Ringraziamo C Zhang per la cura dei pesci. Questo lavoro è stato sostenuto dalla National Science Foundation naturali della Cina (31.171.074, 31.371.099 e 31.571.067 di GP) e dal talento Progetto Pujiang (09PJ1401900 a GP).

Esperimenti zebrafish sono stati approvati dal Comitato Istituzionale cura degli animali e Usa Fudan University. Zebrafish sono state sollevate e allevati secondo le procedure standard 20. 1. preparativi <ol><li> Coltivare 17 dpf e 25 dpf zebrafish larvale <ol><li> Trasferimento 2 maschi e 2 femmine zebrafish adulti (in buona salute, da 3 a 6 mesi di età, di laboratorio AB strain) ad un serbatoio traversata nel tardo pomeriggio prima del giorno traversata. Separare i maschi e le femmine con una barriera. La mattina seguente, rinfrescare l&#39;acqua della vasca e togliere la barriera per consentire loro di accoppiarsi. Raccogliere uova a 100 mm di Petri 1 a 2 h dopo la fecondazione. </li><li> Tenere circa 40 embrioni in un piatto 100 millimetri con 40 ml di media embrione (EM) a 28,5 ° C durante il periodo di sviluppo iniziale (4 giorni) e aggiornare la EM due volte al giorno. Trasferimento larve a 1 serbatoi L (40 larve per 300 dell&#39;acqua del sistema mL) e si nutrono con rotiferi dal vivo (fornitura completa, due volte al giorno), dopo 5 dpf.Live feed artemie, invece di dieta rotifero dopo 10 dpf. Trasferire il pesce nel sistema ricircolo dell&#39;acqua a 14 dpf 21. </li><li> Sollevare zebrafish larvale nel sistema di ricircolo dell&#39;acqua fino al 17 dpf o 25 dpf. Garantire il ciclo luce / buio è 14/10 h ed il pH valore dell&#39;acqua sistema è di circa 7.2. Misurare la lunghezza del corpo di 17 dpf (5,5 a 6,8 millimetri) e 25 dpf (da 8 a 11 mm) larve 22. </li></ol></li><li> Preparare 2% agar per la dissezione. <ol><li> Aggiungere 4 g di agar a 200 ml di acqua sterile. Scaldare la miscela in un forno a microonde fino a quando si scopre trasparente. </li><li> Raffreddare la soluzione di agar per circa 15 minuti, poi versarlo in 60 mm di diametro Petri piatti (circa 1/3 del volume della piastra). Conservare le piastre di agar solidificato a 4 ° C. </li></ol></li></ol> 2. Protocollo 1: sezionare il tessuto gonadico del 17 e 25 dpf Larve <ol><li> Aggiungere ghiaccio tritato nel serbatoio per anestetizzare 17 dpf larve. trasferire illarve anestetizzato a un 100 mm refrigerate Petri con la soluzione di 30 ml di freddo Ringer. Mantenere il pesce incubate in soluzione della refrigerate di Ringer per almeno 15 minuti per anestetizzare completamente le larve. </li><li> Trasferire le larve di una piastra di agar pre-raffreddata con un cucchiaio di plastica di piccole dimensioni. Immergere l&#39;intero corpo di pesce in 10 ml refrigerate soluzione di Ringer e delicatamente adagiarla su un fianco. </li><li> Effettuare le seguenti operazioni sotto il campo di visione stereo microscopio 25X. Bloccare il tronco di pesce con una pinzetta per la stabilizzazione. Strappare l&#39;addome longitudinalmente dall&#39;ano al cuore con un altro paio di pinzette. Rimuovere delicatamente la pelle ed i muscoli su un lato del corpo per esporre gli organi interni. </li><li> Rimuovere la massa di organi ventrali alla vescica natatoria con attenzione. Evitare di danneggiare gonade attaccato alla vescica natatoria. </li><li> Tagliare il collegamento tra la vescica natatoria e il corpo anteriore. Estrarre l&#39;intera vescica natatoria e tessuto gonadico delicatamente. NOTA: Nella maggior parte casos, il tessuto gonadico a 17 dpf contiene circostante tessuto epiteliale e protonephridium. Essi non sono facilmente separati l&#39;uno dall&#39;altro, ma a 25 dpf può essere facilmente separati. Gonade è collegato anche l&#39;ano. Una giunzione con gonadi sinistra e destra collegati tra loro alle ano sarà chiaramente visibile. </li><li> Utilizzare le pinzette per separare con attenzione il tessuto gonadico dalla vescica natatoria e ripulire i tessuti adiposi circostanti. </li><li> trasferire immediatamente il tessuto gonadico isolato ad un prechilled 1,5 mL provetta contenente una soluzione di 200 microlitri Ringer. Tenere la provetta in ghiaccio fino a quando tutti i tessuti gonadici sono separati dal larve. </li><li> Sezionare le gonadi di 25 DPF larve come descritto nei punti 2.1 - 2.7. </li></ol> 3. Protocollo 2: Analisi di espressione genica dei tessuti gonadici isolati <ol><li> Estrarre l&#39;RNA totale dai tessuti gonadici larvali. <ol><li> Trasferire i isolati tessuti gonadici ad un nuovo RNase-free 1.5 ml di tubo e rimuovere soluzione di Ringer. Aggiungere 100 microlitri soluzione di lisi. Vortice finché i tessuti sono completamente lisato. </li><li> Eseguire la procedura di estrazione dell&#39;RNA totale secondo le istruzioni del produttore. </li><li> Aggiungere 1/10 volume di 10x DNasi I buffer e 1 ml di DNasi I per la soluzione di RNA e mescolare delicatamente. Incubare per 20 minuti a 37 ° C. </li><li> Aggiungere 1/10 del volume di reagente DNasi inattivazione alla soluzione di RNA. Incubare per 10 minuti a 70 ° C. Misurare la concentrazione di RNA totale utilizzando uno spettrofotometro. Conservare a -20 ° C. </li></ol></li><li> Eseguire sintesi del DNA prima filamento <ol><li> Utilizzare un oligo (dT) Primer -linker per eseguire la sintesi del primo filamento di cDNA seguendo il protocollo del produttore. Aggiungere 1 a 2 mg di RNA per un volume totale di reazione a 20 ml. </li><li> Incubare la soluzione di reazione per 90 minuti a 45 ° C. Terminare la reazione mediante riscaldamento a 70 ° C per 5 min. </li><li> Aggiungere 1 ml RNasi H al cDNA cosìluzione per rimuovere l&#39;RNA residua. Mescolare delicatamente e centrifugare per 10 s a ~ 13.000 x g. Incubare per 20 minuti a 37 ° C. Aggiungere 20 ml di acqua priva di nucleasi. Conservare a -70 ° C. </li></ol></li><li> Eseguire fluorescente PCR quantitativa <ol><li> Eseguire qPCR su un sistema ciclatore con un colorante fluorescente. Utilizzare i seguenti PCR condizioni di ciclo: 35 cicli a 95 ° C per 15 s, Tm-5 ° C per 15 s, 68 ° C per 30 s. Utilizzare sequenze primer come segue: AMH (fwd: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (fwd: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (fwd: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), vasa (fwd: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) e β-actina (fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA) 19. </li></ol></li></ol>

