Name: dissection of larval zebrafish gonadal tissue
Uploaded: 2017-04-26T14:00:00.000+00:00
Duration: 10 min 43 s
Description: Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Nous remercions C Zhang pour les soins de poissons. Ce travail a été soutenu par la Fondation nationale des sciences naturelles de Chine (31171074, 31371099 et 31571067 GP) et par le projet Talent Pujiang (09PJ1401900 GP).

des expériences ont été approuvées par le poisson-zèbre le soin des animaux Université Fudan Comité institutionnel. Zebrafish ont été soulevées et élevés selon des procédures standard 20. 1. Préparation <ol><li> Cultiver 17 dpf et 25 dpf zebrafish larvaire <ol><li> Transfert 2 hommes et 2 femmes adultes poisson zèbre (santé, 3 à 6 mois, la souche de laboratoire AB) à un réservoir de passage dans l&#39;après-midi avant le jour de passage. Séparer les hommes et les femmes avec une barrière. Le lendemain matin, rafraîchir l&#39;eau du réservoir et enlever la barrière pour leur permettre de s&#39;accoupler. Recueillir des œufs à 100 mm des boîtes de Petri 1 à 2 h après la fécondation. </li><li> Gardez environ 40 embryons dans une plaque de 100 mm avec 40 ml de milieu d&#39;embryon (EM) à 28,5 ° C au cours de la première période de développement (4 jours) et rafraîchir l&#39;EM deux fois par jour. Transfert des larves à 1 réservoirs L (40 larves à 300 ml d&#39;eau du système) et alimenter avec rotifères en direct (alimentation complète, deux fois par jour) après 5 dpf.Nourrissez les crevettes de saumure en direct au lieu de l&#39;alimentation des rotifères après 10 dpf. Transférer le poisson dans le système d&#39;eau de recirculation à 14 dpf 21. </li><li> Élever des larves de poisson zèbre dans le système d&#39;eau en recirculation a 17 dpf ou 25 dpf. Assurer que le cycle lumière / obscurité est 14/10 h et valeur pH de l&#39;eau du système est d&#39;environ 7,2. Mesurer la longueur de corps de 17 dpf (5.5 à 6.8 mm) et 25 dpf (8 à 11 mm) 22 larves. </li></ol></li><li> Préparer 2% des plaques d&#39;agar pour la dissection. <ol><li> Ajouter 4 g d&#39;agar à 200 ml d&#39;eau stérile. Faire chauffer le mélange dans un four à micro-ondes jusqu&#39;à ce qu&#39;il devienne transparent. </li><li> On refroidit la solution de gélose pendant environ 15 min, puis le verser dans de 60 mm de diamètre des boîtes de Petri (environ 1/3 du volume de la plaque). Conserver les plaques d&#39;agar solidifiées à 4 ° C. </li></ol></li></ol> 2. Protocole 1: Disséquer le gonades de 17 et 25 dpf Larves <ol><li> Ajouter de la glace pilée dans le réservoir pour anesthésier 17 larves de dpf. transférer lalarves anesthésié à une boîte de Petri réfrigérées 100 mm avec une solution de 30 ml à froid Ringer. Gardez le poisson dans la incubée solution de Ringer refroidie pendant au moins 15 min pour anesthésier complètement les larves. </li><li> Transfert des larves à une plaque de gélose prérefroidi avec une petite cuillère en plastique. Immerger le corps entier de poisson dans 10 ml réfrigérées solution de Ringer et le poser délicatement sur le côté. </li><li> Les opérations suivantes dans le champ de vision du microscope stéréo 25X. Fixer le tronc de poisson avec des pincettes pour la stabilisation. Extraire l&#39;abdomen longitudinalement à partir de l&#39;anus vers le cœur avec une autre paire de pinces à épiler. Retirez délicatement la peau et les muscles