Wir danken C Zhang für Fisch Pflege. Diese Arbeit wurde von der National Natural Science Foundation of China (31171074, 31371099 und 31571067 bis GP) und durch das Pujiang Talent Project (09PJ1401900 zu GP) unterstützt.

Zebrafisch-Experimente wurden von der Fudan University Institutional Animal Care und Use Committee genehmigt. Zebrafisch wurde angehoben und gezüchtet nach Standardverfahren 20. 1. Vorbereitungen <ol><li> Kultivieren 17 dpf und 25 dpf larvalen Zebrabärbling <ol><li> Transfer 2 männliche und 2 weibliche erwachsene Zebrabärbling (gesund, 3 bis 6 Monate alt, Labor AB-Stamm) an einer Kreuzung Tank am späten Nachmittag vor der Kreuzung Tag. Trennen Sie die Männchen und Weibchen mit einer Barriere. Am nächsten Morgen, aktualisieren Sie die Tankwasser und entfernen Sie die Barriere, damit sie sich paaren. Sammeln Eier in 100 mm Petrischalen mit 1 bis 2 h nach der Befruchtung. </li><li> Halten Sie etwa 40 Embryonen in einer 100-mm-Platte mit 40 ml Embryo Medium (EM) bei 28,5 ° C während der frühen Entwicklungsphase (4 Tage) und aktualisieren Sie die EM zweimal am Tag. Übertragen Larven auf 1 l-Tanks (40 Larven auf 300 ml Wasser-System) und Futtermittel mit Live-Rotatorien (Vollpension, zweimal täglich) nach 5 dpf.Feed-Live-Artemia statt rotifer Diät nach 10 dpf. Übertragen , um die Fische in rezirkulierenden Wassersystem bei 14 dpf 21. </li><li> Erhöhen larvalen Zebrabärbling im rezirkulierenden Wassersystem bis 17 dpf oder 25 dpf. Sicherstellen, dass der Hell / Dunkel-Zyklus ist 14/10 h und die pH-Wert des Systemwassers beträgt etwa 7,2. Messen Sie die Körperlänge von 17 dpf (5,5 bis 6,8 mm) und 25 dpf (8 bis 11 mm) 22 Larven. </li></ol></li><li> Bereiten 2% Agarplatten für die Dissektion. <ol><li> In 4 g Agar zu 200 ml sterilem Wasser. Das Gemisch wird in einem Mikrowellenofen, bis sie transparent macht. </li><li> Man kühlt die Agarlösung für etwa 15 min, dann gieße es in 60 mm Durchmesser Petrischalen (etwa 1/3 des Volumens der Platte). Lagern Sie die verfestigten Agar-Platten bei 4 ° C. </li></ol></li></ol> 2. Protokoll 1: Präparieren Sie die Keimdrüsengewebe von 17 und 25 dpf Larvae <ol><li> In zerstoßenem Eis in den Tank 17 dpf Larven zu betäuben. übertragen Sie dieanästhesiert Larven in einen 100 mm gekühlt Petrischal mit 30 ml kalter Ringer-Lösung. Halten Sie den inkubiert Fisch in der Lösung des gekühlten Ringers für mindestens 15 min vollständig die Larven zu betäuben. </li><li> Übertragen Sie die Larven zu einer vorgekühlten Agar-Platte mit einem kleinen Plastiklöffel. Tauchen Sie den gesamten Fischkörper in 10 ml gekühlt Ringer-Lösung und sanft liegt auf der Seite. </li><li> Führen Sie die folgenden Operationen im Rahmen der Vision Feld 25X Stereomikroskop. Spannen Sie den Fisch Stamm mit einer Pinzette zur Stabilisierung. Rip den Bauch in Längsrichtung vom Anus zum Herzen mit einem anderen Pinzette. Entfernen sanft die Haut und Muskeln auf der einen Seite des Körpers, um die inneren Organe zu belichten. </li><li> Entfernen Sie die Masse der Organe ventral die Schwimmblase vorsichtig. Vermeiden Sie die auf die Schwimmblase angebracht Gonaden zu beschädigen. </li><li> Schneiden Sie die Verbindung zwischen der Schwimmblase und vorderen Körpern. Ziehen Sie die gesamte Schwimmblase und Gonadengewebe vorsichtig heraus. HINWEIS: In den meisten Fällens, das Gonadengewebe bei 17 dpf enthält Epithelgewebe und protonephridium umgibt. Sie sind nicht