Agradecemos C Zhang para o cuidado de peixe. Este trabalho foi financiado pela National Science Foundation Natural da China (31171074, 31371099 e 31571067 para GP) e pelo Projeto Talentos Pujiang (09PJ1401900 para GP).

experiências peixe-zebra foram aprovados pelo Comitê Animal Care Institucional e Use da Universidade Fudan. Peixe-zebra foram levantadas e produzido de acordo com os procedimentos padrão 20. 1. Preparações <ol><li> Cultivar a 17 dpf e 25 dpf peixe-zebra larval <ol><li> Transferência 2 do sexo masculino e 2 do peixe-zebra adultos do sexo feminino (saudável, 3 a 6 meses de idade, a estirpe de laboratório AB) para um tanque de passagem no final da tarde do dia antes do cruzamento. Separar os machos e fêmeas com uma barreira. Na manhã seguinte, atualizar a água do tanque e remova a barreira para permitir-lhes para acasalar. Coleta de ovos em 100 mm placas de Petri de 1 a 2 horas após a fertilização. </li><li> Mantenha a cerca de 40 embriões numa placa de 100 mm, com 40 mL de meio de embrião (EM) a 28,5 ° C durante o período de desenvolvimento inicial (dia 4) e atualizar a EM duas vezes por dia. Transferência das larvas para tanques 1 L (40 larvas para 300 mL de água) e sistema alimentar com rotíferos vivos (alimentação total, duas vezes por dia) após a 5 dpf.Alimente camarão de água salgada ao vivo em vez de dieta rotíferos após 10 dpf. Transferir o peixe em água do sistema de recirculação em 14 dpf 21. </li><li> Elevar peixe-zebra larval no sistema de água de recirculação até 17 dpf ou 25 dpf. Assegurar o ciclo de luz / escuro de 14/10 h é e valor de pH de água do sistema é de cerca de 7,2. Medir o comprimento de corpo de 17 dpf (5,5-6,8 mm) e 25 dpf (8 a 11 mm) 22 larvas. </li></ol></li><li> Preparar 2% placas de agar para a dissecção. <ol><li> Adicionar 4 g de agar a 200 mL de água estéril. Aqueça a mistura em um forno de microondas até que fique transparente. </li><li> Arrefece-se a solução de agar durante cerca de 15 min, depois despejar 60 mm de diâmetro placas de Petri (aproximadamente 1/3 do volume da chapa). Armazenar as placas de agar solidificadas a 4 ° C. </li></ol></li></ol> 2. Protocolo 1: Dissecar o tecido gonadal de 17 e 25 dpf Larvas <ol><li> Adicione gelo picado para o tanque para anestesiar 17 larvas dpf. transferir olarvas anestesiados para um 100 mm refrigeradas placa de Petri com solução de 30 ml de solução fria de Ringer. Manter o peixe incubadas em solução de Ringer geladas durante pelo menos 15 min para anestesiar completamente as larvas. </li><li> Transferência das larvas para uma placa de ágar pré-arrefecida com uma pequena colher de plástico. Submerge todo o corpo do peixe em 10 mL refrigeradas solução de Ringer e suavemente colocá-lo sobre o seu lado. </li><li> Fazer as seguintes operações sob o campo de visão do 25X microscópio estéreo. Prender o tronco peixe com uma pinça para estabilização. Rasgar o abdômen longitudinalmente a partir do ânus para o coração com outro par de pinças. Remova cuidadosamente a pele e os músculos de um lado do corpo para expor os órgãos internos. </li><li> Retire a massa de órgãos ventral à bexiga natatória com cuidado. Evitar danos na gónada ligado à bexiga natatória. </li><li> Cortar a ligação entre a bexiga natatória e corpo anterior. Retire toda a bexiga natatória e tecido gonadal suavemente. NOTA: Na maioria dos casoss, o tecido gonadal em 17 dpf contém circundante tecido epitelial e protonephridium. Eles não são facilmente separadas uma da outra, mas a 25 dpf pode ser facilmente separada. O gonadal também está ligado ao ânus. A junção com gônada esquerda e direita ligados uns aos outros no ânus será claramente visível. </li><li> Utilizar uma pinça para separar cuidadosamente o tecido gonadal da bexiga natatória e limpar os tecidos adiposos adjacentes. </li><li> Imediatamente transferir o tecido gonadal isolado para um tubo de centrífuga previamente arrefecido de 1,5 ml contendo solução de 200 ul da campainha. Manter o tubo em gelo até que todos os tecidos gonadais são separados a partir das larvas. </li><li> Dissecar as gónadas de 25 dpf larvas, tal como descrito nas etapas 2.1 - 2.7. </li></ol> 3. Protocolo 2: Analisar Gene Expression dos isolados tecidos Gonadais <ol><li> Extrair o ARN total a partir dos tecidos gonadais larvares. <ol><li> Transferir os tecidos gonadais isolado para uma nova isenta de RNase 1.5 mL de tubo e remover a solução de Ringer. Adicionar 100 de solução de lise. Vortex até que os tecidos são completamente lisadas. </li><li> Executar o procedimento da extracção total de ARN de acordo com as instruções do fabricante. </li><li> Adicionar 1/10 volume de 10x ADNase I de tampão e 1 mL de ADNase I para a solução de ARN e misturar suavemente. Incubar durante 20 min a 37 ° C. </li><li> Adicionar 1/10 volume de reagente de inactivao de DNase à solução de ARN. Incubar durante 10 min a 70 ° C. Medir a concentração do ARN total utilizando um espectrofotómetro. Armazenar a -20 ° C. </li></ol></li><li> Realizar a síntese de ADNc de primeira cadeia <ol><li> Usar um-ligante iniciador oligo (dT) para realizar a síntese da primeira cadeia de cDNA, seguindo o protocolo do fabricante. Adicionar 1 a 2 ug de RNA para um volume total de reacção de 20 uL. </li><li> Incubar a solução de reacção durante 90 minutos a 45 ° C. Terminar a reacção por aquecimento a 70 ° C durante 5 min. </li><li> Adicionar 1 mL de ARNase H para o cDNA assimlução para remover o ARN residual. Misturar suavemente e centrifuga-se durante 10 s a 13000 x g ~. Incubar durante 20 min a 37 ° C. Adicionar 20 ul de água livre de nuclease. Armazenar a -70 ° C. </li></ol></li><li> Executar PCR quantitativa fluorescente <ol><li> Execute qPCR em um sistema cycler com um corante fluorescente. Use as seguintes condições de ciclos de PCR: 35 ciclos a 95 ° C durante 15 s, Tm-5 ° C durante 15 s, 68 ° C durante 30 s. Use sequências iniciadoras como se segue: a HAM (Fwd: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (Fwd: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (Fwd: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), vasa (Fwd: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) e β-actina (Fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA) 19. </li></ol></li></ol>