d&#39;un côté du corps pour exposer les organes internes. </li><li> Retirer la masse des organes ventrales à la vessie natatoire soigneusement. Evitez d&#39;endommager la gonade attachée à la vessie natatoire. </li><li> Coupez la connexion entre la vessie natatoire et le corps antérieur. Tirer sur toute la vessie natatoire et le tissu gonadique doucement. NOTE: Dans la plupart des cass, le tissu gonadique à 17 dpf contient entourant le tissu épithélial et protonephridium. Ils ne sont pas facilement séparés les uns des autres, mais à 25 dpf il peut être facilement séparés. La gonade est également reliée à l&#39;anus. Une jonction avec gonades gauche et à droite reliés entre eux à l&#39;anus sera clairement visible. </li><li> Utiliser des pinces pour séparer soigneusement le tissu gonadique de la vessie natatoire et nettoyer les tissus adipeux environnants. </li><li> Transférer immédiatement le tissu gonadique isolé à un prérefroidi tube de centrifugation de 1,5 ml contenant une solution de 200 ul Ringer. Gardez le tube sur la glace jusqu&#39;à ce que tous les tissus gonadiques sont séparés des larves. </li><li> Disséquer les gonades de 25 dpf larves comme décrit dans les étapes 2.1 - 2.7. </li></ol> 3. Protocole 2: analyser l&#39;expression génique des tissus isolés gonadiques <ol><li> Extrait ARN total des tissus gonadiques larves. <ol><li> Transférer les tissus gonadiques isolés à une nouvelle RNase 1.tube 5 ml et retirer la solution de Ringer. Ajouter 100 ul d&#39;une solution de lyse. Vortex jusqu&#39;à ce que les tissus sont complètement lysées. </li><li> Effectuez la procédure totale d&#39;extraction d&#39;ARN selon les instructions du fabricant. </li><li> Ajouter 1/10 du volume de la DNase I 10x tampon et 1 ul de DNase I à la solution d&#39;ARN et mélanger doucement. Incuber pendant 20 min à 37 ° C. </li><li> Ajouter 1/10 de volume réactif d&#39;inactivation de DNase à la solution d&#39;ARN. Incuber pendant 10 min à 70 ° C. Mesurer la concentration de l&#39;ARN total en utilisant un spectrophotomètre. Conserver à -20 ° C. </li></ol></li><li> Effectuer la synthèse d&#39;ADNc du premier brin <ol><li> Utiliser une amorce lieur oligo (dT) pour effectuer la synthèse d&#39;ADNc du premier brin suivant le protocole du fabricant. Ajouter de 1 à 2 ug d&#39;ARN à un volume réactionnel total de 20 ul. </li><li> Incuber la solution réactionnelle pendant 90 minutes à 45 ° C. Terminer la réaction par chauffage à 70 ° C pendant 5 min. </li><li> Ajouter 1 pi de RNase H à l&#39;ADNc de manièrelution pour éliminer l&#39;ARN résiduel. Mélanger doucement et centrifuger pendant 10 s à ~ 13 000 x g. Incuber pendant 20 min à 37 ° C. Ajouter 20 ul nucléase d&#39;eau libre. Stocker à -70 ° C. </li></ol></li><li> Effectuer une PCR quantitative fluorescent <ol><li> Effectuer qPCR sur un système cycleur avec un colorant fluorescent. Utiliser les conditions de cycle de PCR suivantes: 35 cycles à 95 ° C pendant 15 s, Tm-5 ° C pendant 15 s, 68 ° C pendant 30 s. Utilisation des séquences d&#39; amorces comme suit: AMH (FWD: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (FWD: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (FWD: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), vasa (FWD: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) et β-actine (Fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA) 19. </li></ol></li></ol>