<ol>
	<li>Wilson, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wild+sex+in+zebrafish:+loss+of+the+natural+sex+determinant+in+domesticated+strains.">Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains.</a> Genetics. 198 (3), 1291-1308 (2014).</li><li>Liew, W. C., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+sex:+a+complicated+affair.">Zebrafish sex: a complicated affair.</a> Genomics. 13 (2), 172-187 (2014).</li><li>Orban, L., Sreenivasan, R., Olsson, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+and+winding+roads:+Testis+differentiation+in+zebrafish.">Long and winding roads: Testis differentiation in zebrafish.</a> Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).</li><li>Blaser, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transition+from+non-motile+behaviour+to+directed+migration+during+early+PGC+development+in+zebrafish.">Transition from non-motile behaviour to directed migration during early PGC development in zebrafish.</a> J. Cell Sci. 118, 4027-4038 (2005).</li><li>Wang, X. G., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-M&#252;llerian+hormone+and+11+&#946;-hydroxylase+show+reciprocal+expression+to+that+of+aromatase+in+the+transforming+gonad+of+zebrafish+males.">Anti-M&#252;llerian hormone and 11 &#946;-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males.</a> Dev. Dynam. 236 (5), 1329-1338 (2007).</li><li>Siegfried, K. R., N&#252;sslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+control+of+female+sex+determination+in+zebrafish.">Germ line control of female sex determination in zebrafish.</a> Dev. Biol. 324 (2), 277-287 (2008).</li><li>Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+apoptosis+during+the+transition+from+ovary-like+tissue+to+testes+during+sex+differentiation+of+juvenile+zebrafish.">Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish.</a> J. Exp. Biol. 205 (Pt 6), 711-718 (2002).</li><li>Groh, K. J., Sch&#246;nenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+expression+in+zebrafish+during+gonad+differentiation+by+targeted+proteomics.">Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics.</a> Gen. Comp. Endocr. 193, 210-220 (2013).</li><li>Siegfried, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+search+of+determinants:+gene+expression+during+gonadal+sex+differentiation.">In search of determinants: gene expression during gonadal sex differentiation.</a> J. Fish Biol. 76 (8), 1879-1902 (2010).</li><li>Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microarray+analysis+of+sex-+and+gonad-biased+gene+expression+in+the+zebrafish:+evidence+for+masculinization+of+the+transcriptome.">A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome.</a> BMC Genomics. 10, 579 (2009).</li><li>Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+Cyp19+(P450+aromatase)+genes+on+duplicated+zebrafish+chromosomes+are+expressed+in+ovary+or+brain.">Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain.</a> Mol. Biol. Evol. 18 (4), 542-550 (2001).</li><li>Kishida, M., Callard, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cytochrome+P450+aromatase+isoforms+in+zebrafish+(Danio+rerio)+brain+and+ovary+are+differentially+programmed+and+estrogen+regulated+during+early+development.">Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development.</a> Endocrinology. 142 (2), 740-750 (2001).</li><li>Rodr&#237;guez-Mar&#237;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+expression+pattern+of+zebrafish+anti-M&#252;llerian+hormone+(amh)+relative+to+sox9a,+sox9b,+and+cyp19a1a,+during+gonad+development.">Characterization and expression pattern of zebrafish anti-M&#252;llerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development.</a> Gene Expr.Patterns. 5 (5), 655-667 (2005).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+a+vas::EGFP+transgene+in+primordial+germ+cells+of+the+zebrafish.">Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish.</a> Mech Dev. 116 (1-2), 141-150 (2002).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sexual+dimorphic+expression+pattern+of+a+splice+variant+of+zebrafish+vasa+during+gonadal+development.">Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development.</a> Dev. Biol. 271 (1), 190-197 (2004).</li><li>Tzung, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+depletion+of+primordial+germ+cells+in+zebrafish+promotes+testis+formation.">Early depletion of primordial germ cells in zebrafish promotes testis formation.</a> Stem Cell Reports. 4 (1), 61-73 (2015).</li><li>Hsiao, C., Tsai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+zebrafish+with+fluorescent+germ+cell:+a+useful+tool+to+visualize+germ+cell+proliferation+and+juvenile+hermaphroditism+in+vivo.">Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo.</a> Dev. Biol. 262 (2), 313-323 (2003).</li><li>Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection+of+gonads+from+juvenile+zebrafish.">Laser capture microdissection of gonads from juvenile zebrafish.</a> Reprod Biol Endocrinol. 7, 97 (2009).</li><li>Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=nr0b1+(DAX1)+mutation+in+zebrafish+causes+female-to-male+sex+reversal+through+abnormal+gonadal+proliferation+and+differentiation.">nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.</a> Mol. Cell. Endocrinol. 433, 105-116 (2016).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). , (2000).</li><li>Liew, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polygenic+sex+determination+system+in+zebrafish.">Polygenic sex determination system in zebrafish.</a> PLoS One. 7 (4), e34397 (2012).</li><li>Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normal+table+of+postembryonic+zebrafish+development:+staging+by+externally+visible+anatomy+of+the+living+fish.">Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish.</a> Dev Dyn. 238 (12), 2975-3015 (2009).</li><li>Gupta, T., Mullins, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+Organs+from+the+Adult+Zebrafish.">Dissection of Organs from the Adult Zebrafish.</a> J. Vis Exp. (37), (2010).</li><li>Arnaout, R., Reischauer, S., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recovery+of+Adult+Zebrafish+Hearts+for+High-throughput+Applications.">Recovery of Adult Zebrafish Hearts for High-throughput Applications.</a> J. Vis Exp. (94), (2014).</li><li>Gerlach, G. F., Schrader, L. N., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+Adult+Zebrafish+Kidney.">Dissection of the Adult Zebrafish Kidney.</a> J. Vis Exp. (54), (2011).</li><li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells.">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li><li>Braat, A. K., Speksnijder, J. E., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+development+in+fishes.">Germ line development in fishes.</a> Int. J. Dev. Biol. 43 (7), 745-760 (1999).</li><li>Huang, H. Y., Ketting, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+zebrafish+gonads+for+RNA+isolation.">Isolation of zebrafish gonads for RNA isolation.</a> Methods Mol Biol. 1093, 183-194 (2014).</li></ol>