<ol>
	<li>Wilson, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wild+sex+in+zebrafish:+loss+of+the+natural+sex+determinant+in+domesticated+strains.">Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains.</a> Genetics. 198 (3), 1291-1308 (2014).</li><li>Liew, W. C., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+sex:+a+complicated+affair.">Zebrafish sex: a complicated affair.</a> Genomics. 13 (2), 172-187 (2014).</li><li>Orban, L., Sreenivasan, R., Olsson, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+and+winding+roads:+Testis+differentiation+in+zebrafish.">Long and winding roads: Testis differentiation in zebrafish.</a> Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).</li><li>Blaser, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transition+from+non-motile+behaviour+to+directed+migration+during+early+PGC+development+in+zebrafish.">Transition from non-motile behaviour to directed migration during early PGC development in zebrafish.</a> J. Cell Sci. 118, 4027-4038 (2005).</li><li>Wang, X. G., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-M&#252;llerian+hormone+and+11+&#946;-hydroxylase+show+reciprocal+expression+to+that+of+aromatase+in+the+transforming+gonad+of+zebrafish+males.">Anti-M&#252;llerian hormone and 11 &#946;-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males.</a> Dev. Dynam. 236 (5), 1329-1338 (2007).</li><li>Siegfried, K. R., N&#252;sslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+control+of+female+sex+determination+in+zebrafish.">Germ line control of female sex determination in zebrafish.</a> Dev. Biol. 324 (2), 277-287 (2008).</li><li>Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+apoptosis+during+the+transition+from+ovary-like+tissue+to+testes+during+sex+differentiation+of+juvenile+zebrafish.">Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish.</a> J. Exp. Biol. 205 (Pt 6), 711-718 (2002).</li><li>Groh, K. J., Sch&#246;nenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+expression+in+zebrafish+during+gonad+differentiation+by+targeted+proteomics.">Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics.</a> Gen. Comp. Endocr. 193, 210-220 (2013).</li><li>Siegfried, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+search+of+determinants:+gene+expression+during+gonadal+sex+differentiation.">In search of determinants: gene expression during gonadal sex differentiation.</a> J. Fish Biol. 76 (8), 1879-1902 (2010).</li><li>Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microarray+analysis+of+sex-+and+gonad-biased+gene+expression+in+the+zebrafish:+evidence+for+masculinization+of+the+transcriptome.">A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome.</a> BMC Genomics. 10, 579 (2009).</li><li>Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+Cyp19+(P450+aromatase)+genes+on+duplicated+zebrafish+chromosomes+are+expressed+in+ovary+or+brain.">Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain.</a> Mol. Biol. Evol. 18 (4), 542-550 (2001).</li><li>Kishida, M., Callard, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cytochrome+P450+aromatase+isoforms+in+zebrafish+(Danio+rerio)+brain+and+ovary+are+differentially+programmed+and+estrogen+regulated+during+early+development.">Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development.</a> Endocrinology. 142 (2), 740-750 (2001).</li><li>Rodr&#237;guez-Mar&#237;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+expression+pattern+of+zebrafish+anti-M&#252;llerian+hormone+(amh)+relative+to+sox9a,+sox9b,+and+cyp19a1a,+during+gonad+development.">Characterization and expression pattern of zebrafish anti-M&#252;llerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development.</a> Gene Expr.Patterns. 5 (5), 655-667 (2005).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+a+vas::EGFP+transgene+in+primordial+germ+cells+of+the+zebrafish.">Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish.</a> Mech Dev. 116 (1-2), 141-150 (2002).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sexual+dimorphic+expression+pattern+of+a+splice+variant+of+zebrafish+vasa+during+gonadal+development.">Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development.</a> Dev. Biol. 271 (1), 190-197 (2004).</li><li>Tzung, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+depletion+of+primordial+germ+cells+in+zebrafish+promotes+testis+formation.">Early depletion of primordial germ cells in zebrafish promotes testis formation.</a> Stem Cell Reports. 4 (1), 61-73 (2015).</li><li>Hsiao, C., Tsai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+zebrafish+with+fluorescent+germ+cell:+a+useful+tool+to+visualize+germ+cell+proliferation+and+juvenile+hermaphroditism+in+vivo.">Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo.</a> Dev. Biol. 262 (2), 313-323 (2003).</li><li>Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection+of+gonads+from+juvenile+zebrafish.">Laser capture microdissection of gonads from juvenile zebrafish.</a> Reprod Biol Endocrinol. 7, 97 (2009).</li><li>Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=nr0b1+(DAX1)+mutation+in+zebrafish+causes+female-to-male+sex+reversal+through+abnormal+gonadal+proliferation+and+differentiation.">nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.</a> Mol. Cell. Endocrinol. 433, 105-116 (2016).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). , (2000).</li><li>Liew, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polygenic+sex+determination+system+in+zebrafish.">Polygenic sex determination system in zebrafish.</a> PLoS One. 7 (4), e34397 (2012).</li><li>Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normal+table+of+postembryonic+zebrafish+development:+staging+by+externally+visible+anatomy+of+the+living+fish.">Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish.</a> Dev Dyn. 238 (12), 2975-3015 (2009).</li><li>Gupta, T., Mullins, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+Organs+from+the+Adult+Zebrafish.">Dissection of Organs from the Adult Zebrafish.</a> J. Vis Exp. (37), (2010).</li><li>Arnaout, R., Reischauer, S., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recovery+of+Adult+Zebrafish+Hearts+for+High-throughput+Applications.">Recovery of Adult Zebrafish Hearts for High-throughput Applications.</a> J. Vis Exp. (94), (2014).</li><li>Gerlach, G. F., Schrader, L. N., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+Adult+Zebrafish+Kidney.">Dissection of the Adult Zebrafish Kidney.</a> J. Vis Exp. (54), (2011).</li><li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells.">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li><li>Braat, A. K., Speksnijder, J. E., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+development+in+fishes.">Germ line development in fishes.</a> Int. J. Dev. Biol. 43 (7), 745-760 (1999).</li><li>Huang, H. Y., Ketting, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+zebrafish+gonads+for+RNA+isolation.">Isolation of zebrafish gonads for RNA isolation.</a> Methods Mol Biol. 1093, 183-194 (2014).</li></ol>