<ol>
	<li>Wilson, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wild+sex+in+zebrafish:+loss+of+the+natural+sex+determinant+in+domesticated+strains.">Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains.</a> Genetics. 198 (3), 1291-1308 (2014).</li><li>Liew, W. C., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+sex:+a+complicated+affair.">Zebrafish sex: a complicated affair.</a> Genomics. 13 (2), 172-187 (2014).</li><li>Orban, L., Sreenivasan, R., Olsson, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+and+winding+roads:+Testis+differentiation+in+zebrafish.">Long and winding roads: Testis differentiation in zebrafish.</a> Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).</li><li>Blaser, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transition+from+non-motile+behaviour+to+directed+migration+during+early+PGC+development+in+zebrafish.">Transition from non-motile behaviour to directed migration during early PGC development in zebrafish.</a> J. Cell Sci. 118, 4027-4038 (2005).</li><li>Wang, X. G., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-M&#252;llerian+hormone+and+11+&#946;-hydroxylase+show+reciprocal+expression+to+that+of+aromatase+in+the+transforming+gonad+of+zebrafish+males.">Anti-M&#252;llerian hormone and 11 &#946;-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males.</a> Dev. Dynam. 236 (5), 1329-1338 (2007).</li><li>Siegfried, K. R., N&#252;sslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+control+of+female+sex+determination+in+zebrafish.">Germ line control of female sex determination in zebrafish.</a> Dev. Biol. 324 (2), 277-287 (2008).</li><li>Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+apoptosis+during+the+transition+from+ovary-like+tissue+to+testes+during+sex+differentiation+of+juvenile+zebrafish.">Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish.</a> J. Exp. Biol. 205 (Pt 6), 711-718 (2002).</li><li>Groh, K. J., Sch&#246;nenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+expression+in+zebrafish+during+gonad+differentiation+by+targeted+proteomics.">Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics.</a> Gen. Comp. Endocr. 193, 210-220 (2013).</li><li>Siegfried, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+search+of+determinants:+gene+expression+during+gonadal+sex+differentiation.">In search of determinants: gene expression during gonadal sex differentiation.</a> J. Fish Biol. 76 (8), 1879-1902 (2010).</li><li>Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microarray+analysis+of+sex-+and+gonad-biased+gene+expression+in+the+zebrafish:+evidence+for+masculinization+of+the+transcriptome.">A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome.</a> BMC Genomics. 10, 579 (2009).</li><li>Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+Cyp19+(P450+aromatase)+genes+on+duplicated+zebrafish+chromosomes+are+expressed+in+ovary+or+brain.">Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain.</a> Mol. Biol. Evol. 18 (4), 542-550 (2001).</li><li>Kishida, M., Callard, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cytochrome+P450+aromatase+isoforms+in+zebrafish+(Danio+rerio)+brain+and+ovary+are+differentially+programmed+and+estrogen+regulated+during+early+development.">Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development.</a> Endocrinology. 142 (2), 740-750 (2001).</li><li>Rodr&#237;guez-Mar&#237;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+expression+pattern+of+zebrafish+anti-M&#252;llerian+hormone+(amh)+relative+to+sox9a,+sox9b,+and+cyp19a1a,+during+gonad+development.">Characterization and expression pattern of zebrafish anti-M&#252;llerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development.</a> Gene Expr.Patterns. 5 (5), 655-667 (2005).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+a+vas::EGFP+transgene+in+primordial+germ+cells+of+the+zebrafish.">Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish.</a> Mech Dev. 116 (1-2), 141-150 (2002).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sexual+dimorphic+expression+pattern+of+a+splice+variant+of+zebrafish+vasa+during+gonadal+development.">Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development.</a> Dev. Biol. 271 (1), 190-197 (2004).</li><li>Tzung, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+depletion+of+primordial+germ+cells+in+zebrafish+promotes+testis+formation.">Early depletion of primordial germ cells in zebrafish promotes testis formation.</a> Stem Cell Reports. 4 (1), 61-73 (2015).</li><li>Hsiao, C., Tsai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+zebrafish+with+fluorescent+germ+cell:+a+useful+tool+to+visualize+germ+cell+proliferation+and+juvenile+hermaphroditism+in+vivo.">Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo.</a> Dev. Biol. 262 (2), 313-323 (2003).</li><li>Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection+of+gonads+from+juvenile+zebrafish.">Laser capture microdissection of gonads from juvenile zebrafish.</a> Reprod Biol Endocrinol. 7, 97 (2009).</li><li>Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=nr0b1+(DAX1)+mutation+in+zebrafish+causes+female-to-male+sex+reversal+through+abnormal+gonadal+proliferation+and+differentiation.">nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.</a> Mol. Cell. Endocrinol. 433, 105-116 (2016).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). , (2000).</li><li>Liew, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polygenic+sex+determination+system+in+zebrafish.">Polygenic sex determination system in zebrafish.</a> PLoS One. 7 (4), e34397 (2012).</li><li>Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normal+table+of+postembryonic+zebrafish+development:+staging+by+externally+visible+anatomy+of+the+living+fish.">Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish.</a> Dev Dyn. 238 (12), 2975-3015 (2009).</li><li>Gupta, T., Mullins, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+Organs+from+the+Adult+Zebrafish.">Dissection of Organs from the Adult Zebrafish.</a> J. Vis Exp. (37), (2010).</li><li>Arnaout, R., Reischauer, S., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recovery+of+Adult+Zebrafish+Hearts+for+High-throughput+Applications.">Recovery of Adult Zebrafish Hearts for High-throughput Applications.</a> J. Vis Exp. (94), (2014).</li><li>Gerlach, G. F., Schrader, L. N., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+Adult+Zebrafish+Kidney.">Dissection of the Adult Zebrafish Kidney.</a> J. Vis Exp. (54), (2011).</li><li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells.">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li><li>Braat, A. K., Speksnijder, J. E., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+development+in+fishes.">Germ line development in fishes.</a> Int. J. Dev. Biol. 43 (7), 745-760 (1999).</li><li>Huang, H. Y., Ketting, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+zebrafish+gonads+for+RNA+isolation.">Isolation of zebrafish gonads for RNA isolation.</a> Methods Mol Biol. 1093, 183-194 (2014).</li></ol>

