We thank C Zhang for fish care. This work was supported by the National Natural Science Foundation of China (31171074, 31371099 and 31571067 to GP) and by the Pujiang Talent Project (09PJ1401900 to GP).

Zebrafish experiments were approved by the Fudan University Institutional Animal Care and Use Committee. Zebrafish were raised and bred according to standard procedures20.
1. Preparations
<ol>
	<li>Cultivate 17 dpf and 25 dpf larval zebrafish
	<ol>
		<li>Transfer 2 male and 2 female adult zebrafish (healthy, 3 to 6 months old, laboratory AB strain) to a crossing tank in the late afternoon before the crossing day. Separate the males and females with a barrier. The next morning, refresh the tank water and remove the barrier to allow them to mate. Collect eggs in 100 mm Petri dishes 1 to 2 h after fertilization.</li>
		<li>Keep about 40 embryos in a 100 mm plate with 40 mL embryo medium (EM) at 28.5 &#176;C during the early development period (4 days) and refresh the EM twice a day. Transfer larvae to 1 L tanks (40 larvae to 300 mL system water) and feed with live rotifers (full supply, twice a day) after 5 dpf. Feed live brine shrimp instead of rotifer diet after 10 dpf. Transfer the fish into re-circulating water system at 14 dpf21.</li>
		<li>Raise larval zebrafish in the re-circulating water system till 17 dpf or 25 dpf. Ensure the light/dark cycle is 14/10 h and pH value of system water is about 7.2. Measure the body length of 17 dpf (5.5 to 6.8 mm) and 25 dpf (8 to 11 mm) larvae22.</li>
	</ol>
	</li>
	<li>Prepare 2% agar plates for the dissection.
	<ol>
		<li>Add 4 g agar to 200 mL sterile water. Heat the mixture in a microwave oven until it turns transparent.</li>
		<li>Cool the agar solution for about 15 min, then pour it into 60 mm diameter Petri dishes (approximately 1/3 volume of the plate). Store the solidified agar plates at 4 &#176;C.</li>
	</ol>
	</li>
</ol>
2. Protocol 1: Dissect the Gonadal Tissue of 17 and 25 dpf Larvae
<ol>
	<li>Add crushed ice into the tank to anesthetize 17 dpf larvae. Transfer the anesthetized larvae to a 100 mm chilled Petri dish with 30 mL cold Ringer&#39;s solution. Keep the fish incubated in the chilled Ringer&#39;s solution for at least 15 min to fully anesthetize the larvae.</li>
	<li>Transfer the larvae to a precooled agar plate with a small plastic spoon. Submerge the entire fish body in 10 mL chilled Ringer&#39;s solution and gently lay it on its side.</li>
	<li>Do the following operations under the vision field of 25X stereo microscope. Clamp the fish trunk with tweezers for stabilization. Rip the abdomen longitudinally from the anus to the heart with another pair of tweezers. Gently remove the skin and muscles on one side of the body to expose the internal organs.</li>
	<li>Remove the mass of organs ventral to the swim bladder carefully. Avoid damaging the gonad attached to the swim bladder.</li>
	<li>Cut off the connection between the swim bladder and anterior body. Pull out the entire swim bladder and gonadal tissue gently. 
	NOTE: In most cases, the gonadal tissue at 17 dpf contains surrounding epithelial tissue and protonephridium. They are not easily separated from each other, but at 25 dpf it can be easily separated. The gonad is also connected to the anus. A junction with left and right gonad connected to each other at the anus will be clearly visible.</li>
	<li>Use tweezers to carefully separate the gonadal tissue from the swim bladder and clean up the surrounding adipose tissues.</li>
	<li>Immediately transfer the isolated gonadal tissue to a prechilled 1.5 mL centrifuge tube containing 200 &#181;L Ringer&#39;s solution. Keep the tube on ice until all gonadal tissues are separated from the larvae.</li>
	<li>Dissect the gonads of 25 dpf larvae as described in steps 2.1 -&#160; 2.7.</li>
</ol>
3. Protocol 2: Analyze Gene Expression of the Isolated Gonadal Tissues
<ol>
	<li>Extract total RNA from the larval gonadal tissues.
	<ol>
		<li>Transfer the isolated gonadal tissues to a new RNase-free 1.5 mL tube and remove Ringer&#39;s solution. Add 100 &#181;L lysis solution. Vortex until the tissues are completely lysed.</li>
		<li>Perform the total RNA extraction procedure according to the manufacturer&#39;s instructions.</li>