Os autores declaram que não têm interesses financeiros concorrentes.

O peixe-zebra tornou-se um modelo poderoso e é amplamente utilizado no desenvolvimento e investigação relacionada com a doença. Os métodos para o isolamento de órgãos no peixe-zebra adulto, tais como tumores do cérebro, coração, gônadas e rim, foram bem documentados 23, 24, 25. Devido ao pequeno tamanho e remodelação dinâmica dos tecidos gonadais no peixe-zebra larval, o isolamento de tecido gonadal é uma tarefa ...

O principal determinante do sexo feminino em selvagem cromossoma peixe-zebra 4 for perdido ou modificado no peixe-zebra domesticado (por exemplo estirpes de laboratório comuns) 1. Em vez disso, eles têm um sistema de determinação do sexo poligénica acompanhados por factores ambientais tais como a temperatura, a hipoxia, a disponibilidade de alimentos e densidade populacional. As modalidades específicas do desenvolvimento sexual peixe-zebra não são totalmente compreendidos. As questões fundamentais, tais como quando a determinação do sexo do peixe-zebra ocorre, o que o sinal de determinação do sexo primário (s) é / são, e que os genes regulam o primeiro passo de transformação das gónadas permanecem sem resposta 2, 3. No processo de desenvolvimento sexual peixe-zebra, várias etapas importantes foram reconhecidos. Na fase inicial de desenvolvimento, a partir de 4 HPF (horas após a fertilização) células germinativas primordiais (PGCs) submeter a especificação, a migração para e crista genitalproliferação. Números PGC e interacções recíprocas entre as células germinativas e células somáticas são importantes para a diferenciação gonadal 4. Aos 13 dpf (dias após a fertilização), as gónadas estão em fase indiferenciada. Por 17 dpf, as gônadas desenvolver em bi-potenciais ovários em ambos os sexos futuras. A transição dependente de apoptose a partir de ovário de testículo começam em 21 a 25 dpf e pode continuar durante várias semanas. Por 35 dpf, o sexo da gónada foi determinada e a produção de gâmetas específicos do sexo está em curso em ambos os ovários e de testículos de 5, 6, 7. Até à data, diversos genes e os mecanismos de determinação do sexo candidatos têm sido propostos. Proteomics e análise do transcriptoma isolaram muitos genes com expressão dimorfismo sexual e estes genes foram utilizados para estudar diferenciação sexual em peixes-zebra 8, </sup&gt; 9, 10. Por exemplo, no peixe-zebra larval, o gene cyp19a1a é especificamente expresso no ovário mas não no testículo 11, 12. Além disso, o gene AMH é fracamente expressa nas células da granulosa de folículos do ovário, mas fortemente em células de Sertoli de testículos 13. Em contraste, o gene de vasa é continuamente expressa nas células germinativas de ambos peixe-zebra macho e fêmea, tornando-o um marcador adequado gonadal 14, 15. Investigar os níveis de expressão do gene gonadais é fundamental para compreender o mecanismo molecular de determinação e diferenciação sexual, especialmente na fase de ovário bi-potencial 3, 9. No entanto, o pequeno tamanho do peixe-zebra larval e, correspondentemente, pequenas gónadas complicam o isolamento da gónadal tecido para outras análises moleculares. Estudos anteriores usados dissecado região do tronco inteiro entre o opercula e poros anal 16. Esta preparação, embora contendo gónadas, consiste em vários tecidos e órgãos. Em alternativa, os animais transgénicos com expressão da GFP específica para-gonadal, tais como vasa: EGFP foram usadas para o isolamento de tecido gonadal através de células activadas por fluorescência (FACS) e captura de laser de micro-dissecção 17, 18. Mas a sua aplicação generalizada é limitado. Aqui, descrevemos um procedimento simples para isolar o tecido gonadal dos peixes-zebra larval em 17 dpf e 25 dpf. Nós demonstramos a posição das gónadas no que diz respeito a outros órgãos e isolar as gónadas morfologicamente intactas a partir dos tecidos circundantes. Mostramos ainda mais os genes específicos de gónadas, tais como vasos e cyp19a1a são altamente expresso nas gônadas isolado em comparação com o tecido do tronco por meio de PCR quantitativa (qPCR) análise. O presente protocolo permite a identificação, o isolamento, a purificação de ARN e amplificação de genes específicos gonadais de peixe-zebra larval, permitindo assim a análise molecular subsequente de tecido gonadal 19.

<table border="0" cellpadding="0" cellspacing="0" width="975">
	<tbody>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Cell culture dish 100 mm</td>
			<td style="width:208px;">Corning</td>
			<td style="width:208px;">430167</td>
