Name: dissection of larval zebrafish gonadal tissue
Uploaded: 2017-04-26T14:00:00.000+00:00
Duration: 10 min 43 s
Description: Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Agradecemos C Zhang para o cuidado de peixe. Este trabalho foi financiado pela National Science Foundation Natural da China (31171074, 31371099 e 31571067 para GP) e pelo Projeto Talentos Pujiang (09PJ1401900 para GP).

experiências peixe-zebra foram aprovados pelo Comitê Animal Care Institucional e Use da Universidade Fudan. Peixe-zebra foram levantadas e produzido de acordo com os procedimentos padrão 20. 1. Preparações <ol><li> Cultivar a 17 dpf e 25 dpf peixe-zebra larval <ol><li> Transferência 2 do sexo masculino e 2 do peixe-zebra adultos do sexo feminino (saudável, 3 a 6 meses de idade, a estirpe de laboratório AB) para um tanque de passagem no final da tarde do dia antes do cruzamento. Separar os machos e fêmeas com uma barreira. Na manhã seguinte, atualizar a água do tanque e remova a barreira para permitir-lhes para acasalar. Coleta de ovos em 100 mm placas de Petri de 1 a 2 horas após a fertilização. </li><li> Mantenha a cerca de 40 embriões numa placa de 100 mm, com 40 mL de meio de embrião (EM) a 28,5 ° C durante o período de desenvolvimento inicial (dia 4) e atualizar a EM duas vezes por dia. Transferência das larvas para tanques 1 L (40 larvas para 300 mL de água) e sistema alimentar com rotíferos vivos (alimentação total, duas vezes por dia) após a 5 dpf.Alimente camarão de água salgada ao vivo em vez de dieta rotíferos após 10 dpf. Transferir o peixe em água do sistema de recirculação em 14 dpf 21. </li><li> Elevar peixe-zebra larval no sistema de água de recirculação até 17 dpf ou 25 dpf. Assegurar o ciclo de luz / escuro de 14/10 h é e valor de pH de água do sistema é de cerca de 7,2. Medir o comprimento de corpo de 17 dpf (5,5-6,8 mm) e 25 dpf (8 a 11 mm) 22 larvas. </li></ol></li><li> Preparar 2% placas de agar para a dissecção. <ol><li> Adicionar 4 g de agar a 200 mL de água estéril. Aqueça a mistura em um forno de microondas até que fique transparente. </li><li> Arrefece-se a solução de agar durante cerca de 15 min, depois despejar 60 mm de diâmetro placas de Petri (aproximadamente 1/3 do volume da chapa). Armazenar as placas de agar solidificadas a 4 ° C. </li></ol></li></ol> 2. Protocolo 1: Dissecar o tecido gonadal de 17 e 25 dpf Larvas <ol><li> Adicione gelo picado para o tanque para anestesiar 17 larvas dpf. transferir olarvas anestesiados para um 100 mm refrigeradas placa de Petri com solução de 30 ml de solução fria de Ringer. Manter o peixe incubadas em solução de Ringer geladas durante pelo menos 15 min para anestesiar completamente as larvas. </li><li> Transferência das larvas para uma placa de ágar pré-arrefecida com uma pequena colher de plástico. Submerge todo o corpo do peixe em 10 mL refrigeradas solução de Ringer e suavemente colocá-lo sobre o seu lado. </li><li> Fazer as seguintes operações sob o campo de visão do 25X microscópio estéreo. Prender o tronco peixe com uma pinça para estabilização. Rasgar o abdômen longitudinalmente a partir do ânus para o coração com outro par de pinças. Remova cuidadosamente a pele e os músculos de um lado