Name: dissection of larval zebrafish gonadal tissue
Uploaded: 2017-04-26T14:00:00.000+00:00
Duration: 10 min 43 s
Description: Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Biz balık bakımı için C Zhang teşekkür ederim. Bu çalışma Çin Ulusal Doğa Bilim Vakfı (GP için 31.171.074, 31.371.099 ve 31.571.067) tarafından ve Pujiang Talent Projesi (GP için 09PJ1401900) tarafından desteklenmiştir.

Zebra balığı deneyler Fudan Üniversitesi Kurumsal Hayvan Bakım ve Kullanım Komitesi tarafından onaylandı. Balığı, standart prosedürlere 20&#39;ye göre yükseltilmiş ve yetiştirildi. 1. hazırlıklar <ol><li> larva zebrabalıkları dpf 17 dpf ve 25 yetiştirmek <ol><li> geçiş gününden önce geç öğleden sonra bir geçiş tankına Transferi 2 erkek ve 2 dişi yetişkin zebra balığı (sağlıklı, eski 3 ila 6 ay, laboratuvar AB strain). Bir bariyer kadın ve erkeklerden ayırın. Ertesi sabah, tank suyu yenilemek ve onları çiftleşmeye izin engeli kaldırın. 100 mm Petri tabaklarda döllenmeden sonra 1 ila 2 saat içerisinde yumurta toplayın. </li><li> Erken gelişim döneminde (4 gün) boyunca 28.5 ° C&#39;de 40 ml embriyo ortamı (EM) ile bir 100 mm&#39;lik plaka 40 embriyolar tutun ve günde iki kez EM yenileyin. 1 L tankları (300 ml sistem suyuna 40 larva) Larvalar aktarın ve 5 dpf sonra canlı rotifer (tam temini, günde iki kez) ile beslenirler.10 dpf&#39;e sonra yerine rotiferin diyetin canlı tuzlu su karidesi besleyin. 21 dpf 14 yaşında yeniden dolaşan su sistemi içine balık aktarın. </li><li> 17 dpf veya 25 dpf kadar yeniden dolaşan su sistemindeki larva zebrafish kaldırın. aydınlık / karanlık döngüsü sağlamak sistem su 14/10 saat ve pH değeri yaklaşık 7.2 olan. 17 dpf (5.5 mm 6.8) ve 25 dpf larvaları 22 (8 mm ila 11) arasında vücut uzunluğu ölçülür. </li></ol></li><li> diseksiyon için% 2 agar hazırlayın. <ol><li> 200 ml steril su 4 g agar ekleyin. saydam olana kadar bir mikrodalga fırınında karışım ısıtılır. </li><li> daha sonra, 60 mm çapında Petri tabağı (plakanın yaklaşık 1/3 hacim) içine dökün, yaklaşık 15 dakika boyunca agar soğutun. 4 ° C&#39;de katılaşmış Agar plakaları saklayın. </li></ol></li></ol> 2. Protokol 1: Larva dpf Gonadal 17 Doku ve 25 teşrih <ol><li> 17 dpf larvaları uyutmak için tanka kırılmış buz ekleyin. Transferi30 ml soğuk Ringer solüsyonu ile Petri kabı soğutulmuş 100 mm anestezi larva. Tamamen larvaları uyutmak için en az 15 dakika boyunca soğutulmuş Ringer çözeltisinde kuluçkaya balık tutun. </li><li> Küçük bir plastik kaşıkla önceden soğutulmuş bir agar plaka larvalarını aktarın. Ringer çözeltisi soğutulmuş 10 mL tüm balık vücut daldırın ve yavaşça yan koyun. </li><li> 25X Stereo mikroskop görüş alanının altında aşağıdaki işlemleri yapın. stabilizasyon cımbız ile balık sandığı Kelepçe. cımbız bir çift kalp anusdan uzunlamasına karın Rip. Yavaşça iç organları açığa çıkarmak için vücudun bir tarafında cilt ve kasların kaldırın. </li><li> dikkatle yüzmek mesaneye ventral organlarının