			<td style="width:351px;">For embryo incubation</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:208px;">20 X EM</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">For a 1 liter needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl.2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4. 7H2O.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">1 X EM</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">Dilute 20 X EM in distilled water</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">AGAROSE G-10</td>
			<td style="width:208px;">Gene</td>
			<td style="width:208px;">121985</td>
			<td style="width:351px;">For preparing the 2% agar plates&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Trizol Reagent</td>
			<td style="width:208px;">Invitrogen</td>
			<td style="width:208px;">15596-026</td>
			<td style="width:351px;">For RNA isolation&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Meter glass</td>
			<td style="width:208px;">Shen Bo</td>
			<td style="width:208px;">250 ml</td>
			<td style="width:351px;">For preparing the 2% agar plates&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Microwave Oven</td>
			<td style="width:208px;">Midea</td>
			<td style="width:208px;">M1-211A</td>
			<td style="width:351px;">For heating the AGAR</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">TWEEZER DUMONT#5INOX</td>
			<td style="width:208px;">World Precision Instrument</td>
			<td style="width:208px;">500341</td>
			<td style="width:351px;">For dissection</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Stereomicroscope</td>
			<td style="width:208px;">Motic</td>
			<td style="width:208px;">SMZ168</td>
			<td style="width:351px;">For dissection</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Pure water equipment</td>
			<td style="width:208px;">Millipore</td>
			<td style="width:208px;"></td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="81">
			<td height="81" style="height:81px;width:208px;">Ringer&#8217;s solution</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">For a 1 liter needed: Add 6.78g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Transfer pipette</td>
			<td style="width:208px;">Samco</td>
			<td style="width:208px;">202, 204</td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Metal bath</td>
			<td style="width:208px;">QiLinbeier</td>
			<td style="width:208px;"></td>
			<td style="width:351px;">Model GL-150</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Microscope</td>
			<td style="width:208px;">Leica&#160;</td>
			<td style="width:208px;">M205 FA</td>
			<td style="width:351px;">For photomicrograph</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Centrifuge</td>
			<td style="width:208px;">Eppendorf</td>
			<td style="width:208px;">5417R</td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Micro Scale RNA Isolation Kit&#160;</td>
			<td style="width:208px;">Ambion</td>
			<td style="width:208px;">AM1931</td>
			<td style="width:351px;">For RNA isolation from gonad tissues</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Dnase I&#160;</td>
			<td style="width:208px;">Sigma</td>
			<td style="width:208px;">AMPD1-1KT</td>
			<td style="width:351px;">For DNA digestion in the RNA solution&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">RevertAid First Strand cDNA Synthesis Kit</td>
			<td style="width:208px;">Thermo Scientific</td>
			<td style="width:208px;">#K1631</td>
			<td style="width:351px;">For&#160; first-strand cDNA synthesis</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Rnase H&#160;</td>
			<td style="width:208px;">Thermo Scientific</td>
			<td style="width:208px;">#EN0202</td>
			<td style="width:351px;">For digesting the residual RNA in the cDNA solution.</td>
		</tr>
		<tr height="98">
			<td height="98" style="height:98px;width:208px;">SYBR Green Realtime PCR Master Mix</td>
			<td style="width:208px;">TOYOBO</td>
			<td style="width:208px;">QPK-201</td>
			<td style="width:351px;">This product is a Taq DNA polymerase-based 2 x master mix for real-time PCR and&#160; applicable for intercalation assay with SYBR Green I.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Spectrophotometer</td>
			<td style="width:208px;">Ne Drop</td>
			<td style="width:208px;">OD-2000+</td>
			<td>Measuring the concentration of the total RNA</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Mastercycler</td>
			<td style="width:208px;">Eppendorf</td>
			<td style="width:208px;">AG 22331 Hamburg</td>
			<td>gene expression profiling</td>
		</tr>
	</tbody>
</table>