do corpo para expor os órgãos internos. </li><li> Retire a massa de órgãos ventral à bexiga natatória com cuidado. Evitar danos na gónada ligado à bexiga natatória. </li><li> Cortar a ligação entre a bexiga natatória e corpo anterior. Retire toda a bexiga natatória e tecido gonadal suavemente. NOTA: Na maioria dos casoss, o tecido gonadal em 17 dpf contém circundante tecido epitelial e protonephridium. Eles não são facilmente separadas uma da outra, mas a 25 dpf pode ser facilmente separada. O gonadal também está ligado ao ânus. A junção com gônada esquerda e direita ligados uns aos outros no ânus será claramente visível. </li><li> Utilizar uma pinça para separar cuidadosamente o tecido gonadal da bexiga natatória e limpar os tecidos adiposos adjacentes. </li><li> Imediatamente transferir o tecido gonadal isolado para um tubo de centrífuga previamente arrefecido de 1,5 ml contendo solução de 200 ul da campainha. Manter o tubo em gelo até que todos os tecidos gonadais são separados a partir das larvas. </li><li> Dissecar as gónadas de 25 dpf larvas, tal como descrito nas etapas 2.1 - 2.7. </li></ol> 3. Protocolo 2: Analisar Gene Expression dos isolados tecidos Gonadais <ol><li> Extrair o ARN total a partir dos tecidos gonadais larvares. <ol><li> Transferir os tecidos gonadais isolado para uma nova isenta de RNase 1.5 mL de tubo e remover a solução de Ringer. Adicionar 100 de solução de lise. Vortex até que os tecidos são completamente lisadas. </li><li> Executar o procedimento da extracção total de ARN de acordo com as instruções do fabricante. </li><li> Adicionar 1/10 volume de 10x ADNase I de tampão e 1 mL de ADNase I para a solução de ARN e misturar suavemente. Incubar durante 20 min a 37 ° C. </li><li> Adicionar 1/10 volume de reagente de inactivao de DNase à solução de ARN. Incubar durante 10 min a 70 ° C. Medir a concentração do ARN total utilizando um espectrofotómetro. Armazenar a -20 ° C. </li></ol></li><li> Realizar a síntese de ADNc de primeira cadeia <ol><li> Usar um-ligante iniciador oligo (dT) para realizar a síntese da primeira cadeia de cDNA, seguindo o protocolo do fabricante. Adicionar 1 a 2 ug de RNA para um volume total de reacção de 20 uL. </li><li> Incubar a solução de reacção durante 90 minutos a 45 ° C. Terminar a reacção por aquecimento a 70 ° C durante 5 min. </li><li> Adicionar 1 mL de ARNase H para o cDNA assimlução para remover o ARN residual. Misturar suavemente e centrifuga-se durante 10 s a 13000 x g ~. Incubar durante 20 min a 37 ° C. Adicionar 20 ul de água livre de nuclease. Armazenar a -70 ° C. </li></ol></li><li> Executar PCR quantitativa fluorescente <ol><li> Execute qPCR em um sistema cycler com um corante fluorescente. Use as seguintes condições de ciclos de PCR: 35 ciclos a 95 ° C durante 15 s, Tm-5 ° C durante 15 s, 68 ° C durante 30 s. Use sequências iniciadoras como se segue: a HAM (Fwd: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (Fwd: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (Fwd: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), vasa (Fwd: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) e β-actina (Fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA) 19. </li></ol></li></ol>