		<li>Add 1/10 volume of 10x DNase I buffer and 1 &#181;L of DNase I to the RNA solution and mix gently. Incubate for 20 min at 37 &#176;C.</li>
		<li>Add 1/10 volume DNase inactivation reagent to the RNA solution. Incubate for 10 min at 70 &#176;C. Measure the concentration of the total RNA using a spectrophotometer. Store at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Perform first-strand cDNA synthesis
	<ol>
		<li>Use an oligo(dT)-linker primer to perform first-strand cDNA synthesis following the manufacture&#39;s protocol. Add 1 to 2 &#181;g of RNA to a total reaction volume to 20 &#181;L.</li>
		<li>Incubate the reaction solution for 90 min at 45 &#176;C. Terminate the reaction by heating at 70 &#176;C for 5 min.</li>
		<li>Add 1 &#181;L RNase H to the cDNA solution to remove the residual RNA. Mix gently and centrifuge for 10 s at ~ 13,000 x g. Incubate for 20 min at 37 &#176;C. Add 20 &#181;l nuclease free water. Store at -70 &#176;C.</li>
	</ol>
	</li>
	<li>Perform fluorescent quantitative PCR
	<ol>
		<li>Perform qPCR on a cycler system with a fluorescent dye. Use the following PCR cycling conditions: 35 cycles at 95 &#176;C for 15 s, Tm-5 &#176;C for 15 s, 68 &#176;C for 30 s. Use primer sequences as follows: amh (fwd: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (fwd: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (fwd: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), vasa (fwd: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) and &#946;-actin (fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA)19.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Wilson, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wild+sex+in+zebrafish:+loss+of+the+natural+sex+determinant+in+domesticated+strains.">Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains.</a> Genetics. 198 (3), 1291-1308 (2014).</li><li>Liew, W. C., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+sex:+a+complicated+affair.">Zebrafish sex: a complicated affair.</a> Genomics. 13 (2), 172-187 (2014).</li><li>Orban, L., Sreenivasan, R., Olsson, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+and+winding+roads:+Testis+differentiation+in+zebrafish.">Long and winding roads: Testis differentiation in zebrafish.</a> Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).</li><li>Blaser, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transition+from+non-motile+behaviour+to+directed+migration+during+early+PGC+development+in+zebrafish.">Transition from non-motile behaviour to directed migration during early PGC development in zebrafish.</a> J. Cell Sci. 118, 4027-4038 (2005).</li><li>Wang, X. G., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-M&#252;llerian+hormone+and+11+&#946;-hydroxylase+show+reciprocal+expression+to+that+of+aromatase+in+the+transforming+gonad+of+zebrafish+males.">Anti-M&#252;llerian hormone and 11 &#946;-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males.</a> Dev. Dynam. 236 (5), 1329-1338 (2007).</li><li>Siegfried, K. R., N&#252;sslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+control+of+female+sex+determination+in+zebrafish.">Germ line control of female sex determination in zebrafish.</a> Dev. Biol. 324 (2), 277-287 (2008).</li><li>Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+apoptosis+during+the+transition+from+ovary-like+tissue+to+testes+during+sex+differentiation+of+juvenile+zebrafish.">Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish.</a> J. Exp. Biol. 205 (Pt 6), 711-718 (2002).</li><li>Groh, K. J., Sch&#246;nenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+expression+in+zebrafish+during+gonad+differentiation+by+targeted+proteomics.">Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics.</a> Gen. Comp. Endocr. 193, 210-220 (2013).</li><li>Siegfried, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+search+of+determinants:+gene+expression+during+gonadal+sex+differentiation.">In search of determinants: gene expression during gonadal sex differentiation.</a> J. Fish Biol. 76 (8), 1879-1902 (2010).</li><li>Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microarray+analysis+of+sex-+and+gonad-biased+gene+expression+in+the+zebrafish:+evidence+for+masculinization+of+the+transcriptome.">A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome.</a> BMC Genomics. 10, 579 (2009).