roll techniques that enhance intestinal epithelial morphology are discussed. Postresection processing and reorientation of embedded intestinal tissues are critical in obtaining paraffin-embedded blocks that display intact intestinal structural features after sectioning. The Swiss-rolling technique helps in histological assessment of the complete intestinal or colonic sections examined. An ability to differentiate intestinal structural features can be vital in quantitative measurements of intestinal inflammation and tumorigenesis along the entire length. Finally, paraffin-embedded sections are ideal for robust processing using both immunohistochemical and immunofluorescent detection methods. Nonfluorescent immunohistochemical sections provide a vibrant image of the tissue detailing different cellular structural features but do not provide flexibility for intracellular co-localization experiments. Multiple fluorescent channels can be appropriately utilized with immunofluorescent detection for co-localization experiments, lending support to mechanistic studies.

Accurate identification and location of epithelial cells along the intestinal mucosal lining are essential to define different cell lineages. Proper imaging of intestinal tissues is crucial for identification of protein expression patterns with maximum resolution. This study aims to delineate the optimal methods and conditions for processing mouse intestinal tissues.

Understanding the role of factors that regulate intestinal epithelial homeostasis and response to injury and regeneration is important. The current ...

An Easy Method for Plant Polysome Profiling

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the analysis of translational regulation. The method described here is an easy and economical way for fractionating polysomes from various plant tissues. A sucrose gradient is made without the need for a gradient maker by sequentially freezing each layer. Cytosolic extracts are then prepared in a buffer containing cycloheximide and chloramphenicol to immobilize the cytosolic and chloroplastic ribosomes to mRNA and are loaded onto the sucrose gradient. After centrifugation, six fractions are directly collected from the bottom to the top of the gradient, without piercing the ultracentrifugation tube. During collection, the absorbance at 260 nm is read continuously to generate a polysome profile that gives a snapshot of global translational activity. Fractions are then pooled to prepare three different mRNA populations: the polysomes, mRNAs bound to several ribosomes; the monosomes, mRNAs bound to one ribosome; and mRNAs that are not bound to ribosomes. mRNAs are then extracted. This protocol has been validated for different plants and tissues including Arabidopsis thaliana seedlings and adult plants, Nicotiana benthamiana, Solanum lycopersicum, and Oryza sativa leaves.

This protocol describes an easy method to extract and fractionate transcripts from plant tissues on the basis of the number of bound ribosomes. It allows a global estimate of translation activity and the determination of the translational status of specific mRNAs.

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the ...