<ol>
	<li>Wilson, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wild+sex+in+zebrafish:+loss+of+the+natural+sex+determinant+in+domesticated+strains.">Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains.</a> Genetics. 198 (3), 1291-1308 (2014).</li><li>Liew, W. C., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+sex:+a+complicated+affair.">Zebrafish sex: a complicated affair.</a> Genomics. 13 (2), 172-187 (2014).</li><li>Orban, L., Sreenivasan, R., Olsson, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+and+winding+roads:+Testis+differentiation+in+zebrafish.">Long and winding roads: Testis differentiation in zebrafish.</a> Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).</li><li>Blaser, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transition+from+non-motile+behaviour+to+directed+migration+during+early+PGC+development+in+zebrafish.">Transition from non-motile behaviour to directed migration during early PGC development in zebrafish.</a> J. Cell Sci. 118, 4027-4038 (2005).</li><li>Wang, X. G., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-M&#252;llerian+hormone+and+11+&#946;-hydroxylase+show+reciprocal+expression+to+that+of+aromatase+in+the+transforming+gonad+of+zebrafish+males.">Anti-M&#252;llerian hormone and 11 &#946;-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males.</a> Dev. Dynam. 236 (5), 1329-1338 (2007).</li><li>Siegfried, K. R., N&#252;sslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+control+of+female+sex+determination+in+zebrafish.">Germ line control of female sex determination in zebrafish.</a> Dev. Biol. 324 (2), 277-287 (2008).</li><li>Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+apoptosis+during+the+transition+from+ovary-like+tissue+to+testes+during+sex+differentiation+of+juvenile+zebrafish.">Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish.</a> J. Exp. Biol. 205 (Pt 6), 711-718 (2002).</li><li>Groh, K. J., Sch&#246;nenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+expression+in+zebrafish+during+gonad+differentiation+by+targeted+proteomics.">Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics.</a> Gen. Comp. Endocr. 193, 210-220 (2013).</li><li>Siegfried, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+search+of+determinants:+gene+expression+during+gonadal+sex+differentiation.">In search of determinants: gene expression during gonadal sex differentiation.</a> J. Fish Biol. 76 (8), 1879-1902 (2010).</li><li>Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microarray+analysis+of+sex-+and+gonad-biased+gene+expression+in+the+zebrafish:+evidence+for+masculinization+of+the+transcriptome.">A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome.</a> BMC Genomics. 10, 579 (2009).</li><li>Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+Cyp19+(P450+aromatase)+genes+on+duplicated+zebrafish+chromosomes+are+expressed+in+ovary+or+brain.">Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain.</a> Mol. Biol. Evol. 18 (4), 542-550 (2001).</li><li>Kishida, M., Callard, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cytochrome+P450+aromatase+isoforms+in+zebrafish+(Danio+rerio)+brain+and+ovary+are+differentially+programmed+and+estrogen+regulated+during+early+development.">Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development.</a> Endocrinology. 142 (2), 740-750 (2001).</li><li>Rodr&#237;guez-Mar&#237;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+expression+pattern+of+zebrafish+anti-M&#252;llerian+hormone+(amh)+relative+to+sox9a,+sox9b,+and+cyp19a1a,+during+gonad+development.">Characterization and expression pattern of zebrafish anti-M&#252;llerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development.</a> Gene Expr.Patterns. 5 (5), 655-667 (2005).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+a+vas::EGFP+transgene+in+primordial+germ+cells+of+the+zebrafish.">Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish.</a> Mech Dev. 116 (1-2), 141-150 (2002).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sexual+dimorphic+expression+pattern+of+a+splice+variant+of+zebrafish+vasa+during+gonadal+development.">Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development.</a> Dev. Biol. 271 (1), 190-197 (2004).</li><li>Tzung, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+depletion+of+primordial+germ+cells+in+zebrafish+promotes+testis+formation.">Early depletion of primordial germ cells in zebrafish promotes testis formation.</a> Stem Cell Reports. 4 (1), 61-73 (2015).</li><li>Hsiao, C., Tsai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+zebrafish+with+fluorescent+germ+cell:+a+useful+tool+to+visualize+germ+cell+proliferation+and+juvenile+hermaphroditism+in+vivo.">Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo.</a> Dev. Biol. 262 (2), 313-323 (2003).</li><li>Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection+of+gonads+from+juvenile+zebrafish.">Laser capture microdissection of gonads from juvenile zebrafish.</a> Reprod Biol Endocrinol. 7, 97 (2009).</li><li>Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=nr0b1+(DAX1)+mutation+in+zebrafish+causes+female-to-male+sex+reversal+through+abnormal+gonadal+proliferation+and+differentiation.">nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.</a> Mol. Cell. Endocrinol. 433, 105-116 (2016).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). , (2000).</li><li>Liew, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polygenic+sex+determination+system+in+zebrafish.">Polygenic sex determination system in zebrafish.</a> PLoS One. 7 (4), e34397 (2012).</li><li>Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normal+table+of+postembryonic+zebrafish+development:+staging+by+externally+visible+anatomy+of+the+living+fish.">Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish.</a> Dev Dyn. 238 (12), 2975-3015 (2009).</li><li>Gupta, T., Mullins, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+Organs+from+the+Adult+Zebrafish.">Dissection of Organs from the Adult Zebrafish.</a> J. Vis Exp. (37), (2010).</li><li>Arnaout, R., Reischauer, S., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recovery+of+Adult+Zebrafish+Hearts+for+High-throughput+Applications.">Recovery of Adult Zebrafish Hearts for High-throughput Applications.</a> J. Vis Exp. (94), (2014).</li><li>Gerlach, G. F., Schrader, L. N., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+Adult+Zebrafish+Kidney.">Dissection of the Adult Zebrafish Kidney.</a> J. Vis Exp. (54), (2011).</li><li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells.">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li><li>Braat, A. K., Speksnijder, J. E., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+development+in+fishes.">Germ line development in fishes.</a> Int. J. Dev. Biol. 43 (7), 745-760 (1999).</li><li>Huang, H. Y., Ketting, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+zebrafish+gonads+for+RNA+isolation.">Isolation of zebrafish gonads for RNA isolation.</a> Methods Mol Biol. 1093, 183-194 (2014).</li></ol>