Gli autori dichiarano di non avere interessi finanziari in competizione.

Il pesce zebra è diventato un modello potente ed è ampiamente utilizzato nello sviluppo e nella ricerca sulle malattie correlate. I metodi per l&#39;isolamento degli organi in zebrafish adulti come il cervello, il cuore, gonadi, e del rene, sono stati ben documentati 23, 24, 25. A causa delle piccole dimensioni e rimodellamento dinamica dei tessuti gonadici nella zebrafish larvale, isolamento di tessuto gonadico è un compito...

Il principale determinante del sesso femminile nel selvaggio cromosoma zebrafish 4 è perso o modificato nel zebrafish addomesticato (vale a dire i ceppi più comuni di laboratorio) 1. Al contrario, hanno un sistema di determinazione del sesso poligenica accompagnato da fattori ambientali come la temperatura, l&#39;ipossia, la disponibilità di cibo e la densità di popolazione. I meccanismi dettagliati dello sviluppo sessuale zebrafish non sono pienamente compresi. Domande fondamentali come quando si verifica determinazione del sesso zebrafish, ciò che il segnale determinazione sessuale primaria (s) è / sono, e quali geni regolano il primo passo di trasformazione gonadi restano da risolvere 2, 3. Nel processo di sviluppo sessuale zebrafish, più tappe importanti sono state riconosciute. Nella fase iniziale di sviluppo, a partire dal 4 HPF (ore dopo la fecondazione) cellule germinali primordiali (PGC) sottoporsi specifica, migrazione cresta genitale eproliferazione. Numeri PGC e interazioni reciproche tra cellule germinali e cellule somatiche sono importanti per gonadi differenziazione 4. A 13 dpf (giorni dopo la fecondazione), le gonadi sono in fase indifferenziata. Con 17 DPF, le gonadi si sviluppano in ovaie bi-potenziali in entrambi i maschi e femmine futuri. La transizione apoptosi dipendente da ovaio al testicolo inizio alle 21 a 25 dpf e può continuare per diverse settimane. Da 35 dpf, il sesso della gonade è stata determinata e produzione di gameti sesso-specifico è in corso in entrambe le ovaie e testicoli 5, 6, 7. Fino ad oggi, sono stati proposti diversi geni candidati ei meccanismi di determinazione del sesso. Proteomica e analisi trascrittomica hanno isolato molti geni con espressione dimorfismo sessuale e questi geni sono stati utilizzati per studiare la differenziazione del sesso in zebrafish 8, </sup&gt; 9, 10. Ad esempio, in zebrafish larvale, il gene cyp19a1a è specificamente espresso nelle ovaie, ma non nel testicolo 11, 12. Inoltre, gene amh è debolmente espressa nelle cellule follicolo granulosa ovarica, ma fortemente nei testicoli cellule di Sertoli 13. Al contrario, gene vasa continuamente espresso nelle cellule germinali sia zebrafish maschile e femminile, che lo rendono adatto marcatore gonadi 14, 15. Indagare gonadici livelli di espressione genica è fondamentale per capire il meccanismo molecolare di determinazione del sesso e la differenziazione soprattutto nella fase ovaie bi-potenziale 3, 9. Tuttavia, le piccole dimensioni delle zebrafish larvale e corrispondentemente piccole gonadi complicare l&#39;isolamento di gonadal tessuti per ulteriori analisi molecolari. Precedenti studi utilizzati sezionati tutta la regione del tronco tra l&#39;opercoli e pori anale 16. Questa preparazione, anche se contenenti gonadi, costituito da più tessuti e organi. In alternativa, gli animali transgenici con espressione GFP specifico gonade come vasa: EGFP sono stati usati per l&#39;isolamento tessuto gonadico mediante fluorescenza delle cellule attivate (FACS) e la cattura laser micro-dissezione 17, 18. Ma la loro applicazione diffusa è limitata. Qui, descriviamo una semplice procedura per isolare il tessuto gonadico da zebrafish larvale a 17 dpf e 25 dpf. Dimostriamo la posizione delle gonadi rispetto ad altri organi e isolare le gonadi morfologicamente intatte dai tessuti circostanti. Mostriamo ulteriormente i geni specifici gonade come vasa e cyp19a1a sono altamente espresso nelle gonadi isolate rispetto al tessuto tronco tramite PCR quantitativa (qPCR) analisi. Il presente protocollo permette l&#39;identificazione, l&#39;isolamento, la purificazione dell&#39;RNA e l&#39;amplificazione di geni specifici gonadici da zebrafish larvale, consentendo così successiva analisi molecolare del tessuto gonadica 19.

<table border="0" cellpadding="0" cellspacing="0" width="975">
	<tbody>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Cell culture dish 100 mm</td>
			<td style="width:208px;">Corning</td>
			<td style="width:208px;">430167</td>