</li><li>Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+Cyp19+(P450+aromatase)+genes+on+duplicated+zebrafish+chromosomes+are+expressed+in+ovary+or+brain.">Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain.</a> Mol. Biol. Evol. 18 (4), 542-550 (2001).</li><li>Kishida, M., Callard, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cytochrome+P450+aromatase+isoforms+in+zebrafish+(Danio+rerio)+brain+and+ovary+are+differentially+programmed+and+estrogen+regulated+during+early+development.">Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development.</a> Endocrinology. 142 (2), 740-750 (2001).</li><li>Rodr&#237;guez-Mar&#237;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+expression+pattern+of+zebrafish+anti-M&#252;llerian+hormone+(amh)+relative+to+sox9a,+sox9b,+and+cyp19a1a,+during+gonad+development.">Characterization and expression pattern of zebrafish anti-M&#252;llerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development.</a> Gene Expr.Patterns. 5 (5), 655-667 (2005).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+a+vas::EGFP+transgene+in+primordial+germ+cells+of+the+zebrafish.">Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish.</a> Mech Dev. 116 (1-2), 141-150 (2002).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sexual+dimorphic+expression+pattern+of+a+splice+variant+of+zebrafish+vasa+during+gonadal+development.">Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development.</a> Dev. Biol. 271 (1), 190-197 (2004).</li><li>Tzung, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+depletion+of+primordial+germ+cells+in+zebrafish+promotes+testis+formation.">Early depletion of primordial germ cells in zebrafish promotes testis formation.</a> Stem Cell Reports. 4 (1), 61-73 (2015).</li><li>Hsiao, C., Tsai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+zebrafish+with+fluorescent+germ+cell:+a+useful+tool+to+visualize+germ+cell+proliferation+and+juvenile+hermaphroditism+in+vivo.">Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo.</a> Dev. Biol. 262 (2), 313-323 (2003).</li><li>Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection+of+gonads+from+juvenile+zebrafish.">Laser capture microdissection of gonads from juvenile zebrafish.</a> Reprod Biol Endocrinol. 7, 97 (2009).</li><li>Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=nr0b1+(DAX1)+mutation+in+zebrafish+causes+female-to-male+sex+reversal+through+abnormal+gonadal+proliferation+and+differentiation.">nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.</a> Mol. Cell. Endocrinol. 433, 105-116 (2016).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). , (2000).</li><li>Liew, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polygenic+sex+determination+system+in+zebrafish.">Polygenic sex determination system in zebrafish.</a> PLoS One. 7 (4), e34397 (2012).</li><li>Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normal+table+of+postembryonic+zebrafish+development:+staging+by+externally+visible+anatomy+of+the+living+fish.">Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish.</a> Dev Dyn. 238 (12), 2975-3015 (2009).</li><li>Gupta, T., Mullins, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+Organs+from+the+Adult+Zebrafish.">Dissection of Organs from the Adult Zebrafish.</a> J. Vis Exp. (37), (2010).</li><li>Arnaout, R., Reischauer, S., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recovery+of+Adult+Zebrafish+Hearts+for+High-throughput+Applications.">Recovery of Adult Zebrafish Hearts for High-throughput Applications.</a> J. Vis Exp. (94), (2014).</li><li>Gerlach, G. F., Schrader, L. N., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+Adult+Zebrafish+Kidney.">Dissection of the Adult Zebrafish Kidney.</a> J. Vis Exp. (54), (2011).</li><li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells.">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li><li>Braat, A. K., Speksnijder, J. E., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+development+in+fishes.">Germ line development in fishes.</a> Int. J. Dev. Biol. 43 (7), 745-760 (1999).</li><li>Huang, H. Y., Ketting, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+zebrafish+gonads+for+RNA+isolation.">Isolation of zebrafish gonads for RNA isolation.</a> Methods Mol Biol. 1093, 183-194 (2014).</li></ol>