kütlesini çıkarın. yüzme mesaneye bağlı gonad zarar kaçının. </li><li> yüzmek mesane ve ön vücut arasındaki bağlantıyı kesin. Tüm yüzmek mesane ve yavaşça gonadal doku çekin. NOT: En durumdas, 17 dpf gonadal doku epitel doku ve protonephridium çevreleyen içerir. Bunlar kolayca birbirinden ayrıldı değildir, ancak 25 ° C&#39;de kolayca ayrılabilir dpf. erbezi ayrıca anüs bağlanır. anüs birbirine bağlı sol ve sağ gonad olan bir bağlantı açıkça görülebilir. </li><li> dikkatli bir şekilde yüzme mesaneden gonadal doku ayırmak ve çevresindeki yağ dokuları temizlemek için cımbız kullanarak. </li><li> Hemen 200 uL Ringer çözeltisi ihtiva eden önceden soğutulmuş bir 1.5 mL santrifüj tüpüne izole gonadal doku aktarın. Tüm gonadal dokular larva ayrılır kadar buz üzerinde tüp tutun. </li><li> 2.7 - adımlarda 2.1 anlatıldığı gibi dpf larvaları 25 gonadlar parçalara ayır. </li></ol> 3. Protokol 2: İzole Gonadal Dokuların Gen İfade analiz <ol><li> larva gonadal dokulardan toplam RNA ekstrakte edilir. <ol><li> Yeni RNazsız 1&#39;e izole gonadal dokuları aktarın.5 ml tüp Ringer çözeltisi kaldırıp. 100 uL lizis çözeltisi ilave edin. dokuların kadar Vorteks tamamen parçalanır. </li><li> üreticinin talimatlarına göre toplam RNA ekstraksiyon prosedürü uygulayın. </li><li> I tampon 10x DNase 1/10 hacmi ve RNA çözeltisine DNase I 1 uL ekleyin ve yavaşça karıştırın. 37 ° C&#39;de 20 dakika süreyle inkübe edilir. </li><li> RNA çözeltisine 1/10 hacim DNaz inaktivasyon reaktif ekleyin. 70 ° C&#39;de 10 dakika süreyle inkübe edilir. bir spektrofotometre kullanılarak toplam RNA konsantrasyonu ölçümü. -20 ° C&#39;de saklayın. </li></ol></li><li> Birinci-şerit cDNA sentezi gerçekleştirme <ol><li> üreticinin protokolünü birinci tür cDNA sentezi gerçekleştirmek için bir oligo (dT) -bağlayıcı primeri kullanarak. 20 uL bir toplam reaksiyon hacmi 1 RNA ug 2 ekle. </li><li> 45 ° C&#39;de 90 dakika boyunca reaksiyon çözeltisi inkübe edin. 5 dakika boyunca 70 ° C&#39;de ısıtma ile reaksiyonu bitirin. </li><li> cDNA 1 mL RNaz H ekleme yüzdenDevriminin kalıntı RNA&#39;nın çıkması için. ~ 13,000 x g&#39;de 10 saniye boyunca hafifçe ve santrifüj karıştırın. 37 ° C&#39;de 20 dakika süreyle inkübe edilir. 20 ul nükleaz ücretsiz su ekleyin. -70 ° C&#39;de saklayın. </li></ol></li><li> Floresan kantitatif PCR gerçekleştirme <ol><li> bir floresan boya ile bir döngü sisteminde qPCR gerçekleştirin. 15 s, 30 s için 68 ° C, 15 sn için 95 ° C &#39;de Tm-5 ° C ile 35 döngü: Aşağıdaki PCR döngü koşulları kullanarak. (: GTCCTGTTGTCTCCTACTGTCG; REV: fwd CATTTGAGTTGAATATGATGCCCTG), cyp19a1a:;: AMH (GCGGAGAGGTGGAAGAGAGAATG fwd: rev GTGGATGGCAGCAGTACGAC) aşağıdaki gibi primer dizileri kullanarak, nanos3 (FWD: GCTCGGTGTACGCCAAATCAACAT; REV: CCAAGTGAAAACACAACACCAGTGC), vasa (FWD: ATCGCATAGGAAGAACTGGACGCT; REV: CCAAGTGAAAACACAACACCAGTGC) ve β-aktin (FWD: AGTGCGACGTGGACATCCGTA; rEV: GCACTTCCTGTGGACGATGGA) 19. </li></ol></li></ol>