leicht voneinander getrennt, aber bei 25 dpf leicht getrennt werden können. Die Gonaden sind auch mit dem Anus verbunden. Eine Kreuzung mit der linken und rechten Gonade zueinander sichtbar sein wird deutlich an den Anus verbunden. </li><li> Verwenden einer Pinzette vorsichtig die Gonadengewebe aus der Schwimmblase zu trennen und die umliegenden Fettgewebe aufzuräumen. </li><li> Unmittelbar überträgt die isolierten Gonadengewebe auf ein vorgekühlte 1,5 ml-Zentrifugenröhrchen, das 200 &amp; mgr; l Ringer-Lösung. Halten Sie das Röhrchen auf Eis, bis alle Gonadengewebe von den Larven getrennt sind. </li><li> Seziert die Gonaden von 25 dpf Larven wie in den Schritten von 2,1 bis 2,7. </li></ol> 3. Protokoll 2: Analysieren Gene Expression der isolierten Gonadengewebe <ol><li> Extrahieren der Gesamt-RNA aus den Geweben der Larven Gonaden. <ol><li> Übertragen Sie die isolierten Gonadengewebe auf ein neues RNase-free 1.5 ml-Röhrchen und Ringer-Lösung entfernen. Je 100 &amp; mgr; l Lyse-Lösung. Vortex, bis das Gewebe vollständig aufgelöst. </li><li> Führen Sie die Gesamt-RNA-Extraktionsverfahren gemäß den Anweisungen des Herstellers. </li><li> In 1/10 Volumen 10x DNase I-Puffer und 1 ul DNase I zu der RNA-Lösung und vorsichtig mischen. bei 37 ° C für 20 min inkubieren. </li><li> In 1/10 Volumen DNase Inaktivierung Reagenz zu der RNA-Lösung. bei 70 ° C für 10 min inkubieren. Messen Sie die Konzentration des Gesamt-RNA mit einem Spektralphotometer. Lagerung bei -20 ° C. </li></ol></li><li> Führen des ersten Strangs der cDNA-Synthese <ol><li> Verwenden eines Oligo (dT) Primer -Linker Erststrang-cDNA-Synthese durchzuführen, dem Protokoll des Herstellers folgend. In 1 bis 2 &amp; mgr; g RNA zu einem Gesamtreaktionsvolumen auf 20 ul. </li><li> Inkubieren der Reaktionslösung für 90 min bei 45 ° C. Beenden Sie die Reaktion durch Erhitzen auf 70 ° C für 5 min. </li><li> 1 &amp; mgr; l RNase H zu der cDNA solution die restlichen RNA zu entfernen. Vorsichtig mischen und Zentrifuge für 10 s bei ~ 13.000 x g. bei 37 ° C für 20 min inkubieren. In 20 ul Nuklease freiem Wasser. Lagern bei -70 ° C. </li></ol></li><li> Führen fluoreszierende quantitative PCR <ol><li> Führen qPCR auf einem Cycler-System mit einem Fluoreszenzfarbstoff. Verwenden Sie die folgenden PCR-Zyklusbedingungen: 35 Zyklen bei 95 ° C für 15 s, Tm-5 ° C für 15 s, 68 ° C für 30 s. Primersequenzen wie folgt verwenden: AMH (fwd: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (fwd: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (fwd: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), Vasa (fwd: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) und β-Actin (fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA) 19. </li></ol></li></ol>

<ol>
	<li>Wilson, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wild+sex+in+zebrafish:+loss+of+the+natural+sex+determinant+in+domesticated+strains.">Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains.</a> Genetics. 198 (3), 1291-1308 (2014).</li><li>Liew, W. C., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+sex:+a+complicated+affair.">Zebrafish sex: a complicated affair.</a> Genomics. 13 (2), 172-187 (2014).</li><li>Orban, L., Sreenivasan, R., Olsson, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+and+winding+roads:+Testis+differentiation+in+zebrafish.">Long and winding roads: Testis differentiation in zebrafish.</a> Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).