The authors declare that they have no competing financial interests.

The zebrafish has become a powerful model and is extensively used in development and disease-related research. The methods for isolation of organs in adult zebrafish such as brain, heart, gonad, and kidney, have been well documented23,24,25. Due to the small size and dynamic remodeling of the gonadal tissues in the larval zebrafish, isolation of gonadal tissue is a challenging task. Previous studies used whole dissected trunk ti...

The major female sex determinant in wild zebrafish chromosome 4 is lost or modified in the domesticated zebrafish (i.e. common lab strains)1. Instead, they have a polygenic sex determination system accompanied by environmental factors such as temperature, hypoxia, food availability and population density. The detailed mechanisms of zebrafish sex development are not fully understood. Fundamental questions such as when zebrafish sex determination occurs, what the primary sex determination signal(s) is/are, and which genes regulate the first step of gonad transformation remain to be answered2,3.
In the process of zebrafish sex development, several important stages have been recognized. In the early stage of development, starting from 4 hpf (hours post fertilization) primordial germ-cells (PGCs) undergo specification, migration to genital ridge and proliferation. PGC numbers and reciprocal interactions between germ cells and somatic cells are important for gonad differentiation4. At 13 dpf (days post fertilization), the gonads are in the undifferentiated stage. By 17 dpf, the gonads develop into bi-potential ovaries in both future females and males. The apoptosis-dependent transition from ovary to testis begin at 21 to 25 dpf and may continue for several weeks. By 35 dpf, the sex of the gonad has been determined and sex-specific gamete production is underway in both ovaries and testes5,6,7.
To date, diverse candidate genes and mechanisms of sex determination have been proposed. Proteomics and transcriptomic analysis have isolated many genes with sexually dimorphic expression and these genes have been utilized to study sex differentiation in zebrafish8,9,10. For example, in larval zebrafish, the cyp19a1a gene is specifically expressed in the ovary but not in the testis11,12. In addition, amh gene is weakly expressed in the ovarian follicle granulosa cells, but strongly in testis Sertoli cells13. In contrast, vasa gene is continuously expressed in the germ cells of both female and male zebrafish, making it a suitable gonad marker14,15.
Investigating gonadal gene expression levels is critical to understand the molecular mechanism of sex determination and differentiation especially in the bi-potential ovary stage3,9. However, the small size of larval zebrafish and correspondingly small gonads complicate the isolation of gonadal tissue for further molecular analysis. Previous studies used dissected whole trunk region between the opercula and anal pore16. This preparation, although containing gonads, consists of multiple tissues and organs. Alternatively, transgenic animals with gonad-specific GFP expression such as vasa: EGFP were used for gonadal tissue isolation via fluorescence activated cell sorting (FACS) and laser capture micro-dissection17,18. But their widespread application is limited. Here, we describe a simple procedure to isolate gonadal tissue from larval zebrafish at 17 dpf and 25 dpf. We demonstrate the position of the gonads with respect to other organs and isolate the morphologically intact gonads from the surrounding tissues. We further show the gonad-specific genes such as vasa and cyp19a1a are highly expressed in the isolated gonads compared with the trunk tissue through quantitative PCR (qPCR) analysis. The present protocol allows identification, isolation, RNA purification and amplification of gonadal specific genes from larval zebrafish, thereby enabling subsequent molecular analysis of gonadal tissue19.