dissection of larval zebrafish gonadal tissue

Embora peixe-zebra selvagem possuem um / ZW sistema de determinação do sexo ZZ, peixe-zebra domesticados perderam do cromossoma sexual. Eles utilizam um sistema de determinação do sexo poligénica, onde vários genes distribuídos ao longo do genoma determinar colectivamente as identidades do sexo de cada peixe. Atualmente, os genes envolvidos na regulação do desenvolvimento das gônadas e como eles funcionam ainda imperceptíveis. Normalmente, o isolamento de tecido gonadal é o primeiro passo para examinar os processos de desenvolvimento sexuais. Aqui, nós apresentamos um processo para isolar tecido gonadal de 17 dpf (dias após a fertilização) e 25 dpf larvas de peixe-zebra. O tecido gonadal isolado pode ser posteriormente examinada por morfologia e a expressão do gene de perfis.

Dissecções das gónadas foram realizadas na AB strain peixe-zebra larval. A Figura 1 mostra tecido gonadal típico de peixe-zebra de larvas no 17 dpf e 25 dpf. Em primeiro lugar, a pele e os músculos de um lado do abdômen é cortado para expor os órgãos internos. Depois de retirar a massa dos órgãos internos, a bexiga natatória, juntamente com a gônada permanecer no tronco. O gonadal foi ligado ao lado ventral da bexiga natatória (seta na <strong ...

Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Dissection of Larval Zebrafish Gonadal Tissue

Aqui, apresentamos um protocolo para isolamento de tecido gonadal dos peixes-zebra larval, o que irá facilitar as investigações de diferenciação sexual peixe-zebra e manutenção.

Dissecção de larval Zebrafish gonadal Tissue

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex ...

dissection-of-larval-zebrafish-gonadal-tissue

Research

JoVE Journal

Developmental Biology

10.2K visualizações.  Fudan University.  Aqui, apresentamos um protocolo para isolamento de tecido gonadal dos peixes-zebra larval, o que irá facilitar as investigações de diferenciação sexual peixe-zebra e manutenção. 

Vídeo: Dissection of Larval Zebrafish Gonadal Tissue

Large-scale Zebrafish Embryonic Heart Dissection for Transcriptional Analysis

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the cardiac transcriptome from being masked by the global embryonic transcriptome, it is necessary to collect sufficient numbers of hearts for further analyses. Furthermore, as zebrafish cardiac development proceeds rapidly, heart collection and RNA extraction methods need to be quick in order to ensure homogeneity of the samples. Here, we present a rapid manual dissection protocol for collecting functional/beating hearts from zebrafish embryos. This is an essential prerequisite for subsequent cardiac-specific RNA extraction to determine cardiac-specific gene expression levels by transcriptome analyses, such as quantitative real-time polymerase chain reaction (RT-qPCR). The method is based on differential adhesive properties of the zebrafish embryonic heart compared with other tissues; this allows for the rapid physical separation of cardiac from extracardiac tissue by a combination of fluidic shear force disruption, stepwise filtration and manual collection of transgenic fluorescently labeled hearts.

To analyse cardiac gene expression profiles during zebrafish heart development, total RNA has to be extracted from isolated hearts. Here, we present a protocol for collecting functional/beating hearts by rapid manual dissection from zebrafish embryos to obtain cardiac-specific mRNA.