</li><li>Blaser, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transition+from+non-motile+behaviour+to+directed+migration+during+early+PGC+development+in+zebrafish.">Transition from non-motile behaviour to directed migration during early PGC development in zebrafish.</a> J. Cell Sci. 118, 4027-4038 (2005).</li><li>Wang, X. G., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-M&#252;llerian+hormone+and+11+&#946;-hydroxylase+show+reciprocal+expression+to+that+of+aromatase+in+the+transforming+gonad+of+zebrafish+males.">Anti-M&#252;llerian hormone and 11 &#946;-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males.</a> Dev. Dynam. 236 (5), 1329-1338 (2007).</li><li>Siegfried, K. R., N&#252;sslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+control+of+female+sex+determination+in+zebrafish.">Germ line control of female sex determination in zebrafish.</a> Dev. Biol. 324 (2), 277-287 (2008).</li><li>Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+apoptosis+during+the+transition+from+ovary-like+tissue+to+testes+during+sex+differentiation+of+juvenile+zebrafish.">Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish.</a> J. Exp. Biol. 205 (Pt 6), 711-718 (2002).</li><li>Groh, K. J., Sch&#246;nenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+expression+in+zebrafish+during+gonad+differentiation+by+targeted+proteomics.">Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics.</a> Gen. Comp. Endocr. 193, 210-220 (2013).</li><li>Siegfried, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+search+of+determinants:+gene+expression+during+gonadal+sex+differentiation.">In search of determinants: gene expression during gonadal sex differentiation.</a> J. Fish Biol. 76 (8), 1879-1902 (2010).</li><li>Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microarray+analysis+of+sex-+and+gonad-biased+gene+expression+in+the+zebrafish:+evidence+for+masculinization+of+the+transcriptome.">A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome.</a> BMC Genomics. 10, 579 (2009).</li><li>Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+Cyp19+(P450+aromatase)+genes+on+duplicated+zebrafish+chromosomes+are+expressed+in+ovary+or+brain.">Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain.</a> Mol. Biol. Evol. 18 (4), 542-550 (2001).</li><li>Kishida, M., Callard, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cytochrome+P450+aromatase+isoforms+in+zebrafish+(Danio+rerio)+brain+and+ovary+are+differentially+programmed+and+estrogen+regulated+during+early+development.">Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development.</a> Endocrinology. 142 (2), 740-750 (2001).</li><li>Rodr&#237;guez-Mar&#237;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+expression+pattern+of+zebrafish+anti-M&#252;llerian+hormone+(amh)+relative+to+sox9a,+sox9b,+and+cyp19a1a,+during+gonad+development.">Characterization and expression pattern of zebrafish anti-M&#252;llerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development.</a> Gene Expr.Patterns. 5 (5), 655-667 (2005).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+a+vas::EGFP+transgene+in+primordial+germ+cells+of+the+zebrafish.">Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish.</a> Mech Dev. 116 (1-2), 141-150 (2002).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sexual+dimorphic+expression+pattern+of+a+splice+variant+of+zebrafish+vasa+during+gonadal+development.">Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development.