<table><tbody><tr><td>Cell culture dish 100 mm</td><td>Corning</td><td>430167</td><td>For embryo incubation</td></tr><tr><td>20x EM</td><td></td><td></td><td>For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl&amp;#183;2H&lt;sub&gt;2&lt;/sub&gt;O; then add 0.41 g KH&lt;sub&gt;2&lt;/sub&gt;PO4, 0.412 g Na&lt;sub&gt;2&lt;/sub&gt;HPO4 anhydrous and 4.9 g MgSO&lt;sub&gt;4&lt;/sub&gt;&amp;#183;7H&lt;sub&gt;2&lt;/sub&gt;O.</td></tr><tr><td>1x EM</td><td></td><td></td><td>Dilute 20x EM in distilled water</td></tr><tr><td>AGAROSE G-10</td><td>Gene</td><td>121985</td><td>For preparing the 2% agar plates</td></tr><tr><td>Trizol Reagent</td><td>Invitrogen</td><td>15596-026</td><td>For RNA isolation</td></tr><tr><td>Meter glass</td><td>Shen Bo</td><td>250 ml</td><td>For preparing the 2% agar plates</td></tr><tr><td>Microwave Oven</td><td>Midea</td><td>M1-211A</td><td>For heating the AGAR</td></tr><tr><td>Tweezer DUMONT#5INOX</td><td>World Precision Instrument</td><td>500341</td><td>For dissection</td></tr><tr><td>Stereomicroscope</td><td>Motic</td><td>SMZ168</td><td>For dissection</td></tr><tr><td>Pure water equipment</td><td>Millipore</td><td></td><td></td></tr><tr><td>Ringer&amp;rsquo;s solution</td><td></td><td></td><td>For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl&lt;sub&gt;2&lt;/sub&gt; and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.</td></tr><tr><td>Transfer pipette</td><td>Samco</td><td>202, 204</td><td></td></tr><tr><td>Metal bath</td><td>QiLinbeier</td><td></td><td>Model GL-150</td></tr><tr><td>Microscope</td><td>Leica&amp;nbsp;</td><td>M205 FA</td><td>For photomicrograph</td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5417R</td><td></td></tr><tr><td>Micro Scale RNA Isolation Kit</td><td>Ambion</td><td>AM1931</td><td>For RNA isolation from gonad tissues</td></tr><tr><td>Dnase I</td><td>Sigma</td><td>AMPD1-1KT</td><td>For DNA digestion in the RNA solution</td></tr><tr><td>RevertAid First Strand cDNA Synthesis Kit</td><td>Thermo Scientific</td><td>#K1631</td><td>For first-strand cDNA synthesis</td></tr><tr><td>Rnase H</td><td>Thermo Scientific</td><td>#EN0202</td><td>For digesting the residual RNA in the cDNA solution.</td></tr><tr><td>SYBR Green Realtime PCR Master Mix</td><td>TOYOBO</td><td>QPK-201</td><td>This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and&amp;nbsp; applicable for intercalation assay with SYBR Green I.</td></tr><tr><td>Spectrophotometer</td><td>Ne Drop</td><td>OD-2000+</td><td>Measuring the concentration of the total RNA</td></tr><tr><td>Mastercycler</td><td>Eppendorf</td><td>AG 22331 Hamburg</td><td>gene expression profiling</td></tr></tbody></table>

dissection of larval zebrafish gonadal tissue

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex determination system, where several genes distributed throughout the genome collectively determine the sex identities of individual fish. Currently, the genes involved in regulating gonad development and how they work remain elusive. Normally, isolating gonadal tissue is the first step to examine the sex developmental processes. Here, we present a procedure to isolate gonadal tissue from 17 dpf (days post fertilization) and 25 dpf zebrafish larvae. The isolated gonadal tissue may be subsequently examined by morphology and gene expression profiling.

Dissections of the gonads were performed on AB strain larval zebrafish. Figure 1 shows typical gonadal tissue of larval zebrafish at 17 dpf and 25 dpf. Firstly, the skin and muscles of one side of the abdomen is cut to expose the internal organs. After removing the mass of internal organs, the swim bladder together with the gonad remain in the trunk. The gonad was attached to the ventral side of swim bladder (arrow in Figure 1B<s...

Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Dissection of Larval Zebrafish Gonadal Tissue

Here, we present a protocol for isolating gonadal tissue of larval zebrafish, which will facilitate investigations of zebrafish sex differentiation and maintenance.

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex ...

dissection-of-larval-zebrafish-gonadal-tissue

Research

JoVE Journal

Developmental Biology

10.2K Views.  Fudan University. Here, we present a protocol for isolating gonadal tissue of larval zebrafish, which will facilitate investigations of zebrafish sex differentiation and maintenance.

Video: Dissection of Larval Zebrafish Gonadal Tissue

Dissection and Lateral Mounting of Zebrafish Embryos: Analysis of Spinal Cord Development

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene knockdown approaches can be utilized to examine the molecular mechanisms underlying nervous system development. Second, large clutches of developmentally synchronized embryos provide large experimental sample sizes. Third, the optical clarity of the zebrafish embryo permits researchers to visualize progenitor, glial, and neuronal populations. Although zebrafish embryos are transparent, specimen thickness can impede effective microscopic visualization. One reason for this is the tandem development of the spinal cord and overlying somite tissue. Another reason is the large yolk ball, which is still present during periods of early neurogenesis. In this article, we demonstrate microdissection and removal of the yolk in fixed embryos, which allows microscopic visualization while preserving surrounding somite tissue. We also demonstrate semipermanent mounting of zebrafish embryos. This permits observation of neurodevelopment in the dorso-ventral and anterior-posterior axes, as it preserves the three-dimensionality of the tissue.