Os autores declaram que não têm interesses financeiros concorrentes.

O peixe-zebra tornou-se um modelo poderoso e é amplamente utilizado no desenvolvimento e investigação relacionada com a doença. Os métodos para o isolamento de órgãos no peixe-zebra adulto, tais como tumores do cérebro, coração, gônadas e rim, foram bem documentados 23, 24, 25. Devido ao pequeno tamanho e remodelação dinâmica dos tecidos gonadais no peixe-zebra larval, o isolamento de tecido gonadal é uma tarefa ...

O principal determinante do sexo feminino em selvagem cromossoma peixe-zebra 4 for perdido ou modificado no peixe-zebra domesticado (por exemplo estirpes de laboratório comuns) 1. Em vez disso, eles têm um sistema de determinação do sexo poligénica acompanhados por factores ambientais tais como a temperatura, a hipoxia, a disponibilidade de alimentos e densidade populacional. As modalidades específicas do desenvolvimento sexual peixe-zebra não são totalmente compreendidos. As questões fundamentais, tais como quando a determinação do sexo do peixe-zebra ocorre, o que o sinal de determinação do sexo primário (s) é / são, e que os genes regulam o primeiro passo de transformação das gónadas permanecem sem resposta 2, 3. No processo de desenvolvimento sexual peixe-zebra, várias etapas importantes foram reconhecidos. Na fase inicial de desenvolvimento, a partir de 4 HPF (horas após a fertilização) células germinativas primordiais (PGCs) submeter a especificação, a migração para e crista genitalproliferação. Números PGC e interacções recíprocas entre as células germinativas e células somáticas são importantes para a diferenciação gonadal 4. Aos 13 dpf (dias após a fertilização), as gónadas estão em fase indiferenciada. Por 17 dpf, as gônadas desenvolver em bi-potenciais ovários em ambos os sexos futuras. A transição dependente de apoptose a partir de ovário de testículo começam em 21 a 25 dpf e pode continuar durante várias semanas. Por 35 dpf, o sexo da gónada foi determinada e a produção de gâmetas específicos do sexo está em curso em ambos os ovários e de testículos de 5, 6, 7. Até à data, diversos genes e os mecanismos de determinação do sexo candidatos têm sido propostos. Proteomics e análise do transcriptoma isolaram muitos genes com expressão dimorfismo sexual e estes genes foram utilizados para estudar diferenciação sexual em peixes-zebra 8, </sup&gt; 9, 10. Por exemplo, no peixe-zebra larval, o gene cyp19a1a é especificamente expresso no ovário mas não no testículo 11, 12. Além disso, o gene AMH é fracamente expressa nas células da granulosa de folículos do ovário, mas fortemente em células de Sertoli de testículos 13. Em contraste, o gene de vasa é continuamente expressa nas células germinativas de ambos peixe-zebra macho e fêmea, tornando-o um marcador adequado gonadal 14, 15. Investigar os níveis de expressão do gene gonadais é fundamental para compreender o mecanismo molecular de determinação e diferenciação sexual, especialmente na fase de ovário bi-potencial 3, 9. No entanto, o pequeno tamanho do peixe-zebra larval e, correspondentemente, pequenas gónadas complicam o isolamento da gónadal tecido para outras análises moleculares. Estudos anteriores usados dissecado região do tronco inteiro entre o opercula e poros anal 16. Esta preparação, embora contendo gónadas, consiste em vários tecidos e órgãos. Em alternativa, os animais transgénicos com expressão da GFP específica para-gonadal, tais como vasa: EGFP foram usadas para o isolamento de tecido gonadal através de células activadas por fluorescência (FACS) e captura de laser de micro-dissecção 17, 18. Mas a sua aplicação generalizada é limitado. Aqui, descrevemos um procedimento simples para isolar o tecido gonadal dos peixes-zebra larval em 17 dpf e 25 dpf. Nós demonstramos a posição das gónadas no que diz respeito a outros órgãos e isolar as gónadas morfologicamente intactas a partir dos tecidos circundantes. Mostramos ainda mais os genes específicos de gónadas, tais como vasos e cyp19a1a são altamente expresso nas gônadas isolado em comparação com o tecido do tronco por meio de PCR quantitativa (qPCR) análise. O presente protocolo permite a identificação, o isolamento, a purificação de ARN e amplificação de genes específicos gonadais de peixe-zebra larval, permitindo assim a análise molecular subsequente de tecido gonadal 19.