</a> Dev. Biol. 271 (1), 190-197 (2004).</li><li>Tzung, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+depletion+of+primordial+germ+cells+in+zebrafish+promotes+testis+formation.">Early depletion of primordial germ cells in zebrafish promotes testis formation.</a> Stem Cell Reports. 4 (1), 61-73 (2015).</li><li>Hsiao, C., Tsai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+zebrafish+with+fluorescent+germ+cell:+a+useful+tool+to+visualize+germ+cell+proliferation+and+juvenile+hermaphroditism+in+vivo.">Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo.</a> Dev. Biol. 262 (2), 313-323 (2003).</li><li>Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection+of+gonads+from+juvenile+zebrafish.">Laser capture microdissection of gonads from juvenile zebrafish.</a> Reprod Biol Endocrinol. 7, 97 (2009).</li><li>Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=nr0b1+(DAX1)+mutation+in+zebrafish+causes+female-to-male+sex+reversal+through+abnormal+gonadal+proliferation+and+differentiation.">nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.</a> Mol. Cell. Endocrinol. 433, 105-116 (2016).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). , (2000).</li><li>Liew, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polygenic+sex+determination+system+in+zebrafish.">Polygenic sex determination system in zebrafish.</a> PLoS One. 7 (4), e34397 (2012).</li><li>Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normal+table+of+postembryonic+zebrafish+development:+staging+by+externally+visible+anatomy+of+the+living+fish.">Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish.</a> Dev Dyn. 238 (12), 2975-3015 (2009).</li><li>Gupta, T., Mullins, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+Organs+from+the+Adult+Zebrafish.">Dissection of Organs from the Adult Zebrafish.</a> J. Vis Exp. (37), (2010).</li><li>Arnaout, R., Reischauer, S., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recovery+of+Adult+Zebrafish+Hearts+for+High-throughput+Applications.">Recovery of Adult Zebrafish Hearts for High-throughput Applications.</a> J. Vis Exp. (94), (2014).</li><li>Gerlach, G. F., Schrader, L. N., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+Adult+Zebrafish+Kidney.">Dissection of the Adult Zebrafish Kidney.</a> J. Vis Exp. (54), (2011).</li><li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells.">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li><li>Braat, A. K., Speksnijder, J. E., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+development+in+fishes.">Germ line development in fishes.</a> Int. J. Dev. Biol. 43 (7), 745-760 (1999).</li><li>Huang, H. Y., Ketting, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+zebrafish+gonads+for+RNA+isolation.">Isolation of zebrafish gonads for RNA isolation.</a> Methods Mol Biol. 1093, 183-194 (2014).</li></ol>

Die Autoren erklären, dass sie keine finanziellen Interessen haben.

Der Zebrabärbling hat ein leistungsfähiges Modell worden und ist in der Entwicklung und krankheitsbezogenen Forschung intensiv genutzt. Die Verfahren zur Isolierung von Organen bei erwachsenen Zebrafisch wie Gehirn, Herz, Gonaden und Niere wurden gut dokumentiert , 23, 24, 25. Aufgrund der geringen Größe und dynamische Umgestaltung der Gonadengewebe im Larven Zebrabärbling, Isolierung von Gonadengewebe ist eine anspruchsvo...