Les auteurs déclarent qu&#39;ils ont pas d&#39;intérêts financiers concurrents.

Le poisson zèbre est devenu un modèle puissant et est largement utilisé dans le développement et la recherche liée à la maladie. Les méthodes d&#39;isolement des organes chez le poisson zèbre adulte tels que le cerveau, le cœur, gonades, et les reins, ont été bien documentés 23, 24, 25. En raison de la petite taille et le remodelage dynamique des tissus gonadiques du poisson zèbre larvaire, l&#39;isolement des gona...

Le principal déterminant du sexe féminin dans le chromosome 4 est sauvage zebrafish perdu ou modifié dans le poisson zèbre domestique (c. -à- souches de laboratoire communes) 1. , Ils ont plutôt un système de détermination du sexe polygénique accompagnée par des facteurs environnementaux tels que la température, l&#39;hypoxie, la disponibilité alimentaire et de la densité de la population. ne sont pas pleinement compris les mécanismes détaillés de développement sexuel poisson zèbre. Des questions fondamentales telles que lors de la détermination du sexe se produit, ce poisson zèbre le signal primaire de détermination du sexe (s) est / sont et quels gènes régulent la première étape de la transformation des gonades reste à répondre 2, 3. Dans le processus de développement sexuel poisson zèbre, plusieurs étapes importantes ont été reconnues. Au début du stade de développement, à partir de 4 HPF (heures de fécondation) des cellules germinales primordiales (PGC) sont soumises à la spécification, la migration vers la crête génitale etprolifération. Les nombres de PGC et les interactions réciproques entre les cellules germinales et les cellules somatiques sont importantes pour la différenciation des gonades 4. A 13 dpf (jours de la fécondation), les gonades sont au stade indifférencié. Par 17 dpf, les gonades se développent dans les ovaires bi potentiel dans les deux futures femmes et les hommes. La transition dépendant de l&#39;apoptose de l&#39;ovaire à testiculaire commencent à 21 à 25 dpf et peut se poursuivre pendant plusieurs semaines. Par 35 dpf, le sexe de la gonade a été déterminée et la production de gamètes spécifique du sexe est en cours dans les deux ovaires et les testicules 5, 6, 7. À ce jour, divers gènes candidats et les mécanismes de détermination du sexe ont été proposées. Protéomique et l&#39; analyse de transcriptome ont isolé plusieurs gènes dont l&#39; expression dimorphisme sexuel et ces gènes ont été utilisés pour étudier la différenciation sexuelle chez le poisson zèbre 8, </sup&gt; 9, 10. Par exemple, chez le poisson zèbre larvaire, le gène cyp19a1a est exprimé spécifiquement dans l&#39;ovaire , mais pas dans le testicule 11, 12. De plus, le gène de l&#39; AMH est faiblement exprimé dans les cellules granuleuses des follicules ovariens, mais fortement dans les cellules de Sertoli testiculaires 13. En revanche, le gène de vasa est exprimé en continu dans les cellules germinales à la fois le poisson zèbre mâle et femelle, ce qui en fait un marqueur de gonade approprié 14, 15. Enquête sur les niveaux d&#39;expression du gène gonadiques est essentiel pour comprendre le mécanisme moléculaire de la détermination du sexe et de la différenciation en particulier au stade de l&#39; ovaire bi-potentiel 3, 9. Cependant, la petite taille du poisson zèbre larvaire et des gonades de façon correspondante de petits compliquer l&#39;isolement des gonadal tissu pour une analyse plus poussée moléculaire. Des études antérieures utilisées toute la région du tronc disséqués entre les opercules et pores anal 16. Cette préparation, bien que contenant gonades, se compose de plusieurs tissus et organes. En variante, des animaux transgéniques avec expression de GFP spécifique de gonade tels que vasa: EGFP ont été utilisés pour l&#39; isolement des tissus gonadiques par tri cellulaire activé par fluorescence (FACS) et des micro-dissection par capture laser 17, 18. Mais leur application à grande échelle est limitée. Ici, nous décrivons une procédure simple pour isoler gonades des larves de poisson zèbre à 17 dpf et 25 dpf. Nous démontrons la position des gonades par rapport à d&#39;autres organes et d&#39;isoler les gonades des tissus environnants morphologiquement intacts. Nous montrons en outre les gènes spécifiques gonades tels que Vasa et cyp19a1a sont fortement exprimés dans les gonades isolées par rapport au tissu du tronc par PCR quantitative (analyse qPCR). Le présent protocole permet l&#39; identification, l&#39; isolement, la purification de l&#39; ARN et l&#39; amplification de gènes spécifiques des gonades de poisson zèbre larvaire, ce qui permet une analyse moléculaire ultérieure du tissu gonadique 19.