Em larga escala Zebrafish Embryonic Coração de dissecação para a análise transcricional

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the ...

Biologia do Desenvolvimento

Live Imaging of Innate Immune and Preneoplastic Cell Interactions Using an Inducible Gal4/UAS Expression System in Larval Zebrafish Skin

Here we describe a method to conditionally induce epithelial cell transformation by the use of the 4-Hydroxytamoxifen (4-OHT) inducible KalTA4-ERT2/UAS expression system1 in zebrafish larvae, and the subsequent live imaging of innate immune cell interaction with HRASG12V expressing skin cells. The KalTA4-ERT2/UAS system is both inducible and reversible which allows us to induce cell transformation with precise temporal/spatial resolution in vivo. This provides us with a unique opportunity to live image how individual preneoplastic cells interact with host tissues as soon as they emerge, then follow their progression as well as regression. Recent studies in zebrafish larvae have shown a trophic function of innate immunity in the earliest stages of tumorigenesis2,3. Our inducible system would allow us to live image the onset of cellular transformation and the subsequent host response, which may lead to important insights on the underlying mechanisms for the regulation of oncogenic trophic inflammatory responses. We also discuss how one might adapt our protocol to achieve temporal and spatial control of ectopic gene expression in any tissue of interest.

Studying the earliest events of preneoplastic cell progression and innate immune cell interaction is pivotal to understand and treat cancer. Here we describe a method to conditionally induce epithelial cell transformations and the subsequent live imaging of innate immune cell interaction with HRASG12V expressing skin cells in zebrafish larvae.

Imagens ao vivo da imunológica inata e pré-neoplásicas Interações de células utilizando um / UAS Expression System Inducible Gal4 em larvas de peixe-zebra da pele

Here we describe a method to conditionally induce epithelial cell transformation by the use of the 4-Hydroxytamoxifen (4-OHT) inducible KalTA4-ERT2/UAS ...

Capturing Tissue Repair in Zebrafish Larvae with Time-lapse Brightfield Stereomicroscopy

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two layers of skin that enclose undifferentiated mesenchyme, and because the larval tail fin regenerates rapidly within 2-3 days. Using this system, we demonstrate a method for capturing the repair dynamics of the amputated tail fin with time-lapse video brightfield stereomicroscopy. We demonstrate that fin amputation triggers a contraction of the amputation wound and extrusion of cells around the wound margin, leading to their subsequent clearance. Fin regeneration proceeds from proximal to distal direction after a short delay. In addition, developmental growth of the larva can be observed during all stages. The presented method provides an opportunity for observing and analyzing whole tissue-scale behaviors such as fin development and growth in a simple microscope setting, which is easily adaptable to any stereomicroscope with time-lapse capabilities.

We present a protocol for capturing the dynamics of zebrafish larval tail fin regeneration on a whole-tissue scale using brightfield-based stereomicroscopy. This technique enables capturing the regeneration dynamics with single cell resolution. This methodology can be adapted to any stereomicroscope equipped with a CCD camera and time-lapse software.

Captura de Reparo de Tecidos em Zebrafish larvas com a Time-lapse Brightfield lupa estereoscópica

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two ...

Visualizing the Interrenal Steroidogenic Tissue and Its Vascular Microenvironment in Zebrafish

This protocol introduces how to detect differentiated interrenal steroidogenic cells through a simple whole-mount enzymatic activity assay. Identifying differentiated steroidogenic tissues through chromogenic histochemical staining of 3-&#946;-Hydroxysteroid dehydrogenase /&#916;5-4 isomerase (3&#946;-Hsd) activity-positive cells is critical for monitoring the morphology and differentiation of adrenocortical and interrenal tissues in mammals and teleosts, respectively. In the zebrafish model, the optical transparency and tissue permeability of the developing embryos and larvae allow for whole-mount staining of 3&#946;-Hsd activity. This staining protocol, as performed on transgenic fluorescent reporter lines marking the developing pronephric and endothelial cells, enables the detection of the steroidogenic interrenal tissue in addition to the kidney and neighboring vasculature. In combination with vibratome sectioning, immunohistochemistry, and confocal microscopy, we can visualize and assay the vascular microenvironment of interrenal steroidogenic tissues. The 3&#946;-Hsd activity assay is essential for studying the cell biology of the zebrafish interrenal gland because to date, no suitable antibody is available for labeling zebrafish steroidogenic cells. Furthermore, this assay is rapid and simple, thus providing a powerful tool for mutant screens targeting adrenal (interrenal) genetic disorders as well as for determining disruption effects of chemicals on steroidogenesis in pharmaceutical or toxicological studies.

The interrenal gland in zebrafish is the teleostean counterpart of the mammalian adrenal gland. This protocol introduces how to perform the 3-&#946;-hydroxysteroid dehydrogenase (&#916;5-4 isomerase; 3&#946;-Hsd) enzymatic activity assay, which detects differentiated steroidogenic cells in the developing zebrafish.