<ol>
	<li>Wilson, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wild+sex+in+zebrafish:+loss+of+the+natural+sex+determinant+in+domesticated+strains.">Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains.</a> Genetics. 198 (3), 1291-1308 (2014).</li><li>Liew, W. C., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+sex:+a+complicated+affair.">Zebrafish sex: a complicated affair.</a> Genomics. 13 (2), 172-187 (2014).</li><li>Orban, L., Sreenivasan, R., Olsson, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+and+winding+roads:+Testis+differentiation+in+zebrafish.">Long and winding roads: Testis differentiation in zebrafish.</a> Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).</li><li>Blaser, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transition+from+non-motile+behaviour+to+directed+migration+during+early+PGC+development+in+zebrafish.">Transition from non-motile behaviour to directed migration during early PGC development in zebrafish.</a> J. Cell Sci. 118, 4027-4038 (2005).</li><li>Wang, X. G., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-M&#252;llerian+hormone+and+11+&#946;-hydroxylase+show+reciprocal+expression+to+that+of+aromatase+in+the+transforming+gonad+of+zebrafish+males.">Anti-M&#252;llerian hormone and 11 &#946;-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males.</a> Dev. Dynam. 236 (5), 1329-1338 (2007).</li><li>Siegfried, K. R., N&#252;sslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+control+of+female+sex+determination+in+zebrafish.">Germ line control of female sex determination in zebrafish.</a> Dev. Biol. 324 (2), 277-287 (2008).</li><li>Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+apoptosis+during+the+transition+from+ovary-like+tissue+to+testes+during+sex+differentiation+of+juvenile+zebrafish.">Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish.</a> J. Exp. Biol. 205 (Pt 6), 711-718 (2002).</li><li>Groh, K. J., Sch&#246;nenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+expression+in+zebrafish+during+gonad+differentiation+by+targeted+proteomics.">Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics.</a> Gen. Comp. Endocr. 193, 210-220 (2013).</li><li>Siegfried, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+search+of+determinants:+gene+expression+during+gonadal+sex+differentiation.">In search of determinants: gene expression during gonadal sex differentiation.</a> J. Fish Biol. 76 (8), 1879-1902 (2010).</li><li>Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microarray+analysis+of+sex-+and+gonad-biased+gene+expression+in+the+zebrafish:+evidence+for+masculinization+of+the+transcriptome.">A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome.</a> BMC Genomics. 10, 579 (2009).</li><li>Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+Cyp19+(P450+aromatase)+genes+on+duplicated+zebrafish+chromosomes+are+expressed+in+ovary+or+brain.">Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain.</a> Mol. Biol. Evol. 18 (4), 542-550 (2001).</li><li>Kishida, M., Callard, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cytochrome+P450+aromatase+isoforms+in+zebrafish+(Danio+rerio)+brain+and+ovary+are+differentially+programmed+and+estrogen+regulated+during+early+development.">Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development.</a> Endocrinology. 142 (2), 740-750 (2001).</li><li>Rodr&#237;guez-Mar&#237;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+expression+pattern+of+zebrafish+anti-M&#252;llerian+hormone+(amh)+relative+to+sox9a,+sox9b,+and+cyp19a1a,+during+gonad+development.">Characterization and expression pattern of zebrafish anti-M&#252;llerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development.</a> Gene Expr.Patterns. 5 (5), 655-667 (2005).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+a+vas::EGFP+transgene+in+primordial+germ+cells+of+the+zebrafish.">Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish.</a> Mech Dev. 116 (1-2), 141-150 (2002).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sexual+dimorphic+expression+pattern+of+a+splice+variant+of+zebrafish+vasa+during+gonadal+development.">Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development.</a> Dev. Biol. 271 (1), 190-197 (2004).</li><li>Tzung, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+depletion+of+primordial+germ+cells+in+zebrafish+promotes+testis+formation.">Early depletion of primordial germ cells in zebrafish promotes testis formation.</a> Stem Cell Reports. 4 (1), 61-73 (2015).</li><li>Hsiao, C., Tsai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+zebrafish+with+fluorescent+germ+cell:+a+useful+tool+to+visualize+germ+cell+proliferation+and+juvenile+hermaphroditism+in+vivo.">Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo.</a> Dev. Biol. 262 (2), 313-323 (2003).</li><li>Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection+of+gonads+from+juvenile+zebrafish.">Laser capture microdissection of gonads from juvenile zebrafish.</a> Reprod Biol Endocrinol. 7, 97 (2009).</li><li>Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=nr0b1+(DAX1)+mutation+in+zebrafish+causes+female-to-male+sex+reversal+through+abnormal+gonadal+proliferation+and+differentiation.">nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.</a> Mol. Cell. Endocrinol. 433, 105-116 (2016).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). , (2000).</li><li>Liew, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polygenic+sex+determination+system+in+zebrafish.">Polygenic sex determination system in zebrafish.</a> PLoS One. 7 (4), e34397 (2012).</li><li>Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normal+table+of+postembryonic+zebrafish+development:+staging+by+externally+visible+anatomy+of+the+living+fish.">Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish.</a> Dev Dyn. 238 (12), 2975-3015 (2009).</li><li>Gupta, T., Mullins, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+Organs+from+the+Adult+Zebrafish.">Dissection of Organs from the Adult Zebrafish.</a> J. Vis Exp. (37), (2010).</li><li>Arnaout, R., Reischauer, S., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recovery+of+Adult+Zebrafish+Hearts+for+High-throughput+Applications.">Recovery of Adult Zebrafish Hearts for High-throughput Applications.</a> J. Vis Exp. (94), (2014).</li><li>Gerlach, G. F., Schrader, L. N., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+Adult+Zebrafish+Kidney.">Dissection of the Adult Zebrafish Kidney.</a> J. Vis Exp. (54), (2011).</li><li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells.">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li><li>Braat, A. K., Speksnijder, J. E., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+development+in+fishes.">Germ line development in fishes.</a> Int. J. Dev. Biol. 43 (7), 745-760 (1999).</li><li>Huang, H. Y., Ketting, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+zebrafish+gonads+for+RNA+isolation.">Isolation of zebrafish gonads for RNA isolation.</a> Methods Mol Biol. 1093, 183-194 (2014).</li></ol>