			<td style="width:351px;">For embryo incubation</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:208px;">20 X EM</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">For a 1 liter needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl.2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4. 7H2O.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">1 X EM</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">Dilute 20 X EM in distilled water</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">AGAROSE G-10</td>
			<td style="width:208px;">Gene</td>
			<td style="width:208px;">121985</td>
			<td style="width:351px;">For preparing the 2% agar plates&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Trizol Reagent</td>
			<td style="width:208px;">Invitrogen</td>
			<td style="width:208px;">15596-026</td>
			<td style="width:351px;">For RNA isolation&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Meter glass</td>
			<td style="width:208px;">Shen Bo</td>
			<td style="width:208px;">250 ml</td>
			<td style="width:351px;">For preparing the 2% agar plates&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Microwave Oven</td>
			<td style="width:208px;">Midea</td>
			<td style="width:208px;">M1-211A</td>
			<td style="width:351px;">For heating the AGAR</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">TWEEZER DUMONT#5INOX</td>
			<td style="width:208px;">World Precision Instrument</td>
			<td style="width:208px;">500341</td>
			<td style="width:351px;">For dissection</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Stereomicroscope</td>
			<td style="width:208px;">Motic</td>
			<td style="width:208px;">SMZ168</td>
			<td style="width:351px;">For dissection</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Pure water equipment</td>
			<td style="width:208px;">Millipore</td>
			<td style="width:208px;"></td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="81">
			<td height="81" style="height:81px;width:208px;">Ringer&#8217;s solution</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">For a 1 liter needed: Add 6.78g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Transfer pipette</td>
			<td style="width:208px;">Samco</td>
			<td style="width:208px;">202, 204</td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Metal bath</td>
			<td style="width:208px;">QiLinbeier</td>
			<td style="width:208px;"></td>
			<td style="width:351px;">Model GL-150</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Microscope</td>
			<td style="width:208px;">Leica&#160;</td>
			<td style="width:208px;">M205 FA</td>
			<td style="width:351px;">For photomicrograph</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Centrifuge</td>
			<td style="width:208px;">Eppendorf</td>
			<td style="width:208px;">5417R</td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Micro Scale RNA Isolation Kit&#160;</td>
			<td style="width:208px;">Ambion</td>
			<td style="width:208px;">AM1931</td>
			<td style="width:351px;">For RNA isolation from gonad tissues</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Dnase I&#160;</td>
			<td style="width:208px;">Sigma</td>
			<td style="width:208px;">AMPD1-1KT</td>
			<td style="width:351px;">For DNA digestion in the RNA solution&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">RevertAid First Strand cDNA Synthesis Kit</td>
			<td style="width:208px;">Thermo Scientific</td>
			<td style="width:208px;">#K1631</td>
			<td style="width:351px;">For&#160; first-strand cDNA synthesis</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Rnase H&#160;</td>
			<td style="width:208px;">Thermo Scientific</td>
			<td style="width:208px;">#EN0202</td>
			<td style="width:351px;">For digesting the residual RNA in the cDNA solution.</td>
		</tr>
		<tr height="98">
			<td height="98" style="height:98px;width:208px;">SYBR Green Realtime PCR Master Mix</td>
			<td style="width:208px;">TOYOBO</td>
			<td style="width:208px;">QPK-201</td>
			<td style="width:351px;">This product is a Taq DNA polymerase-based 2 x master mix for real-time PCR and&#160; applicable for intercalation assay with SYBR Green I.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Spectrophotometer</td>
			<td style="width:208px;">Ne Drop</td>
			<td style="width:208px;">OD-2000+</td>
			<td>Measuring the concentration of the total RNA</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Mastercycler</td>
			<td style="width:208px;">Eppendorf</td>
			<td style="width:208px;">AG 22331 Hamburg</td>
			<td>gene expression profiling</td>
		</tr>
	</tbody>
</table>