Visualizando o Tissue interrenais Steroidogenic e sua Vascular Microenvironment em Zebrafish

This protocol introduces how to detect differentiated interrenal steroidogenic cells through a simple whole-mount enzymatic activity assay. Identifying ...

Establishment of Larval Zebrafish as an Animal Model to Investigate Trypanosoma cruzi Motility In Vivo

Chagas disease is a parasitic infection caused by Trypanosoma cruzi, whose motility is not only important for localization, but also for cellular binding and invasion. Current animal models for the study of T. cruzi allow limited observation of parasites in vivo, representing a challenge for understanding parasite behavior during the initial stages of infection in humans. This protozoan has a flagellar stage in both vector and mammalian hosts, but there are no studies describing its motility in vivo.The objective of this project was to establish a live vertebrate zebrafish model to evaluate T. cruzi motility in the vascular system. Transparent zebrafish larvae were injected with fluorescently labeled trypomastigotes and observed using light sheet fluorescence microscopy (LSFM), a noninvasive method to visualize live organisms with high optical resolution. The parasites could be visualized for extended periods of time due to this technique&#39;s relatively low risk of photodamage compared to confocal or epifluorescence microscopy. T. cruzi parasites were observed traveling in the circulatory system of live zebrafish in different-sized blood vessels and the yolk. They could also be seen attached to the yolk sac wall and to the atrioventricular valve despite the strong forces associated with heart contractions. LSFM of T. cruzi-inoculated zebrafish larvae is a valuable method that can be used to visualize circulating parasites and evaluate their tropism, migration patterns, and motility in the dynamic environment of the cardiovascular system of a live animal.

Establishment of Larval Zebrafish as an Animal Model to Investigate Trypanosoma cruzi Motility In Vivo

In this protocol, fluorescently labeled T. cruzi&#160;were injected into transparent zebrafish larvae, and parasite motility was observed in vivo using light sheet fluorescence microscopy.

Estabelecimento de Zebrafish Larval como um modelo Animal para investigar Trypanosoma cruzi motilidade In Vivo

Chagas disease is a parasitic infection caused by Trypanosoma cruzi, whose motility is not only important for localization, but also for cellular binding ...

Dissection and Staining of Drosophila Pupal Ovaries

Unlike adult Drosophila ovaries, pupal ovaries are relatively difficult to access and examine due to their small size, translucence, and encasing within a pupal case. The challenge of dissecting pupal ovaries also lies in their physical location within the pupa: the ovaries are surrounded by fat body cells inside the pupal abdomen, and these fat cells must be removed to allow for proper antibody staining. To overcome these challenges, this protocol utilizes customized Pasteur pipets to extract fat body cells from the pupal abdomen. Moreover, a chambered coverglass is used in place of a microcentrifuge tube during the staining process to improve visibility of the pupae. However, despite these and other advantages of the tools used in this protocol, successful execution of these techniques may still involve several days of practice due to the small size of pupal ovaries. The techniques outlined in this protocol could be applied to time course experiments in which ovaries are analyzed at various stages of pupal development.

Dissection and Staining of Drosophila Pupal Ovaries

The Drosophila ovary is an excellent model system for studying stem cell niche development. Though methods for dissecting larval and adult ovaries have been published, pupal ovary dissections require different techniques that have not been published in detail. Here we outline a protocol for dissecting, staining, and mounting pupal ovaries.

Dissecção e coloração dos ovários Pupal drosófila

Unlike adult Drosophila ovaries, pupal ovaries are relatively difficult to access and examine due to their small size, translucence, and encasing within a ...

Following Endocardial Tissue Movements via Cell Photoconversion in the Zebrafish Embryo

During embryogenesis, cells undergo dynamic changes in cell behavior, and deciphering the cellular logic behind these changes is a fundamental goal in the field of developmental biology. The discovery and development of photoconvertible proteins have greatly aided our understanding of these dynamic changes by providing a method to optically highlight cells and tissues. However, while photoconversion, time-lapse microscopy, and subsequent image analysis have proven to be very successful in uncovering cellular dynamics in organs such as the brain or the eye, this approach is generally not used in the developing heart due to challenges posed by the rapid movement of the heart during the cardiac cycle. This protocol consists of two parts. The first part describes a method for photoconverting and subsequently tracking endocardial cells (EdCs) during zebrafish atrioventricular canal (AVC) and atrioventricular heart valve development. The method involves temporally stopping the heart with a drug in order for accurate photoconversion to take place. Hearts are allowed to resume beating upon removal of the drug and embryonic development continues normally until the heart is stopped again for high-resolution imaging of photoconverted EdCs at a later developmental time point. The second part of the protocol describes an image analysis method to quantify the length of a photoconverted or non-photoconverted region in the AVC in young embryos by mapping the fluorescent signal from the three-dimensional structure onto a two-dimensional map. Together, the two parts of the protocol allows one to examine the origin and behavior of cells that make up the zebrafish AVC and atrioventricular heart valve, and can potentially be applied for studying mutants, morphants, or embryos that have been treated with reagents that disrupt AVC and/or valve development.