Yazarlar hiçbir rakip mali çıkarları olduğunu beyan ederim.

Zebra balığı güçlü bir model haline gelmiştir ve yoğun gelişme ve hastalıkla ilgili araştırmalarda kullanılır. Örneğin beyin, kalp, gonad ve böbrek gibi yetişkin zebrabalıkları organların izole edilmesi için yöntemler, iyi 23, 24, 25 belgelenmiştir. Nedeniyle küçük boyutu ve larva zebrabalıkları gonadal dokuların dinamik yeniden yapılanmasına bağlı gonadal dokuların izolasyonu zor bir iştir. ...

Vahşi Zebra balığı kromozomu 4&#39;te önemli kadın seks belirleyici 1 (yani ortak laboratuar suşları) kaybolması veya evcil zebrabalıkları değiştirilir. Bunun yerine, sıcaklık, hipoksi, gıda temini ve nüfus yoğunluğu gibi çevresel faktörlerin eşliğinde polıgenık eşey tayini sistemi var. zebra balığı seks gelişme ayrıntılı mekanizması tam olarak anlaşılmış değildir. Birincil cinsiyet tespiti sinyal (ler) i / ne tür zebra balığı cinsiyet tespiti oluştuğunda gibi temel soru vardır ve genler gonad dönüşümün ilk adım, 3 2 cevaplanması gereken kalır düzenleyen. Zebra balığı seks gelişim sürecinde, birçok önemli aşamalar kabul edilmiştir. gelişiminin erken safhasında, 4 HPF (saat sonra döllenme) primordiyal üreme hücreleri (PGC) özellikleri tabi başlanarak genital s göç veçoğalma. PGC sayıları ve germ hücreleri ve somatik hücreler arasındaki karşılıklı etkileşimler gonad farklılaşma 4 için çok önemlidir. 13 dpf (gün sonra döllenme) &#39;de, gonadlar farklılaşmamış aşamasındadır. 17 dpf&#39;e olarak, gonadlar gelecek hem kadın hem erkeklerin de iki potansiyel yumurtalıkların içine gelişir. yumurtalık apoptozise bağımlı bir geçiş testise 21 ila 25 dpf başlar ve birçok hafta boyunca devam edebilir. 35 dpf ile, gonadal cinsiyet tespit edilmiştir ve cinsiyete spesifik gamet üretimi, 7 her iki yumurtalıkta devam etmektedir ve 6, 5 testisler. Bugüne kadar, çeşitli aday genleri ve cinsiyet tespiti mekanizmaları önerilmiştir. Proteomik ve transkriptomik analizi, dimorfik ifade bulunan pek çok gen izole ettik ve bu genler zebrabalıkları 8 seks farklılaşma çalışma kullanılmıştır </sup&gt; 9, 10. Örneğin, larva zebrabalıkları, cyp19a1a gen özel olarak fakat testis 11, 12 yumurtalık olarak ifade edilir. Buna ek olarak, AMH geni zayıf yumurtalık folikül granüloza hücrelerinde eksprese edilir, ancak güçlü bir testis Sertoli hücreleri 13 edilmektedir. Bunun aksine, vasa geni sürekli olarak uygun bir gonad işaretleyici 14, 15 yaparak, dişi ve erkek zebrabalıkları germ hücrelerinde ifade edilir. Gonadal gen ekspresyon düzeyleri incelenmesi, özellikle iki potansiyel yumurtalık aşama 3, 9, cinsiyet tespiti ve diferansiyasyonuna ait moleküler mekanizmanın anlaşılması önemlidir. Bununla birlikte, larva zebrabalıkları ve mukabil ölçüde küçük gonad küçük boyutu gonada izolasyonunu karmaşıkDaha fazla moleküler analiz l dokusu. Kullanılan önceki çalışmalar opercula ve anal gözenek 16 arasındaki bütün gövde bölgesini disseke. Bu preparat içeren gonadlar, ancak birden fazla doku ve organların oluşur. Seçenek olarak ise, bu tür vas olarak gonad-spesifik GFP ekspresyonu ile transgenik hayvanları: EGFP flüoresan aktif hücre ayrıştırma (FACS) ve lazer yakalama mikro diseksiyon 17, 18 üzerinden gonadal doku izolasyonu için kullanılmıştır. Ama onların yaygın uygulama sınırlıdır. Burada, 17 dpf ve 25 dpf&#39;e larva zebrafish gonadal doku izole etmek için basit bir prosedür açıklanmaktadır. Diğer organlarda göre gonad konumunu göstermekte ve çevre dokulardan morfolojik olarak bozulmamış gonadlar izole eder. Biz daha yüksek kantitatif PCR ile gövde dokusu (karşılaştırıldığında izole gonadlar olarak ifade edilmiştir, örneğin vaz ve cyp19a1a olarak gonad-spesifik genleri göstermektedirqPCR) analizi. Bu protokol, böylece gonad doku 19 daha sonra moleküler analiz sağlayarak, tanımlanmasını, izolasyonunu RNA saflaştırma ve larva zebrafish gonadal spesifik genlerin amplifikasyonuna olanak tanır.