<table><tbody><tr><td>Cell culture dish 100 mm</td><td>Corning</td><td>430167</td><td>For embryo incubation</td></tr><tr><td>20x EM</td><td></td><td></td><td>For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl&amp;#183;2H&lt;sub&gt;2&lt;/sub&gt;O; then add 0.41 g KH&lt;sub&gt;2&lt;/sub&gt;PO4, 0.412 g Na&lt;sub&gt;2&lt;/sub&gt;HPO4 anhydrous and 4.9 g MgSO&lt;sub&gt;4&lt;/sub&gt;&amp;#183;7H&lt;sub&gt;2&lt;/sub&gt;O.</td></tr><tr><td>1x EM</td><td></td><td></td><td>Dilute 20x EM in distilled water</td></tr><tr><td>AGAROSE G-10</td><td>Gene</td><td>121985</td><td>For preparing the 2% agar plates</td></tr><tr><td>Trizol Reagent</td><td>Invitrogen</td><td>15596-026</td><td>For RNA isolation</td></tr><tr><td>Meter glass</td><td>Shen Bo</td><td>250 ml</td><td>For preparing the 2% agar plates</td></tr><tr><td>Microwave Oven</td><td>Midea</td><td>M1-211A</td><td>For heating the AGAR</td></tr><tr><td>Tweezer DUMONT#5INOX</td><td>World Precision Instrument</td><td>500341</td><td>For dissection</td></tr><tr><td>Stereomicroscope</td><td>Motic</td><td>SMZ168</td><td>For dissection</td></tr><tr><td>Pure water equipment</td><td>Millipore</td><td></td><td></td></tr><tr><td>Ringer&amp;rsquo;s solution</td><td></td><td></td><td>For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl&lt;sub&gt;2&lt;/sub&gt; and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.</td></tr><tr><td>Transfer pipette</td><td>Samco</td><td>202, 204</td><td></td></tr><tr><td>Metal bath</td><td>QiLinbeier</td><td></td><td>Model GL-150</td></tr><tr><td>Microscope</td><td>Leica&amp;nbsp;</td><td>M205 FA</td><td>For photomicrograph</td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5417R</td><td></td></tr><tr><td>Micro Scale RNA Isolation Kit</td><td>Ambion</td><td>AM1931</td><td>For RNA isolation from gonad tissues</td></tr><tr><td>Dnase I</td><td>Sigma</td><td>AMPD1-1KT</td><td>For DNA digestion in the RNA solution</td></tr><tr><td>RevertAid First Strand cDNA Synthesis Kit</td><td>Thermo Scientific</td><td>#K1631</td><td>For first-strand cDNA synthesis</td></tr><tr><td>Rnase H</td><td>Thermo Scientific</td><td>#EN0202</td><td>For digesting the residual RNA in the cDNA solution.</td></tr><tr><td>SYBR Green Realtime PCR Master Mix</td><td>TOYOBO</td><td>QPK-201</td><td>This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and&amp;nbsp; applicable for intercalation assay with SYBR Green I.</td></tr><tr><td>Spectrophotometer</td><td>Ne Drop</td><td>OD-2000+</td><td>Measuring the concentration of the total RNA</td></tr><tr><td>Mastercycler</td><td>Eppendorf</td><td>AG 22331 Hamburg</td><td>gene expression profiling</td></tr></tbody></table>