<table><tbody><tr><td>Cell culture dish 100 mm</td><td>Corning</td><td>430167</td><td>For embryo incubation</td></tr><tr><td>20x EM</td><td></td><td></td><td>For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl&amp;#183;2H&lt;sub&gt;2&lt;/sub&gt;O; then add 0.41 g KH&lt;sub&gt;2&lt;/sub&gt;PO4, 0.412 g Na&lt;sub&gt;2&lt;/sub&gt;HPO4 anhydrous and 4.9 g MgSO&lt;sub&gt;4&lt;/sub&gt;&amp;#183;7H&lt;sub&gt;2&lt;/sub&gt;O.</td></tr><tr><td>1x EM</td><td></td><td></td><td>Dilute 20x EM in distilled water</td></tr><tr><td>AGAROSE G-10</td><td>Gene</td><td>121985</td><td>For preparing the 2% agar plates</td></tr><tr><td>Trizol Reagent</td><td>Invitrogen</td><td>15596-026</td><td>For RNA isolation</td></tr><tr><td>Meter glass</td><td>Shen Bo</td><td>250 ml</td><td>For preparing the 2% agar plates</td></tr><tr><td>Microwave Oven</td><td>Midea</td><td>M1-211A</td><td>For heating the AGAR</td></tr><tr><td>Tweezer DUMONT#5INOX</td><td>World Precision Instrument</td><td>500341</td><td>For dissection</td></tr><tr><td>Stereomicroscope</td><td>Motic</td><td>SMZ168</td><td>For dissection</td></tr><tr><td>Pure water equipment</td><td>Millipore</td><td></td><td></td></tr><tr><td>Ringer&amp;rsquo;s solution</td><td></td><td></td><td>For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl&lt;sub&gt;2&lt;/sub&gt; and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.</td></tr><tr><td>Transfer pipette</td><td>Samco</td><td>202, 204</td><td></td></tr><tr><td>Metal bath</td><td>QiLinbeier</td><td></td><td>Model GL-150</td></tr><tr><td>Microscope</td><td>Leica&amp;nbsp;</td><td>M205 FA</td><td>For photomicrograph</td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5417R</td><td></td></tr><tr><td>Micro Scale RNA Isolation Kit</td><td>Ambion</td><td>AM1931</td><td>For RNA isolation from gonad tissues</td></tr><tr><td>Dnase I</td><td>Sigma</td><td>AMPD1-1KT</td><td>For DNA digestion in the RNA solution</td></tr><tr><td>RevertAid First Strand cDNA Synthesis Kit</td><td>Thermo Scientific</td><td>#K1631</td><td>For first-strand cDNA synthesis</td></tr><tr><td>Rnase H</td><td>Thermo Scientific</td><td>#EN0202</td><td>For digesting the residual RNA in the cDNA solution.</td></tr><tr><td>SYBR Green Realtime PCR Master Mix</td><td>TOYOBO</td><td>QPK-201</td><td>This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and&amp;nbsp; applicable for intercalation assay with SYBR Green I.</td></tr><tr><td>Spectrophotometer</td><td>Ne Drop</td><td>OD-2000+</td><td>Measuring the concentration of the total RNA</td></tr><tr><td>Mastercycler</td><td>Eppendorf</td><td>AG 22331 Hamburg</td><td>gene expression profiling</td></tr></tbody></table>