<table><tbody><tr><td>Cell culture dish 100 mm</td><td>Corning</td><td>430167</td><td>For embryo incubation</td></tr><tr><td>20x EM</td><td></td><td></td><td>For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl&amp;#183;2H&lt;sub&gt;2&lt;/sub&gt;O; then add 0.41 g KH&lt;sub&gt;2&lt;/sub&gt;PO4, 0.412 g Na&lt;sub&gt;2&lt;/sub&gt;HPO4 anhydrous and 4.9 g MgSO&lt;sub&gt;4&lt;/sub&gt;&amp;#183;7H&lt;sub&gt;2&lt;/sub&gt;O.</td></tr><tr><td>1x EM</td><td></td><td></td><td>Dilute 20x EM in distilled water</td></tr><tr><td>AGAROSE G-10</td><td>Gene</td><td>121985</td><td>For preparing the 2% agar plates</td></tr><tr><td>Trizol Reagent</td><td>Invitrogen</td><td>15596-026</td><td>For RNA isolation</td></tr><tr><td>Meter glass</td><td>Shen Bo</td><td>250 ml</td><td>For preparing the 2% agar plates</td></tr><tr><td>Microwave Oven</td><td>Midea</td><td>M1-211A</td><td>For heating the AGAR</td></tr><tr><td>Tweezer DUMONT#5INOX</td><td>World Precision Instrument</td><td>500341</td><td>For dissection</td></tr><tr><td>Stereomicroscope</td><td>Motic</td><td>SMZ168</td><td>For dissection</td></tr><tr><td>Pure water equipment</td><td>Millipore</td><td></td><td></td></tr><tr><td>Ringer&amp;rsquo;s solution</td><td></td><td></td><td>For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl&lt;sub&gt;2&lt;/sub&gt; and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.</td></tr><tr><td>Transfer pipette</td><td>Samco</td><td>202, 204</td><td></td></tr><tr><td>Metal bath</td><td>QiLinbeier</td><td></td><td>Model GL-150</td></tr><tr><td>Microscope</td><td>Leica&amp;nbsp;</td><td>M205 FA</td><td>For photomicrograph</td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5417R</td><td></td></tr><tr><td>Micro Scale RNA Isolation Kit</td><td>Ambion</td><td>AM1931</td><td>For RNA isolation from gonad tissues</td></tr><tr><td>Dnase I</td><td>Sigma</td><td>AMPD1-1KT</td><td>For DNA digestion in the RNA solution</td></tr><tr><td>RevertAid First Strand cDNA Synthesis Kit</td><td>Thermo Scientific</td><td>#K1631</td><td>For first-strand cDNA synthesis</td></tr><tr><td>Rnase H</td><td>Thermo Scientific</td><td>#EN0202</td><td>For digesting the residual RNA in the cDNA solution.</td></tr><tr><td>SYBR Green Realtime PCR Master Mix</td><td>TOYOBO</td><td>QPK-201</td><td>This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and&amp;nbsp; applicable for intercalation assay with SYBR Green I.</td></tr><tr><td>Spectrophotometer</td><td>Ne Drop</td><td>OD-2000+</td><td>Measuring the concentration of the total RNA</td></tr><tr><td>Mastercycler</td><td>Eppendorf</td><td>AG 22331 Hamburg</td><td>gene expression profiling</td></tr></tbody></table>