dissection of larval zebrafish gonadal tissue

Anche se zebrafish selvatici in possesso di un / ZW determinazione del sesso ZZ, zebrafish addomesticato hanno perso il cromosoma sessuale. Essi utilizzano un sistema di determinazione del sesso poligenica, in cui diversi geni distribuiti in tutto il genoma determinare collettivamente le identità sessuali di singoli pesci. Attualmente, i geni coinvolti nella regolazione dello sviluppo delle gonadi e come funzionano rimangono sfuggente. Normalmente, isolando tessuto gonadico è il primo passo per esaminare i processi di sviluppo del sesso. Qui vi presentiamo una procedura per isolare il tessuto gonadico da 17 dpf (giorni dopo la fecondazione) e 25 dpf larve di zebrafish. Il tessuto gonadico isolato può essere successivamente esaminati dalla morfologia e l&#39;espressione genica.

Dissezioni delle gonadi sono state effettuate su AB strain zebrafish larvale. La figura 1 mostra tessuto tipico gonadi di zebrafish larvale a 17 dpf e 25 dpf. In primo luogo, la pelle ei muscoli di un lato dell&#39;addome viene tagliato per esporre gli organi interni. Dopo aver rimosso la massa degli organi interni, la vescica natatoria insieme gonade rimangono nel bagagliaio. Gonade era attaccato alla faccia ventrale vescica natatoria (freccia in <strong cl...

Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Dissection of Larval Zebrafish Gonadal Tissue

Qui, vi presentiamo un protocollo per isolare il tessuto gonadico di zebrafish larvale, che faciliterà le indagini della differenziazione sessuale zebrafish e manutenzione.

La dissezione del larvale Zebrafish gonadica Tissue

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex ...

dissection-of-larval-zebrafish-gonadal-tissue

Research

JoVE Journal

Developmental Biology

10.2K Views.  Fudan University.  Qui, vi presentiamo un protocollo per isolare il tessuto gonadico di zebrafish larvale, che faciliterà le indagini della differenziazione sessuale zebrafish e manutenzione. 

Video: Dissection of Larval Zebrafish Gonadal Tissue

Large-scale Zebrafish Embryonic Heart Dissection for Transcriptional Analysis

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the cardiac transcriptome from being masked by the global embryonic transcriptome, it is necessary to collect sufficient numbers of hearts for further analyses. Furthermore, as zebrafish cardiac development proceeds rapidly, heart collection and RNA extraction methods need to be quick in order to ensure homogeneity of the samples. Here, we present a rapid manual dissection protocol for collecting functional/beating hearts from zebrafish embryos. This is an essential prerequisite for subsequent cardiac-specific RNA extraction to determine cardiac-specific gene expression levels by transcriptome analyses, such as quantitative real-time polymerase chain reaction (RT-qPCR). The method is based on differential adhesive properties of the zebrafish embryonic heart compared with other tissues; this allows for the rapid physical separation of cardiac from extracardiac tissue by a combination of fluidic shear force disruption, stepwise filtration and manual collection of transgenic fluorescently labeled hearts.