dissection of larval zebrafish gonadal tissue

Bien que le poisson zèbre sauvage possède un ZZ / ZW système de détermination du sexe, ont perdu domestiqué zebrafish le chromosome sexuel. Ils utilisent un système de détermination du sexe polygénique, où plusieurs gènes répartis dans le génome déterminent collectivement l&#39;identité sexuelle des individus. À l&#39;heure actuelle, les gènes impliqués dans la régulation du développement des gonades et comment ils fonctionnent demeurent insaisissables. Normalement, l&#39;isolement gonades est la première étape pour examiner les processus de développement sexuels. Nous présentons ici une procédure pour isoler gonades de 17 dpf (jours de la fécondation) et 25 dpf larves de poisson zèbre. Le tissu gonadique isolé peut ensuite être examiné par le profilage de la morphologie et de l&#39;expression génique.

Dissections des gonades ont été effectuées sur la souche AB zebrafish des larves. La figure 1 représente un tissu gonadique typique des larves de poisson zèbre à 17 dpf et 25 dpf. Tout d&#39;abord, la peau et les muscles d&#39;un côté de l&#39;abdomen est coupé pour exposer les organes internes. Après avoir enlevé la masse des organes internes, la vessie natatoire en même temps que la gonade restent dans le coffre. Le gonades a été attaché à ...

Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Dissection of Larval Zebrafish Gonadal Tissue

Nous présentons ici un protocole pour isoler gonades des larves de poisson zèbre, ce qui facilitera les enquêtes de la différenciation sexuelle et l&#39;entretien du poisson zèbre.

Dissection de tissu gonadique Larval Zebrafish

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex ...

dissection-of-larval-zebrafish-gonadal-tissue

Research

JoVE Journal

Developmental Biology

10.2K vues.  Fudan University.  Nous présentons ici un protocole pour isoler gonades des larves de poisson zèbre, ce qui facilitera les enquêtes de la différenciation sexuelle et l'entretien du poisson zèbre. 

Vidéo: Dissection of Larval Zebrafish Gonadal Tissue

Dissection and Lateral Mounting of Zebrafish Embryos: Analysis of Spinal Cord Development

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene knockdown approaches can be utilized to examine the molecular mechanisms underlying nervous system development. Second, large clutches of developmentally synchronized embryos provide large experimental sample sizes. Third, the optical clarity of the zebrafish embryo permits researchers to visualize progenitor, glial, and neuronal populations. Although zebrafish embryos are transparent, specimen thickness can impede effective microscopic visualization. One reason for this is the tandem development of the spinal cord and overlying somite tissue. Another reason is the large yolk ball, which is still present during periods of early neurogenesis. In this article, we demonstrate microdissection and removal of the yolk in fixed embryos, which allows microscopic visualization while preserving surrounding somite tissue. We also demonstrate semipermanent mounting of zebrafish embryos. This permits observation of neurodevelopment in the dorso-ventral and anterior-posterior axes, as it preserves the three-dimensionality of the tissue.

Developmental processes such as proliferation, patterning, differentiation, and axon guidance can be readily modeled in the zebrafish spinal cord. In this article, we describe a mounting procedure for zebrafish embryos, which optimizes visualization of these events.

Dissection et montage latéral embryons de poisson zèbre: Analyse de la moelle épinière développement

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene ...

Recherche

Neurosciences

Dissection of Organs from the Adult Zebrafish

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental analysis of the embryo and larva is extensive and the morphology has been well documented, descriptions of adult zebrafish anatomy and studies of development of the adult structures and organs, together with techniques for working with adults are lacking. The organs of the larva undergo significant changes in their overall structure, morphology, and anatomical location during the larval to adult transition.  Externally, the transparent larva develops its characteristic adult striped pigment pattern and paired pelvic fins, while internally, the organs undergo massive growth and remodeling.  In addition, the bipotential gonad primordium develops into either testis or ovary.  This protocol identifies many of the organs of the adult and demonstrates methods for dissection of the brain, gonads, gastrointestinal system, heart, and kidney of the adult zebrafish. The dissected organs can be used for in situ hybridization, immunohistochemistry, histology, RNA extraction, protein analysis, and other molecular techniques.  This protocol will assist in the broadening of studies in the zebrafish to include the remodeling of larval organs, the morphogenesis of organs specific to the adult and other investigations of the adult organ systems.