dissection of larval zebrafish gonadal tissue

vahşi Zebra balığı ZZ / ZW cinsiyet belirleme sistemine sahip olmasına rağmen, evcil Zebra balığı seks kromozomuna kaybetti. Bunlar genom topluca bireysel balık seks kimliklerini belirlemek boyunca çeşitli genler dağıtılan polıgenık eşey tayini sistemi kullanmaktadır. Şu anda, genler gonad gelişimini düzenleyen katılır ve nasıl çalışır zor kalır. Normal olarak, gonadal doku izole seks gelişim süreçleri incelemek için ilk adımdır. Burada, zebra balığı dpf larvaları 17 dpf (gün sonra döllenme) ve 25 ile gonadal doku izole etmek için bir prosedürdür. İzole gonadal doku daha sonra morfoloji ve gen ekspresyon profili ile incelenebilir.

Gonadların Diseksiyonlar AB strain larva zebrabalıkları uygulandı. Şekil 1, 17 dpf ve 25 dpf larva zebrabalıkları tipik gonadal doku gösterir. Birincisi, deri ve karın bir tarafında kaslarının iç organları açığa çıkarmak için kesilir. iç organların kütlesi çıkardıktan sonra, birlikte gonad ile yüzme kesesi gövde kalır. Yumurtalık ( &#39;Şekil 1 B&#39; de ok) kesesi ventral tarafın...

Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Dissection of Larval Zebrafish Gonadal Tissue

Burada, Zebra balığı seks farklılaşması ve bakım soruşturmaları kolaylaştıracaktır larva zebrabalıkları, gonadal doku izole etmek için bir protokol mevcut.

Larva Zebra balığı Gonadal Doku Diseksiyon

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex ...

dissection-of-larval-zebrafish-gonadal-tissue

Research

JoVE Journal

Developmental Biology

10.2K Görüntüleme.  Fudan University.  Burada, Zebra balığı seks farklılaşması ve bakım soruşturmaları kolaylaştıracaktır larva zebrabalıkları, gonadal doku izole etmek için bir protokol mevcut. 

Video: Dissection of Larval Zebrafish Gonadal Tissue

Dissection and Lateral Mounting of Zebrafish Embryos: Analysis of Spinal Cord Development

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene knockdown approaches can be utilized to examine the molecular mechanisms underlying nervous system development. Second, large clutches of developmentally synchronized embryos provide large experimental sample sizes. Third, the optical clarity of the zebrafish embryo permits researchers to visualize progenitor, glial, and neuronal populations. Although zebrafish embryos are transparent, specimen thickness can impede effective microscopic visualization. One reason for this is the tandem development of the spinal cord and overlying somite tissue. Another reason is the large yolk ball, which is still present during periods of early neurogenesis. In this article, we demonstrate microdissection and removal of the yolk in fixed embryos, which allows microscopic visualization while preserving surrounding somite tissue. We also demonstrate semipermanent mounting of zebrafish embryos. This permits observation of neurodevelopment in the dorso-ventral and anterior-posterior axes, as it preserves the three-dimensionality of the tissue.

Developmental processes such as proliferation, patterning, differentiation, and axon guidance can be readily modeled in the zebrafish spinal cord. In this article, we describe a mounting procedure for zebrafish embryos, which optimizes visualization of these events.

Diseksiyon ve Zebra balığı Embriyolar Yanal Montaj: Omurilik Kalkınma Analizi

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene ...

Nörobilim

Dissection of Organs from the Adult Zebrafish

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental analysis of the embryo and larva is extensive and the morphology has been well documented, descriptions of adult zebrafish anatomy and studies of development of the adult structures and organs, together with techniques for working with adults are lacking. The organs of the larva undergo significant changes in their overall structure, morphology, and anatomical location during the larval to adult transition.  Externally, the transparent larva develops its characteristic adult striped pigment pattern and paired pelvic fins, while internally, the organs undergo massive growth and remodeling.  In addition, the bipotential gonad primordium develops into either testis or ovary.  This protocol identifies many of the organs of the adult and demonstrates methods for dissection of the brain, gonads, gastrointestinal system, heart, and kidney of the adult zebrafish. The dissected organs can be used for in situ hybridization, immunohistochemistry, histology, RNA extraction, protein analysis, and other molecular techniques.  This protocol will assist in the broadening of studies in the zebrafish to include the remodeling of larval organs, the morphogenesis of organs specific to the adult and other investigations of the adult organ systems.