To analyse cardiac gene expression profiles during zebrafish heart development, total RNA has to be extracted from isolated hearts. Here, we present a protocol for collecting functional/beating hearts by rapid manual dissection from zebrafish embryos to obtain cardiac-specific mRNA.

Su larga scala Zebrafish embrionali Cuore dissezione per l&#39;analisi trascrizionale

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the ...

Ricerca

Biologia dello sviluppo

Live Imaging of Innate Immune and Preneoplastic Cell Interactions Using an Inducible Gal4/UAS Expression System in Larval Zebrafish Skin

Here we describe a method to conditionally induce epithelial cell transformation by the use of the 4-Hydroxytamoxifen (4-OHT) inducible KalTA4-ERT2/UAS expression system1 in zebrafish larvae, and the subsequent live imaging of innate immune cell interaction with HRASG12V expressing skin cells. The KalTA4-ERT2/UAS system is both inducible and reversible which allows us to induce cell transformation with precise temporal/spatial resolution in vivo. This provides us with a unique opportunity to live image how individual preneoplastic cells interact with host tissues as soon as they emerge, then follow their progression as well as regression. Recent studies in zebrafish larvae have shown a trophic function of innate immunity in the earliest stages of tumorigenesis2,3. Our inducible system would allow us to live image the onset of cellular transformation and the subsequent host response, which may lead to important insights on the underlying mechanisms for the regulation of oncogenic trophic inflammatory responses. We also discuss how one might adapt our protocol to achieve temporal and spatial control of ectopic gene expression in any tissue of interest.

Studying the earliest events of preneoplastic cell progression and innate immune cell interaction is pivotal to understand and treat cancer. Here we describe a method to conditionally induce epithelial cell transformations and the subsequent live imaging of innate immune cell interaction with HRASG12V expressing skin cells in zebrafish larvae.

Immagini dal vivo di Innata immunitario e preneoplastiche interazioni cella utilizzando un / UAS Expression System inducibile GAL4 in Zebrafish larvale pelle

Here we describe a method to conditionally induce epithelial cell transformation by the use of the 4-Hydroxytamoxifen (4-OHT) inducible KalTA4-ERT2/UAS ...

Capturing Tissue Repair in Zebrafish Larvae with Time-lapse Brightfield Stereomicroscopy

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two layers of skin that enclose undifferentiated mesenchyme, and because the larval tail fin regenerates rapidly within 2-3 days. Using this system, we demonstrate a method for capturing the repair dynamics of the amputated tail fin with time-lapse video brightfield stereomicroscopy. We demonstrate that fin amputation triggers a contraction of the amputation wound and extrusion of cells around the wound margin, leading to their subsequent clearance. Fin regeneration proceeds from proximal to distal direction after a short delay. In addition, developmental growth of the larva can be observed during all stages. The presented method provides an opportunity for observing and analyzing whole tissue-scale behaviors such as fin development and growth in a simple microscope setting, which is easily adaptable to any stereomicroscope with time-lapse capabilities.

We present a protocol for capturing the dynamics of zebrafish larval tail fin regeneration on a whole-tissue scale using brightfield-based stereomicroscopy. This technique enables capturing the regeneration dynamics with single cell resolution. This methodology can be adapted to any stereomicroscope equipped with a CCD camera and time-lapse software.

Catturare Tissue Repair in Zebrafish Larve con Time-lapse Brightfield stereomicroscopia

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two ...

Visualizing the Interrenal Steroidogenic Tissue and Its Vascular Microenvironment in Zebrafish

This protocol introduces how to detect differentiated interrenal steroidogenic cells through a simple whole-mount enzymatic activity assay. Identifying differentiated steroidogenic tissues through chromogenic histochemical staining of 3-&#946;-Hydroxysteroid dehydrogenase /&#916;5-4 isomerase (3&#946;-Hsd) activity-positive cells is critical for monitoring the morphology and differentiation of adrenocortical and interrenal tissues in mammals and teleosts, respectively. In the zebrafish model, the optical transparency and tissue permeability of the developing embryos and larvae allow for whole-mount staining of 3&#946;-Hsd activity. This staining protocol, as performed on transgenic fluorescent reporter lines marking the developing pronephric and endothelial cells, enables the detection of the steroidogenic interrenal tissue in addition to the kidney and neighboring vasculature. In combination with vibratome sectioning, immunohistochemistry, and confocal microscopy, we can visualize and assay the vascular microenvironment of interrenal steroidogenic tissues. The 3&#946;-Hsd activity assay is essential for studying the cell biology of the zebrafish interrenal gland because to date, no suitable antibody is available for labeling zebrafish steroidogenic cells. Furthermore, this assay is rapid and simple, thus providing a powerful tool for mutant screens targeting adrenal (interrenal) genetic disorders as well as for determining disruption effects of chemicals on steroidogenesis in pharmaceutical or toxicological studies.

The interrenal gland in zebrafish is the teleostean counterpart of the mammalian adrenal gland. This protocol introduces how to perform the 3-&#946;-hydroxysteroid dehydrogenase (&#916;5-4 isomerase; 3&#946;-Hsd) enzymatic activity assay, which detects differentiated steroidogenic cells in the developing zebrafish.