This protocol describes a procedure for identifying and dissecting organs from the adult zebrafish.

Dissection d&#39;organes sur le poisson zèbre pour adultes

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental ...

Biologie

Spinal Cord Transection in the Larval Zebrafish

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability to reinitiate spinal neurogenesis. However, some anamniotes including the zebrafish Danio rerio exhibit both sensory and functional recovery even after complete transection of the spinal cord. The adult zebrafish is an established model organism for studying regeneration following spinal cord injury, with sensory and motor recovery by 6&#160;weeks post-injury. To take advantage of in vivo analysis of the regenerative process available in the transparent larval zebrafish as well as genetic tools not accessible in the adult, we use the larval zebrafish to study regeneration after spinal cord transection. Here we demonstrate a method for reproducibly and verifiably transecting the larval spinal cord. After transection, our data shows sensory recovery beginning at 2&#160;days post-injury (dpi), with the C-bend movement detectable by 3 dpi and resumption of free swimming by 5 dpi. Thus we propose the larval zebrafish as a companion tool to the adult zebrafish for the study of recovery after spinal cord injury.

After spinal transection, adult zebrafish have functional recovery by six weeks post-injury. To take advantage of larval transparency and faster recovery, we present a method for transecting the larval spinal cord. After transection, we observe sensory recovery beginning at 2&#160;days post-injury, and C-bend movement by 3 days post-injury.

Spinal Cord Transection dans le poisson zèbre larvaire

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability ...

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, germ cell development, piRNA biology, and niche formation. Here, we present a dissection technique to live-image the gonad ex vivo during a period when in vivo live-imaging is highly ineffective. This protocol outlines how to transfer embryos to an imaging dish, choose appropriately-staged male embryos, and dissect the gonad from its surrounding tissue while still maintaining its structural integrity. Following dissection, gonads can be imaged using a confocal microscope to visualize dynamic cellular processes. The dissection procedure requires precise timing and dexterity, but we provide insight on how to prevent common mistakes and how to overcome these challenges. To our knowledge this is the first dissection protocol for the Drosophila embryonic gonad, and will permit live-imaging during an otherwise inaccessible window of time. This technique can be combined with pharmacological or cell-type specific transgenic manipulations to study any dynamic processes occurring within or between the&#160;cells in their natural gonadal environment.

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

Here, we provide a dissection protocol required to live-image the late embryonic Drosophila male gonad. This protocol will permit observation of dynamic cellular processes under normal conditions or after transgenic or pharmacological manipulation.

Dissection et imagerie en direct de la drosophile embryonnaire tardive Gonad

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, ...

Biologie du développement

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Microdissection de tissus embryonnaires Zebrafish Eye

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Eye Removal in Living Zebrafish Larvae to Examine Innervation-dependent Growth and Development of the Visual System

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis support continuous growth of the entire visual system, both in the eye and the brain. Coordinated growth between the retinae and the optic tectum ensures accurate retinotopic mapping as new neurons are added in the eyes and brain. To address whether retinal axons provide crucial information for regulating tectal stem and progenitor cell behaviors such as survival, proliferation, and/or differentiation, it is necessary to be able to compare innervated and denervated tectal lobes within the same animal and across animals. 
Surgical removal of one eye from living larval zebrafish followed by observation of the optic tectum achieves this goal. The accompanying video demonstrates how to anesthetize larvae, electrolytically sharpen tungsten needles, and use them to remove one eye. It next shows how to dissect brains from fixed zebrafish larvae. Finally, the video provides an overview of the protocol for immunohistochemistry and a demonstration of how to mount stained embryos in low-melting-point agarose for microscopy.

The article explains how to surgically remove eyes from living zebrafish larvae as the first step toward investigating how retinal input influences optic tectum growth and development. In addition, the article provides information about larval anesthetization, fixation, and brain dissection, followed by immunohistochemistry and confocal imaging.

Enlèvement des yeux chez les larves vivantes de poisson zèbre pour examiner la croissance et le développement du système visuel dépendants de l’innervation

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis ...