dissection of larval zebrafish gonadal tissue

Embora peixe-zebra selvagem possuem um / ZW sistema de determinação do sexo ZZ, peixe-zebra domesticados perderam do cromossoma sexual. Eles utilizam um sistema de determinação do sexo poligénica, onde vários genes distribuídos ao longo do genoma determinar colectivamente as identidades do sexo de cada peixe. Atualmente, os genes envolvidos na regulação do desenvolvimento das gônadas e como eles funcionam ainda imperceptíveis. Normalmente, o isolamento de tecido gonadal é o primeiro passo para examinar os processos de desenvolvimento sexuais. Aqui, nós apresentamos um processo para isolar tecido gonadal de 17 dpf (dias após a fertilização) e 25 dpf larvas de peixe-zebra. O tecido gonadal isolado pode ser posteriormente examinada por morfologia e a expressão do gene de perfis.

Dissecções das gónadas foram realizadas na AB strain peixe-zebra larval. A Figura 1 mostra tecido gonadal típico de peixe-zebra de larvas no 17 dpf e 25 dpf. Em primeiro lugar, a pele e os músculos de um lado do abdômen é cortado para expor os órgãos internos. Depois de retirar a massa dos órgãos internos, a bexiga natatória, juntamente com a gônada permanecer no tronco. O gonadal foi ligado ao lado ventral da bexiga natatória (seta na <strong ...

Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Dissection of Larval Zebrafish Gonadal Tissue

Aqui, apresentamos um protocolo para isolamento de tecido gonadal dos peixes-zebra larval, o que irá facilitar as investigações de diferenciação sexual peixe-zebra e manutenção.

Dissecção de larval Zebrafish gonadal Tissue

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex ...

dissection-of-larval-zebrafish-gonadal-tissue

Research

JoVE Journal

Developmental Biology

10.2K visualizações.  Fudan University.  Aqui, apresentamos um protocolo para isolamento de tecido gonadal dos peixes-zebra larval, o que irá facilitar as investigações de diferenciação sexual peixe-zebra e manutenção. 

Vídeo: Dissection of Larval Zebrafish Gonadal Tissue

Dissection and Lateral Mounting of Zebrafish Embryos: Analysis of Spinal Cord Development

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene knockdown approaches can be utilized to examine the molecular mechanisms underlying nervous system development. Second, large clutches of developmentally synchronized embryos provide large experimental sample sizes. Third, the optical clarity of the zebrafish embryo permits researchers to visualize progenitor, glial, and neuronal populations. Although zebrafish embryos are transparent, specimen thickness can impede effective microscopic visualization. One reason for this is the tandem development of the spinal cord and overlying somite tissue. Another reason is the large yolk ball, which is still present during periods of early neurogenesis. In this article, we demonstrate microdissection and removal of the yolk in fixed embryos, which allows microscopic visualization while preserving surrounding somite tissue. We also demonstrate semipermanent mounting of zebrafish embryos. This permits observation of neurodevelopment in the dorso-ventral and anterior-posterior axes, as it preserves the three-dimensionality of the tissue.

Developmental processes such as proliferation, patterning, differentiation, and axon guidance can be readily modeled in the zebrafish spinal cord. In this article, we describe a mounting procedure for zebrafish embryos, which optimizes visualization of these events.

Dissecção e montagem lateral de embriões Zebrafish: Análise de Desenvolvimento da Medula Espinhal

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene ...

Neurociência

Dissection of Organs from the Adult Zebrafish

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental analysis of the embryo and larva is extensive and the morphology has been well documented, descriptions of adult zebrafish anatomy and studies of development of the adult structures and organs, together with techniques for working with adults are lacking. The organs of the larva undergo significant changes in their overall structure, morphology, and anatomical location during the larval to adult transition.  Externally, the transparent larva develops its characteristic adult striped pigment pattern and paired pelvic fins, while internally, the organs undergo massive growth and remodeling.  In addition, the bipotential gonad primordium develops into either testis or ovary.  This protocol identifies many of the organs of the adult and demonstrates methods for dissection of the brain, gonads, gastrointestinal system, heart, and kidney of the adult zebrafish. The dissected organs can be used for in situ hybridization, immunohistochemistry, histology, RNA extraction, protein analysis, and other molecular techniques.  This protocol will assist in the broadening of studies in the zebrafish to include the remodeling of larval organs, the morphogenesis of organs specific to the adult and other investigations of the adult organ systems.