Visualizzare il Tissue interrenale Steroidogenic e la sua Vascolare Microenvironment in Zebrafish

This protocol introduces how to detect differentiated interrenal steroidogenic cells through a simple whole-mount enzymatic activity assay. Identifying ...

Establishment of Larval Zebrafish as an Animal Model to Investigate Trypanosoma cruzi Motility In Vivo

Chagas disease is a parasitic infection caused by Trypanosoma cruzi, whose motility is not only important for localization, but also for cellular binding and invasion. Current animal models for the study of T. cruzi allow limited observation of parasites in vivo, representing a challenge for understanding parasite behavior during the initial stages of infection in humans. This protozoan has a flagellar stage in both vector and mammalian hosts, but there are no studies describing its motility in vivo.The objective of this project was to establish a live vertebrate zebrafish model to evaluate T. cruzi motility in the vascular system. Transparent zebrafish larvae were injected with fluorescently labeled trypomastigotes and observed using light sheet fluorescence microscopy (LSFM), a noninvasive method to visualize live organisms with high optical resolution. The parasites could be visualized for extended periods of time due to this technique&#39;s relatively low risk of photodamage compared to confocal or epifluorescence microscopy. T. cruzi parasites were observed traveling in the circulatory system of live zebrafish in different-sized blood vessels and the yolk. They could also be seen attached to the yolk sac wall and to the atrioventricular valve despite the strong forces associated with heart contractions. LSFM of T. cruzi-inoculated zebrafish larvae is a valuable method that can be used to visualize circulating parasites and evaluate their tropism, migration patterns, and motility in the dynamic environment of the cardiovascular system of a live animal.

Establishment of Larval Zebrafish as an Animal Model to Investigate Trypanosoma cruzi Motility In Vivo

In this protocol, fluorescently labeled T. cruzi&#160;were injected into transparent zebrafish larvae, and parasite motility was observed in vivo using light sheet fluorescence microscopy.

Stabilimento di larvale Zebrafish come modello animale per indagare Trypanosoma cruzi motilità In Vivo

Chagas disease is a parasitic infection caused by Trypanosoma cruzi, whose motility is not only important for localization, but also for cellular binding ...

Dissection and Staining of Drosophila Pupal Ovaries

Unlike adult Drosophila ovaries, pupal ovaries are relatively difficult to access and examine due to their small size, translucence, and encasing within a pupal case. The challenge of dissecting pupal ovaries also lies in their physical location within the pupa: the ovaries are surrounded by fat body cells inside the pupal abdomen, and these fat cells must be removed to allow for proper antibody staining. To overcome these challenges, this protocol utilizes customized Pasteur pipets to extract fat body cells from the pupal abdomen. Moreover, a chambered coverglass is used in place of a microcentrifuge tube during the staining process to improve visibility of the pupae. However, despite these and other advantages of the tools used in this protocol, successful execution of these techniques may still involve several days of practice due to the small size of pupal ovaries. The techniques outlined in this protocol could be applied to time course experiments in which ovaries are analyzed at various stages of pupal development.

Dissection and Staining of Drosophila Pupal Ovaries

The Drosophila ovary is an excellent model system for studying stem cell niche development. Though methods for dissecting larval and adult ovaries have been published, pupal ovary dissections require different techniques that have not been published in detail. Here we outline a protocol for dissecting, staining, and mounting pupal ovaries.

Dissezione e colorazione delle ovaie Pupal Drosophila

Unlike adult Drosophila ovaries, pupal ovaries are relatively difficult to access and examine due to their small size, translucence, and encasing within a ...

Following Endocardial Tissue Movements via Cell Photoconversion in the Zebrafish Embryo

During embryogenesis, cells undergo dynamic changes in cell behavior, and deciphering the cellular logic behind these changes is a fundamental goal in the field of developmental biology. The discovery and development of photoconvertible proteins have greatly aided our understanding of these dynamic changes by providing a method to optically highlight cells and tissues. However, while photoconversion, time-lapse microscopy, and subsequent image analysis have proven to be very successful in uncovering cellular dynamics in organs such as the brain or the eye, this approach is generally not used in the developing heart due to challenges posed by the rapid movement of the heart during the cardiac cycle. This protocol consists of two parts. The first part describes a method for photoconverting and subsequently tracking endocardial cells (EdCs) during zebrafish atrioventricular canal (AVC) and atrioventricular heart valve development. The method involves temporally stopping the heart with a drug in order for accurate photoconversion to take place. Hearts are allowed to resume beating upon removal of the drug and embryonic development continues normally until the heart is stopped again for high-resolution imaging of photoconverted EdCs at a later developmental time point. The second part of the protocol describes an image analysis method to quantify the length of a photoconverted or non-photoconverted region in the AVC in young embryos by mapping the fluorescent signal from the three-dimensional structure onto a two-dimensional map. Together, the two parts of the protocol allows one to examine the origin and behavior of cells that make up the zebrafish AVC and atrioventricular heart valve, and can potentially be applied for studying mutants, morphants, or embryos that have been treated with reagents that disrupt AVC and/or valve development.