Developmental processes such as proliferation, patterning, differentiation, and axon guidance can be readily modeled in the zebrafish spinal cord. In this article, we describe a mounting procedure for zebrafish embryos, which optimizes visualization of these events.

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene ...

Neuroscience

Dissection of Organs from the Adult Zebrafish

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental analysis of the embryo and larva is extensive and the morphology has been well documented, descriptions of adult zebrafish anatomy and studies of development of the adult structures and organs, together with techniques for working with adults are lacking. The organs of the larva undergo significant changes in their overall structure, morphology, and anatomical location during the larval to adult transition.  Externally, the transparent larva develops its characteristic adult striped pigment pattern and paired pelvic fins, while internally, the organs undergo massive growth and remodeling.  In addition, the bipotential gonad primordium develops into either testis or ovary.  This protocol identifies many of the organs of the adult and demonstrates methods for dissection of the brain, gonads, gastrointestinal system, heart, and kidney of the adult zebrafish. The dissected organs can be used for in situ hybridization, immunohistochemistry, histology, RNA extraction, protein analysis, and other molecular techniques.  This protocol will assist in the broadening of studies in the zebrafish to include the remodeling of larval organs, the morphogenesis of organs specific to the adult and other investigations of the adult organ systems.

This protocol describes a procedure for identifying and dissecting organs from the adult zebrafish.

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental ...

Biology

Spinal Cord Transection in the Larval Zebrafish

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability to reinitiate spinal neurogenesis. However, some anamniotes including the zebrafish Danio rerio exhibit both sensory and functional recovery even after complete transection of the spinal cord. The adult zebrafish is an established model organism for studying regeneration following spinal cord injury, with sensory and motor recovery by 6&#160;weeks post-injury. To take advantage of in vivo analysis of the regenerative process available in the transparent larval zebrafish as well as genetic tools not accessible in the adult, we use the larval zebrafish to study regeneration after spinal cord transection. Here we demonstrate a method for reproducibly and verifiably transecting the larval spinal cord. After transection, our data shows sensory recovery beginning at 2&#160;days post-injury (dpi), with the C-bend movement detectable by 3 dpi and resumption of free swimming by 5 dpi. Thus we propose the larval zebrafish as a companion tool to the adult zebrafish for the study of recovery after spinal cord injury.

After spinal transection, adult zebrafish have functional recovery by six weeks post-injury. To take advantage of larval transparency and faster recovery, we present a method for transecting the larval spinal cord. After transection, we observe sensory recovery beginning at 2&#160;days post-injury, and C-bend movement by 3 days post-injury.

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability ...

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, germ cell development, piRNA biology, and niche formation. Here, we present a dissection technique to live-image the gonad ex vivo during a period when in vivo live-imaging is highly ineffective. This protocol outlines how to transfer embryos to an imaging dish, choose appropriately-staged male embryos, and dissect the gonad from its surrounding tissue while still maintaining its structural integrity. Following dissection, gonads can be imaged using a confocal microscope to visualize dynamic cellular processes. The dissection procedure requires precise timing and dexterity, but we provide insight on how to prevent common mistakes and how to overcome these challenges. To our knowledge this is the first dissection protocol for the Drosophila embryonic gonad, and will permit live-imaging during an otherwise inaccessible window of time. This technique can be combined with pharmacological or cell-type specific transgenic manipulations to study any dynamic processes occurring within or between the&#160;cells in their natural gonadal environment.

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

Here, we provide a dissection protocol required to live-image the late embryonic Drosophila male gonad. This protocol will permit observation of dynamic cellular processes under normal conditions or after transgenic or pharmacological manipulation.

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, ...