This protocol describes a procedure for identifying and dissecting organs from the adult zebrafish.

Yetişkin Zebra balığı Organları diseksiyonu

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental ...

Biyoloji

Spinal Cord Transection in the Larval Zebrafish

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability to reinitiate spinal neurogenesis. However, some anamniotes including the zebrafish Danio rerio exhibit both sensory and functional recovery even after complete transection of the spinal cord. The adult zebrafish is an established model organism for studying regeneration following spinal cord injury, with sensory and motor recovery by 6&#160;weeks post-injury. To take advantage of in vivo analysis of the regenerative process available in the transparent larval zebrafish as well as genetic tools not accessible in the adult, we use the larval zebrafish to study regeneration after spinal cord transection. Here we demonstrate a method for reproducibly and verifiably transecting the larval spinal cord. After transection, our data shows sensory recovery beginning at 2&#160;days post-injury (dpi), with the C-bend movement detectable by 3 dpi and resumption of free swimming by 5 dpi. Thus we propose the larval zebrafish as a companion tool to the adult zebrafish for the study of recovery after spinal cord injury.

After spinal transection, adult zebrafish have functional recovery by six weeks post-injury. To take advantage of larval transparency and faster recovery, we present a method for transecting the larval spinal cord. After transection, we observe sensory recovery beginning at 2&#160;days post-injury, and C-bend movement by 3 days post-injury.

Larva Zebra balığı Omurilik Kesisi

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability ...

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, germ cell development, piRNA biology, and niche formation. Here, we present a dissection technique to live-image the gonad ex vivo during a period when in vivo live-imaging is highly ineffective. This protocol outlines how to transfer embryos to an imaging dish, choose appropriately-staged male embryos, and dissect the gonad from its surrounding tissue while still maintaining its structural integrity. Following dissection, gonads can be imaged using a confocal microscope to visualize dynamic cellular processes. The dissection procedure requires precise timing and dexterity, but we provide insight on how to prevent common mistakes and how to overcome these challenges. To our knowledge this is the first dissection protocol for the Drosophila embryonic gonad, and will permit live-imaging during an otherwise inaccessible window of time. This technique can be combined with pharmacological or cell-type specific transgenic manipulations to study any dynamic processes occurring within or between the&#160;cells in their natural gonadal environment.

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

Here, we provide a dissection protocol required to live-image the late embryonic Drosophila male gonad. This protocol will permit observation of dynamic cellular processes under normal conditions or after transgenic or pharmacological manipulation.

Geç Embriyonik Drosophila Gonad'ın Diseksiyonu ve Canlı Görüntülemesi

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, ...

Gelişim Biyolojisi

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Zebra balığı Embriyonik Göz Dokular, Mikrodisseksiyon

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Eye Removal in Living Zebrafish Larvae to Examine Innervation-dependent Growth and Development of the Visual System

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis support continuous growth of the entire visual system, both in the eye and the brain. Coordinated growth between the retinae and the optic tectum ensures accurate retinotopic mapping as new neurons are added in the eyes and brain. To address whether retinal axons provide crucial information for regulating tectal stem and progenitor cell behaviors such as survival, proliferation, and/or differentiation, it is necessary to be able to compare innervated and denervated tectal lobes within the same animal and across animals. 
Surgical removal of one eye from living larval zebrafish followed by observation of the optic tectum achieves this goal. The accompanying video demonstrates how to anesthetize larvae, electrolytically sharpen tungsten needles, and use them to remove one eye. It next shows how to dissect brains from fixed zebrafish larvae. Finally, the video provides an overview of the protocol for immunohistochemistry and a demonstration of how to mount stained embryos in low-melting-point agarose for microscopy.

The article explains how to surgically remove eyes from living zebrafish larvae as the first step toward investigating how retinal input influences optic tectum growth and development. In addition, the article provides information about larval anesthetization, fixation, and brain dissection, followed by immunohistochemistry and confocal imaging.

Görsel Sistemin Innervasyona Bağlı Büyümesini ve Gelişimini İncelemek için Canlı Zebra Balığı Larvalarında Göz Çıkarılması

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis ...