This protocol describes a method for the photoconversion of Kaede fluorescent protein in endocardial cells of the living zebrafish embryo that enables the tracking of endocardial cells during atrioventricular canal and atrioventricular heart valve development.

Seguendo i movimenti del tessuto Endocardial tramite cella fotoconversione nell'embrione di pesce zebra

During embryogenesis, cells undergo dynamic changes in cell behavior, and deciphering the cellular logic behind these changes is a fundamental goal in the ...

Adult Zebrafish Injury Models to Study the Effects of Prednisolone in Regenerating Bone Tissue

Zebrafish are able to regenerate various organs, including appendages (fins) after amputation. This involves the regeneration of bone, which regrows within roughly two weeks after injury. Furthermore, zebrafish are able to heal bone rapidly after trepanation of the skull, and repair fractures that can be easily introduced into zebrafish bony fin rays. These injury assays represent feasible experimental paradigms to test the effect of administered drugs on rapidly forming bone. Here, we describe the use of these 3 injury models and their combined use with systemic glucocorticoid treatment, which exerts bone inhibitory and immunosuppressive effects. We provide a workflow on how to prepare for immunosuppressive treatment in adult zebrafish, illustrate how to perform fin amputation, trepanation of calvarial bones, and fin fractures, and describe how the use of glucocorticoids affects both bone forming osteoblasts and cells of the monocyte/macrophage lineage as part of innate immunity in bone tissue.

Here, we describe 3 adult zebrafish injury models and their combined use with immunosuppressive drug treatment. We provide guidance on imaging of regenerating tissues and on detecting bone mineralization therein.

Modelli di lesione di Zebrafish adulto per studiare gli effetti del Prednisolone nella rigenerazione di tessuto osseo

Zebrafish are able to regenerate various organs, including appendages (fins) after amputation. This involves the regeneration of bone, which regrows ...

Electroretinogram Recording in Larval Zebrafish using A Novel Cone-Shaped Sponge-tip Electrode

The zebrafish (Danio rerio) is commonly used as a vertebrate model in developmental studies and is particularly suitable for visual neuroscience. For functional measurements of visual performance, electroretinography (ERG) is an ideal non-invasive method, which has been well established in higher vertebrate species. This approach is increasingly being used for examining the visual function in zebrafish, including during the early developmental larval stages. However, the most commonly used recording electrode for larval zebrafish ERG to date is the glass micropipette electrode, which requires specialized equipment for its manufacture, presenting a challenge for laboratories with limited resources. Here, we present a larval zebrafish ERG protocol using a cone-shaped sponge-tip electrode. The novel electrode is easier to manufacture and handle, more economical, and less likely to damage the larval eye than the glass micropipette. Like previously published ERG methods, the current protocol can assess outer retinal function through photoreceptor and bipolar cell responses, the a- and b-wave, respectively. The protocol can clearly illustrate the refinement of visual function throughout the early development of zebrafish larvae, supporting the utility, sensitivity, and reliability of the novel electrode. The simplified electrode is particularly useful when establishing a new ERG system or modifying existing small-animal ERG apparatus for zebrafish measurement, aiding researchers in the visual neurosciences to use the zebrafish model organism.

Here, we present a protocol that simplifies the measurement of light evoked electroretinogram responses from larval zebrafish. A novel cone-shaped sponge-tip electrode can help to make the study of visual development in larval zebrafish using the electroretinogram ERG easier to achieve with reliable outcomes and lower cost.

Registrazione dell'elettroretinogramma in Zebrafish larvale con elettrodo di spugna-punta conica A romanzo

The zebrafish (Danio rerio) is commonly used as a vertebrate model in developmental studies and is particularly suitable for visual neuroscience. For ...

Quantifying Liver Size in Larval Zebrafish Using Brightfield Microscopy

In several transgenic zebrafish models of hepatocellular carcinoma (HCC), hepatomegaly can be observed during early larval stages. Quantifying larval liver size in zebrafish HCC models provides a means to rapidly assess the effects of drugs and other manipulations on an oncogene-related phenotype. Here we show how to fix zebrafish larvae, dissect the tissues surrounding the liver, photograph livers using bright-field microscopy, measure liver area, and analyze results. This protocol enables rapid, precise quantification of liver size. As this method involves measuring liver area, it may underestimate differences in liver volume, and complementary methodologies are required to differentiate between changes in cell size and changes in cell number. The dissection technique described herein is an excellent tool to visualize the liver, gut, and pancreas in their natural positions for myriad downstream applications including immunofluorescence staining and in situ hybridization. The described strategy for quantifying larval liver size is applicable to many aspects of liver development and regeneration.

Here we demonstrate a method for quantifying liver size in larval zebrafish, providing a way to assess the effects of genetic and pharmacologic manipulations on liver growth and development.

Quantificare le dimensioni del fegato nel pesce zebra Larval utilizzando la microscopia Brightfield

In several transgenic zebrafish models of hepatocellular carcinoma (HCC), hepatomegaly can be observed during early larval stages. Quantifying larval ...