This protocol describes a procedure for identifying and dissecting organs from the adult zebrafish.

Dissecção de Órgãos do Zebrafish Adulto

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental ...

Biologia

Spinal Cord Transection in the Larval Zebrafish

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability to reinitiate spinal neurogenesis. However, some anamniotes including the zebrafish Danio rerio exhibit both sensory and functional recovery even after complete transection of the spinal cord. The adult zebrafish is an established model organism for studying regeneration following spinal cord injury, with sensory and motor recovery by 6&#160;weeks post-injury. To take advantage of in vivo analysis of the regenerative process available in the transparent larval zebrafish as well as genetic tools not accessible in the adult, we use the larval zebrafish to study regeneration after spinal cord transection. Here we demonstrate a method for reproducibly and verifiably transecting the larval spinal cord. After transection, our data shows sensory recovery beginning at 2&#160;days post-injury (dpi), with the C-bend movement detectable by 3 dpi and resumption of free swimming by 5 dpi. Thus we propose the larval zebrafish as a companion tool to the adult zebrafish for the study of recovery after spinal cord injury.

After spinal transection, adult zebrafish have functional recovery by six weeks post-injury. To take advantage of larval transparency and faster recovery, we present a method for transecting the larval spinal cord. After transection, we observe sensory recovery beginning at 2&#160;days post-injury, and C-bend movement by 3 days post-injury.

Transecção medular nos larval Zebrafish

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability ...

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, germ cell development, piRNA biology, and niche formation. Here, we present a dissection technique to live-image the gonad ex vivo during a period when in vivo live-imaging is highly ineffective. This protocol outlines how to transfer embryos to an imaging dish, choose appropriately-staged male embryos, and dissect the gonad from its surrounding tissue while still maintaining its structural integrity. Following dissection, gonads can be imaged using a confocal microscope to visualize dynamic cellular processes. The dissection procedure requires precise timing and dexterity, but we provide insight on how to prevent common mistakes and how to overcome these challenges. To our knowledge this is the first dissection protocol for the Drosophila embryonic gonad, and will permit live-imaging during an otherwise inaccessible window of time. This technique can be combined with pharmacological or cell-type specific transgenic manipulations to study any dynamic processes occurring within or between the&#160;cells in their natural gonadal environment.

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

Here, we provide a dissection protocol required to live-image the late embryonic Drosophila male gonad. This protocol will permit observation of dynamic cellular processes under normal conditions or after transgenic or pharmacological manipulation.

Dissecção e Live-Imaging do Drosophila Gonad embrionário tardio

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, ...

Biologia do Desenvolvimento

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Microdissecção de tecidos oculares Zebrafish embrionárias

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Eye Removal in Living Zebrafish Larvae to Examine Innervation-dependent Growth and Development of the Visual System

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis support continuous growth of the entire visual system, both in the eye and the brain. Coordinated growth between the retinae and the optic tectum ensures accurate retinotopic mapping as new neurons are added in the eyes and brain. To address whether retinal axons provide crucial information for regulating tectal stem and progenitor cell behaviors such as survival, proliferation, and/or differentiation, it is necessary to be able to compare innervated and denervated tectal lobes within the same animal and across animals. 
Surgical removal of one eye from living larval zebrafish followed by observation of the optic tectum achieves this goal. The accompanying video demonstrates how to anesthetize larvae, electrolytically sharpen tungsten needles, and use them to remove one eye. It next shows how to dissect brains from fixed zebrafish larvae. Finally, the video provides an overview of the protocol for immunohistochemistry and a demonstration of how to mount stained embryos in low-melting-point agarose for microscopy.

The article explains how to surgically remove eyes from living zebrafish larvae as the first step toward investigating how retinal input influences optic tectum growth and development. In addition, the article provides information about larval anesthetization, fixation, and brain dissection, followed by immunohistochemistry and confocal imaging.

Remoção de olhos em larvas de zebrafish vivos para examinar o crescimento e desenvolvimento dependentes da inervação do sistema visual

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis ...