Tek Hücreli RNA Dizilimi için Zebra Balığı Larvalarından Bağırsak Hücrelerinin İşlenmesi

Gut Isolation from Zebrafish Larvae for Single-cell RNA Sequencing

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric neuromuscular disorders, highlighting the importance to understand the molecular mechanisms underlying GI development and dysfunction. In this study, we present a method for gut isolation from zebrafish larvae at 5 days post fertilization to obtain live,&#160;viable cells which can be used for single-cell RNA sequencing (scRNA-seq) analysis. This protocol is based on the manual dissection of the zebrafish intestine, followed by enzymatic dissociation with papain. Subsequently, cells are submitted to fluorescence-activated cell sorting, and viable cells are collected for scRNA-seq. With this method, we were able to successfully identify different intestinal cell types, including epithelial, stromal, blood, muscle, and immune cells, as well as enteric neurons and glia. Therefore, we consider it to be a valuable resource for studying the composition of the GI tract in health and disease, using the zebrafish.

Yazar Gündemi: Gastrointestinal Gelişimin Transkriptomik Yönlerini Araştırmak için Zebra Balığı Larvalarının Bağırsak Hücrelerinin İzole Edilmesi ve Analiz Edilmesi 

Here, we describe a method for gut isolation from zebrafish larvae at 5 days post fertilization, for single-cell RNA sequencing analysis.

Tek Hücreli RNA Dizilimi için Zebra Balığı Larvalarından Bağırsak İzolasyonu

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric ...

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work examining post-embryonic through adult cardiac development has been limited7-10. Examining the changing morphology of the maturing and aging heart are restricted by the lack of techniques available for staging and isolating juvenile and adult hearts. In order to analyze heart development over the fish's lifespan, we dissect zebrafish hearts at numerous stages and photograph them for further analysis11. The morphological features of the heart can easily be quantified and individual hearts can be further analyzed by a host of standard methods. Zebrafish grow at variable rates and maturation correlates better with fish size than age, thus, post-fixation, we photograph and measure fish length as a gauge of fish maturation. This protocol explains two distinct, size dependent dissection techniques for zebrafish, ranging from larvae 3.5mm standard length (SL) with hearts of 100&mu;m ventricle length (VL), to adults, with SL of 30mm and VL 1mm or larger. Larval and adult fish have quite distinct body and organ morphology. Larvae are not only significantly smaller, they have less pigment and each organ is visually very difficult to identify. For this reason, we use distinct dissection techniques.
We used pre-dissection fixation procedures, as we discovered that hearts dissected directly after euthanization have a more variable morphology, with very loose and balloon like atria compared with hearts removed following fixation. The fish fixed prior to dissection, retain in vivo morphology and chamber position (data not shown). In addition, for demonstration purposes, we take advantage of the heart (myocardial) specific GFP transgenic Tg(myl7:GFP)twu34 (12), which allows us to visualize the entire heart and is particularly useful at early stages in development when the cardiac morphology is less distinct from surrounding tissues. Dissection of the heart makes further analysis of the cell and molecular biology underlying heart development and maturation using in situ hybridization, immunohistochemistry, RNA extraction or other analytical methods easier in post-embryonic zebrafish. This protocol will provide a valuable technique for the study of cardiac development maturation and aging.

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

A clear, standardized method for dissection and isolation of the zebrafish heart at multiple developmental stages are described. Annotation and quantification techniques are also discussed.

Larvaların Kalp Diseksiyon, Çocuk ve Yetişkin Zebra balığı, Danio rerio</em

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work ...

Larva Zebra balığı Gonadal Doku Diseksiyon

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

Diseksiyon ve Zebra balığı Embriyolar Yanal Montaj: Omurilik Kalkınma Analizi

Yetişkin Zebra balığı Organları diseksiyonu

Larva Zebra balığı Omurilik Kesisi

Geç Embriyonik Drosophila Gonad'ın Diseksiyonu ve Canlı Görüntülemesi

Zebra balığı Embriyonik Göz Dokular, Mikrodisseksiyon

Görsel Sistemin Innervasyona Bağlı Büyümesini ve Gelişimini İncelemek için Canlı Zebra Balığı Larvalarında Göz Çıkarılması

Tek Hücreli RNA Dizilimi için Zebra Balığı Larvalarından Bağırsak İzolasyonu

Tek Hücreli RNA Dizilimi için Zebra Balığı Larvalarından Bağırsak İzolasyonu

Tek Hücreli RNA Dizilimi için Zebra Balığı Larvalarından Bağırsak İzolasyonu

Larvaların Kalp Diseksiyon, Çocuk ve Yetişkin Zebra balığı, Danio rerio