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Eye Removal in Living Zebrafish Larvae to Examine Innervation-dependent Growth and Development of the Visual System

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis support continuous growth of the entire visual system, both in the eye and the brain. Coordinated growth between the retinae and the optic tectum ensures accurate retinotopic mapping as new neurons are added in the eyes and brain. To address whether retinal axons provide crucial information for regulating tectal stem and progenitor cell behaviors such as survival, proliferation, and/or differentiation, it is necessary to be able to compare innervated and denervated tectal lobes within the same animal and across animals. 
Surgical removal of one eye from living larval zebrafish followed by observation of the optic tectum achieves this goal. The accompanying video demonstrates how to anesthetize larvae, electrolytically sharpen tungsten needles, and use them to remove one eye. It next shows how to dissect brains from fixed zebrafish larvae. Finally, the video provides an overview of the protocol for immunohistochemistry and a demonstration of how to mount stained embryos in low-melting-point agarose for microscopy.

The article explains how to surgically remove eyes from living zebrafish larvae as the first step toward investigating how retinal input influences optic tectum growth and development. In addition, the article provides information about larval anesthetization, fixation, and brain dissection, followed by immunohistochemistry and confocal imaging.

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis ...

Processing Gut Cells from Zebrafish Larvae for Single-Cell RNA Sequencing

Gut Isolation from Zebrafish Larvae for Single-cell RNA Sequencing

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric neuromuscular disorders, highlighting the importance to understand the molecular mechanisms underlying GI development and dysfunction. In this study, we present a method for gut isolation from zebrafish larvae at 5 days post fertilization to obtain live,&#160;viable cells which can be used for single-cell RNA sequencing (scRNA-seq) analysis. This protocol is based on the manual dissection of the zebrafish intestine, followed by enzymatic dissociation with papain. Subsequently, cells are submitted to fluorescence-activated cell sorting, and viable cells are collected for scRNA-seq. With this method, we were able to successfully identify different intestinal cell types, including epithelial, stromal, blood, muscle, and immune cells, as well as enteric neurons and glia. Therefore, we consider it to be a valuable resource for studying the composition of the GI tract in health and disease, using the zebrafish.

Author Spotlight: Isolating and Analyzing Intestinal Cells of Zebrafish Larvae for Investigating Transcriptomic Aspects of Gastrointestinal Development 

Here, we describe a method for gut isolation from zebrafish larvae at 5 days post fertilization, for single-cell RNA sequencing analysis.

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric ...

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work examining post-embryonic through adult cardiac development has been limited7-10. Examining the changing morphology of the maturing and aging heart are restricted by the lack of techniques available for staging and isolating juvenile and adult hearts. In order to analyze heart development over the fish's lifespan, we dissect zebrafish hearts at numerous stages and photograph them for further analysis11. The morphological features of the heart can easily be quantified and individual hearts can be further analyzed by a host of standard methods. Zebrafish grow at variable rates and maturation correlates better with fish size than age, thus, post-fixation, we photograph and measure fish length as a gauge of fish maturation. This protocol explains two distinct, size dependent dissection techniques for zebrafish, ranging from larvae 3.5mm standard length (SL) with hearts of 100&mu;m ventricle length (VL), to adults, with SL of 30mm and VL 1mm or larger. Larval and adult fish have quite distinct body and organ morphology. Larvae are not only significantly smaller, they have less pigment and each organ is visually very difficult to identify. For this reason, we use distinct dissection techniques.
We used pre-dissection fixation procedures, as we discovered that hearts dissected directly after euthanization have a more variable morphology, with very loose and balloon like atria compared with hearts removed following fixation. The fish fixed prior to dissection, retain in vivo morphology and chamber position (data not shown). In addition, for demonstration purposes, we take advantage of the heart (myocardial) specific GFP transgenic Tg(myl7:GFP)twu34 (12), which allows us to visualize the entire heart and is particularly useful at early stages in development when the cardiac morphology is less distinct from surrounding tissues. Dissection of the heart makes further analysis of the cell and molecular biology underlying heart development and maturation using in situ hybridization, immunohistochemistry, RNA extraction or other analytical methods easier in post-embryonic zebrafish. This protocol will provide a valuable technique for the study of cardiac development maturation and aging.

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

A clear, standardized method for dissection and isolation of the zebrafish heart at multiple developmental stages are described. Annotation and quantification techniques are also discussed.

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work ...