Processamento de células intestinais de larvas de peixe-zebra para sequenciamento de RNA de célula única

Gut Isolation from Zebrafish Larvae for Single-cell RNA Sequencing

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric neuromuscular disorders, highlighting the importance to understand the molecular mechanisms underlying GI development and dysfunction. In this study, we present a method for gut isolation from zebrafish larvae at 5 days post fertilization to obtain live,&#160;viable cells which can be used for single-cell RNA sequencing (scRNA-seq) analysis. This protocol is based on the manual dissection of the zebrafish intestine, followed by enzymatic dissociation with papain. Subsequently, cells are submitted to fluorescence-activated cell sorting, and viable cells are collected for scRNA-seq. With this method, we were able to successfully identify different intestinal cell types, including epithelial, stromal, blood, muscle, and immune cells, as well as enteric neurons and glia. Therefore, we consider it to be a valuable resource for studying the composition of the GI tract in health and disease, using the zebrafish.

Autor em destaque: isolando e analisando células intestinais de larvas de peixe-zebra para investigar aspectos transcriptômicos do desenvolvimento gastrointestinal 

Here, we describe a method for gut isolation from zebrafish larvae at 5 days post fertilization, for single-cell RNA sequencing analysis.

Isolamento Intestinal de Larvas de Zebrafish para Sequenciamento de RNA de Célula Única

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric ...

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work examining post-embryonic through adult cardiac development has been limited7-10. Examining the changing morphology of the maturing and aging heart are restricted by the lack of techniques available for staging and isolating juvenile and adult hearts. In order to analyze heart development over the fish's lifespan, we dissect zebrafish hearts at numerous stages and photograph them for further analysis11. The morphological features of the heart can easily be quantified and individual hearts can be further analyzed by a host of standard methods. Zebrafish grow at variable rates and maturation correlates better with fish size than age, thus, post-fixation, we photograph and measure fish length as a gauge of fish maturation. This protocol explains two distinct, size dependent dissection techniques for zebrafish, ranging from larvae 3.5mm standard length (SL) with hearts of 100&mu;m ventricle length (VL), to adults, with SL of 30mm and VL 1mm or larger. Larval and adult fish have quite distinct body and organ morphology. Larvae are not only significantly smaller, they have less pigment and each organ is visually very difficult to identify. For this reason, we use distinct dissection techniques.
We used pre-dissection fixation procedures, as we discovered that hearts dissected directly after euthanization have a more variable morphology, with very loose and balloon like atria compared with hearts removed following fixation. The fish fixed prior to dissection, retain in vivo morphology and chamber position (data not shown). In addition, for demonstration purposes, we take advantage of the heart (myocardial) specific GFP transgenic Tg(myl7:GFP)twu34 (12), which allows us to visualize the entire heart and is particularly useful at early stages in development when the cardiac morphology is less distinct from surrounding tissues. Dissection of the heart makes further analysis of the cell and molecular biology underlying heart development and maturation using in situ hybridization, immunohistochemistry, RNA extraction or other analytical methods easier in post-embryonic zebrafish. This protocol will provide a valuable technique for the study of cardiac development maturation and aging.

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

A clear, standardized method for dissection and isolation of the zebrafish heart at multiple developmental stages are described. Annotation and quantification techniques are also discussed.

Dissecção do coração em larval, Zebrafish Juvenil e Adulto, Danio rerio</em

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work ...

Dissecção de larval Zebrafish gonadal Tissue

Resumo

Explore mais vídeos

Capítulos neste vídeo

Dissecção e montagem lateral de embriões Zebrafish: Análise de Desenvolvimento da Medula Espinhal

Dissecção de Órgãos do Zebrafish Adulto

Transecção medular nos larval Zebrafish

Dissecção e Live-Imaging do Drosophila Gonad embrionário tardio

Microdissecção de tecidos oculares Zebrafish embrionárias

Remoção de olhos em larvas de zebrafish vivos para examinar o crescimento e desenvolvimento dependentes da inervação do sistema visual

Isolamento Intestinal de Larvas de Zebrafish para Sequenciamento de RNA de Célula Única

Isolamento Intestinal de Larvas de Zebrafish para Sequenciamento de RNA de Célula Única

Isolamento Intestinal de Larvas de Zebrafish para Sequenciamento de RNA de Célula Única

Dissecção do coração em larval, Zebrafish Juvenil e Adulto, Danio rerio