This protocol describes a method for the photoconversion of Kaede fluorescent protein in endocardial cells of the living zebrafish embryo that enables the tracking of endocardial cells during atrioventricular canal and atrioventricular heart valve development.

Seguindo os movimentos de tecido endocárdico através de célula Photoconversion no embrião Zebrafish

During embryogenesis, cells undergo dynamic changes in cell behavior, and deciphering the cellular logic behind these changes is a fundamental goal in the ...

Adult Zebrafish Injury Models to Study the Effects of Prednisolone in Regenerating Bone Tissue

Zebrafish are able to regenerate various organs, including appendages (fins) after amputation. This involves the regeneration of bone, which regrows within roughly two weeks after injury. Furthermore, zebrafish are able to heal bone rapidly after trepanation of the skull, and repair fractures that can be easily introduced into zebrafish bony fin rays. These injury assays represent feasible experimental paradigms to test the effect of administered drugs on rapidly forming bone. Here, we describe the use of these 3 injury models and their combined use with systemic glucocorticoid treatment, which exerts bone inhibitory and immunosuppressive effects. We provide a workflow on how to prepare for immunosuppressive treatment in adult zebrafish, illustrate how to perform fin amputation, trepanation of calvarial bones, and fin fractures, and describe how the use of glucocorticoids affects both bone forming osteoblasts and cells of the monocyte/macrophage lineage as part of innate immunity in bone tissue.

Here, we describe 3 adult zebrafish injury models and their combined use with immunosuppressive drug treatment. We provide guidance on imaging of regenerating tissues and on detecting bone mineralization therein.

Modelos de lesão adulto Zebrafish para estudar os efeitos de prednisolona na regeneração de tecido ósseo

Zebrafish are able to regenerate various organs, including appendages (fins) after amputation. This involves the regeneration of bone, which regrows ...

Electroretinogram Recording in Larval Zebrafish using A Novel Cone-Shaped Sponge-tip Electrode

The zebrafish (Danio rerio) is commonly used as a vertebrate model in developmental studies and is particularly suitable for visual neuroscience. For functional measurements of visual performance, electroretinography (ERG) is an ideal non-invasive method, which has been well established in higher vertebrate species. This approach is increasingly being used for examining the visual function in zebrafish, including during the early developmental larval stages. However, the most commonly used recording electrode for larval zebrafish ERG to date is the glass micropipette electrode, which requires specialized equipment for its manufacture, presenting a challenge for laboratories with limited resources. Here, we present a larval zebrafish ERG protocol using a cone-shaped sponge-tip electrode. The novel electrode is easier to manufacture and handle, more economical, and less likely to damage the larval eye than the glass micropipette. Like previously published ERG methods, the current protocol can assess outer retinal function through photoreceptor and bipolar cell responses, the a- and b-wave, respectively. The protocol can clearly illustrate the refinement of visual function throughout the early development of zebrafish larvae, supporting the utility, sensitivity, and reliability of the novel electrode. The simplified electrode is particularly useful when establishing a new ERG system or modifying existing small-animal ERG apparatus for zebrafish measurement, aiding researchers in the visual neurosciences to use the zebrafish model organism.

Here, we present a protocol that simplifies the measurement of light evoked electroretinogram responses from larval zebrafish. A novel cone-shaped sponge-tip electrode can help to make the study of visual development in larval zebrafish using the electroretinogram ERG easier to achieve with reliable outcomes and lower cost.

Electroretinogram gravação no Zebrafish Larval usando eletrodo de esponja-ponta em forma de Cone de romance A

The zebrafish (Danio rerio) is commonly used as a vertebrate model in developmental studies and is particularly suitable for visual neuroscience. For ...

Quantifying Liver Size in Larval Zebrafish Using Brightfield Microscopy

In several transgenic zebrafish models of hepatocellular carcinoma (HCC), hepatomegaly can be observed during early larval stages. Quantifying larval liver size in zebrafish HCC models provides a means to rapidly assess the effects of drugs and other manipulations on an oncogene-related phenotype. Here we show how to fix zebrafish larvae, dissect the tissues surrounding the liver, photograph livers using bright-field microscopy, measure liver area, and analyze results. This protocol enables rapid, precise quantification of liver size. As this method involves measuring liver area, it may underestimate differences in liver volume, and complementary methodologies are required to differentiate between changes in cell size and changes in cell number. The dissection technique described herein is an excellent tool to visualize the liver, gut, and pancreas in their natural positions for myriad downstream applications including immunofluorescence staining and in situ hybridization. The described strategy for quantifying larval liver size is applicable to many aspects of liver development and regeneration.

Here we demonstrate a method for quantifying liver size in larval zebrafish, providing a way to assess the effects of genetic and pharmacologic manipulations on liver growth and development.

Quantificando o tamanho do fígado em zebrafish larval usando microscopia de campo brilhante

In several transgenic zebrafish models of hepatocellular carcinoma (HCC), hepatomegaly can be observed during early larval stages. Quantifying larval ...