Microgavage of Zebrafish Larvae

The zebrafish has emerged as a powerful model organism for studying intestinal development1-5, physiology6-11, disease12-16, and host-microbe interactions17-25. Experimental approaches for studying intestinal biology often require the in vivo introduction of selected materials into the lumen of the intestine. In the larval zebrafish model, this is typically accomplished by immersing fish in a solution of the selected material, or by injection through the abdominal wall. Using the immersion method, it is difficult to accurately monitor or control the route or timing of material delivery to the intestine. For this reason, immersion exposure can cause unintended toxicity and other effects on extraintestinal tissues, limiting the potential range of material amounts that can be delivered into the intestine. Also, the amount of material ingested during immersion exposure can vary significantly between individual larvae26. Although these problems are not encountered during direct injection through the abdominal wall, proper injection is difficult and causes tissue damage which could influence experimental results. We introduce a method for microgavage of zebrafish larvae. The goal of this method is to provide a safe, effective, and consistent way to deliver material directly to the lumen of the anterior intestine in larval zebrafish with controlled timing. Microgavage utilizes standard embryo microinjection and stereomicroscopy equipment common to most laboratories that perform zebrafish research. Once fish are properly positioned in methylcellulose, gavage can be performed quickly at a rate of approximately 7-10 fish/ min, and post-gavage survival approaches 100% depending on the gavaged material. We also show that microgavage can permit loading of the intestinal lumen with high concentrations of materials that are lethal to fish when exposed by immersion. To demonstrate the utility of this method, we present a fluorescent dextran microgavage assay that can be used to quantify transit from the intestinal lumen to extraintestinal spaces. This test can be used to verify proper execution of the microgavage procedure, and also provides a novel zebrafish assay to examine intestinal epithelial barrier integrity under different experimental conditions (e.g. genetic manipulation, drug treatment, or exposure to environmental factors). Furthermore, we show how gavage can be used to evaluate intestinal motility by gavaging fluorescent microspheres and monitoring their subsequent transit. Microgavage can be applied to deliver diverse materials such as live microorganisms, secreted microbial factors/toxins, pharmacological agents, and physiological probes. With these capabilities, the larval zebrafish microgavage method has the potential to enhance a broad range of research fields using the zebrafish model system.

We present a novel method for microgavage of larval zebrafish utilizing standard embryo microinjection and stereomicroscopy equipment. We demonstrate that microgavage is a safe and efficient technique useful for delivering controlled amounts of diverse materials specifically into the larval zebrafish intestinal lumen.

The zebrafish has emerged as a powerful model organism for studying intestinal development1-5, physiology6-11, disease12-16, and host-microbe ...

Partial Hepatectomy in Adult Zebrafish

Liver failure is one of the leading causes of death worldwide, and mortality from chronic liver disease is rising sharply in the United States. Healthy livers are capable of regenerating from toxic damage, but in advanced liver disease, the natural ability of the liver to regenerate is impaired. Zebrafish have emerged as a powerful experimental system for studying regeneration. They are an ideal model for studying liver regeneration from partial hepatectomy, a procedure with direct clinical relevance in which part of the liver is surgically removed, leaving the rest intact. There is no standard protocol for partial hepatectomy; previous studies using this model have used slightly different protocols and reported disparate results. Described here is an efficient, reproducible protocol for performing a partial hepatectomy in adult zebrafish. We use this technique to demonstrate that zebrafish are capable of epimorphic regeneration of the resected lobe. This protocol can be used to further interrogate the mechanisms required for liver regeneration in zebrafish.

This protocol describes the procedure for removing the ventral lobe of the liver in adult zebrafish to enable the study of liver regeneration.

Liver failure is one of the leading causes of death worldwide, and mortality from chronic liver disease is rising sharply in the United States. Healthy ...

Dissection of Larval Zebrafish Gonadal Tissue

Summary

Explore More Videos

Chapters in this video

Dissection and Lateral Mounting of Zebrafish Embryos: Analysis of Spinal Cord Development

Dissection of Organs from the Adult Zebrafish

Spinal Cord Transection in the Larval Zebrafish

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

Microdissection of Zebrafish Embryonic Eye Tissues

Eye Removal in Living Zebrafish Larvae to Examine Innervation-dependent Growth and Development of the Visual System

Gut Isolation from Zebrafish Larvae for Single-cell RNA Sequencing

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

Microgavage of Zebrafish Larvae

Partial Hepatectomy in Adult Zebrafish