Traitement de cellules intestinales à partir de larves de poisson-zèbre pour le séquençage de l’ARN unicellulaire

Gut Isolation from Zebrafish Larvae for Single-cell RNA Sequencing

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric neuromuscular disorders, highlighting the importance to understand the molecular mechanisms underlying GI development and dysfunction. In this study, we present a method for gut isolation from zebrafish larvae at 5 days post fertilization to obtain live,&#160;viable cells which can be used for single-cell RNA sequencing (scRNA-seq) analysis. This protocol is based on the manual dissection of the zebrafish intestine, followed by enzymatic dissociation with papain. Subsequently, cells are submitted to fluorescence-activated cell sorting, and viable cells are collected for scRNA-seq. With this method, we were able to successfully identify different intestinal cell types, including epithelial, stromal, blood, muscle, and immune cells, as well as enteric neurons and glia. Therefore, we consider it to be a valuable resource for studying the composition of the GI tract in health and disease, using the zebrafish.

Pleins feux sur l’auteur : Isoler et analyser les cellules intestinales de larves de poisson-zèbre pour étudier les aspects transcriptomiques du développement gastro-intestinal 

Here, we describe a method for gut isolation from zebrafish larvae at 5 days post fertilization, for single-cell RNA sequencing analysis.

Isolement intestinal de larves de poisson-zèbre pour le séquençage de l’ARN unicellulaire

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric ...

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work examining post-embryonic through adult cardiac development has been limited7-10. Examining the changing morphology of the maturing and aging heart are restricted by the lack of techniques available for staging and isolating juvenile and adult hearts. In order to analyze heart development over the fish's lifespan, we dissect zebrafish hearts at numerous stages and photograph them for further analysis11. The morphological features of the heart can easily be quantified and individual hearts can be further analyzed by a host of standard methods. Zebrafish grow at variable rates and maturation correlates better with fish size than age, thus, post-fixation, we photograph and measure fish length as a gauge of fish maturation. This protocol explains two distinct, size dependent dissection techniques for zebrafish, ranging from larvae 3.5mm standard length (SL) with hearts of 100&mu;m ventricle length (VL), to adults, with SL of 30mm and VL 1mm or larger. Larval and adult fish have quite distinct body and organ morphology. Larvae are not only significantly smaller, they have less pigment and each organ is visually very difficult to identify. For this reason, we use distinct dissection techniques.
We used pre-dissection fixation procedures, as we discovered that hearts dissected directly after euthanization have a more variable morphology, with very loose and balloon like atria compared with hearts removed following fixation. The fish fixed prior to dissection, retain in vivo morphology and chamber position (data not shown). In addition, for demonstration purposes, we take advantage of the heart (myocardial) specific GFP transgenic Tg(myl7:GFP)twu34 (12), which allows us to visualize the entire heart and is particularly useful at early stages in development when the cardiac morphology is less distinct from surrounding tissues. Dissection of the heart makes further analysis of the cell and molecular biology underlying heart development and maturation using in situ hybridization, immunohistochemistry, RNA extraction or other analytical methods easier in post-embryonic zebrafish. This protocol will provide a valuable technique for the study of cardiac development maturation and aging.

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

A clear, standardized method for dissection and isolation of the zebrafish heart at multiple developmental stages are described. Annotation and quantification techniques are also discussed.

Dissection du cœur chez les larves, le poisson zèbre juvéniles et adultes, Danio rerio</em

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work ...

Dissection de tissu gonadique Larval Zebrafish

Résumé

Explorer plus de vidéos

Chapitres dans cette vidéo

Dissection et montage latéral embryons de poisson zèbre: Analyse de la moelle épinière développement

Dissection d'organes sur le poisson zèbre pour adultes

Spinal Cord Transection dans le poisson zèbre larvaire

Dissection et imagerie en direct de la drosophile embryonnaire tardive Gonad

Microdissection de tissus embryonnaires Zebrafish Eye

Enlèvement des yeux chez les larves vivantes de poisson zèbre pour examiner la croissance et le développement du système visuel dépendants de l’innervation

Isolement intestinal de larves de poisson-zèbre pour le séquençage de l’ARN unicellulaire

Isolement intestinal de larves de poisson-zèbre pour le séquençage de l’ARN unicellulaire

Isolement intestinal de larves de poisson-zèbre pour le séquençage de l’ARN unicellulaire

Dissection du cœur chez les larves, le poisson zèbre juvéniles et adultes, Danio rerio