Das wichtigste weibliche Geschlecht Determinante bei Wild Zebrabärbling Chromosom 4 in dem domestizierten Zebrabärbling (dh gemeinsame Laborstämme) 1 verloren oder verändert werden . Stattdessen haben sie eine polygene System Geschlechtsbestimmung durch Umweltfaktoren wie Temperatur begleitet, Hypoxie, Nahrungsverfügbarkeit und Bevölkerungsdichte. Die detaillierten Mechanismen der Zebrabärbling Geschlechtsentwicklung sind nicht vollständig verstanden. Grundsätzliche Fragen wie bei Zebrabärbling Geschlechtsbestimmung stattfindet, was das primäre Geschlechtsbestimmungssignal (s) ist / sind, und die Gene regulieren , der erste Schritt der Transformation Gonade bleibt 2 beantwortet werden, 3. Im Prozess der Zebrabärbling Geschlechtsentwicklung wurden mehrere wichtige Etappen anerkannt. In der frühen Phase der Entwicklung, ausgehend von 4 HPF (Stunden nach der Befruchtung) Ur-Keimzellen (PGC) unterzieht Spezifikation, die Migration zu Genitalleiste undProliferation. PGC Zahlen und gegenseitige Wechselwirkungen zwischen den Keimzellen und somatischen Zellen sind wichtig für die Gonade Differenzierung 4. Bei 13 dpf (Tage nach der Befruchtung), sind die Gonaden in dem undifferenzierten Stadium. Mit dem 17 dpf, entwickeln die Gonaden in bi-Potential Ovarien in beiden zukünftigen Frauen und Männern. Der Apoptose-abhängiger Übergang von Ovar zu Hoden bei 21 bis 25 dpf beginnen und für mehrere Wochen andauern kann. Von 35 dpf, hat das Geschlecht der Gonaden bestimmt worden , und geschlechtsspezifische Gameten Produktion ist im Gang in beiden Ovarien und Hoden 5, 6, 7. Bis heute diverse Kandidaten-Gene und Mechanismen der Geschlechtsbestimmung vorgeschlagen worden. Proteomics und Transkriptom - Analyse haben viele Gene mit geschlechtsdimorphischen Ausdruck und diese Gene wurden verwendet , um zu studieren Geschlechtsdifferenzierung in Zebrabärbling 8 isoliert, </sup&gt; 9, 10. Zum Beispiel in larvalen Zebrabärbling wird das cyp19a1a Gen im Ovar spezifisch exprimiert , nicht aber in den Hoden 11, 12. Zusätzlich wird AMH Gene schwach in den Ovarialfollikel Granulosa - Zellen exprimiert, aber stark in Testis Sertoli - Zellen 13. Im Gegensatz dazu wird vasa - Gen in den Keimzellen des weiblichen und männlichen Zebrafisches, so dass es eine geeignete Gonade Marker 14, 15 kontinuierlich ausgedrückt. Gonaden - Genexpressionsniveau zu untersuchen ist kritisch , den molekularen Mechanismus der Geschlechtsbestimmung und Differenzierung vor allem in der Bipotential-Ovar Stufe 3, 9 zu verstehen. Jedoch erschwert die geringe Größe der larvalen Zebrabärbling und entsprechend kleiner Gonaden die Isolierung von gonadal Gewebe für die weitere molekulare Analyse. Frühere Studien verwendet sezierten gesamten Rumpfbereich zwischen Opercula und anal Pore 16. Diese Zubereitung, obwohl enthält Gonaden, besteht aus mehreren Geweben und Organen. Alternativ können transgene Tiere mit GFP Gonade spezifische Expression, wie vasa: 17, 18 EGFP wurden Gonadengewebe Trennung über Fluoreszenz - aktivierte Zellsortierung (FACS) und Laser - Capture - Mikrodissektion verwendet. Aber ihre weit verbreitete Anwendung ist begrenzt. Hier beschreiben wir ein einfaches Verfahren Gonadengewebe von Larven Zebrabärbling zu isolieren, auf 17 dpf und 25 dpf. Wir zeigen die Lage der Gonaden mit Bezug auf andere Organe und zu isolieren, die morphologisch intakten Gonaden aus den umgebenden Geweben. Wir zeigen weiter die Gonade spezifische Gene wie vasa und cyp19a1a sind in den isolierten Gonaden hochexprimierten verglichen mit dem Stamm Gewebe durch quantitative PCR (qPCR-Analyse). Dieses Protokoll ermöglicht die Identifizierung, Isolierung, Reinigung und RNA - Amplifikation von Gonaden - spezifische Gene von larvalen Zebrabärbling, wodurch nachfolgende molekulare Analyse von Gonadengewebe 19 ermöglicht.

<table border="0" cellpadding="0" cellspacing="0" width="975">
	<tbody>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Cell culture dish 100 mm</td>
			<td style="width:208px;">Corning</td>
			<td style="width:208px;">430167</td>
			<td style="width:351px;">For embryo incubation</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:208px;">20 X EM</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">For a 1 liter needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl.2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4. 7H2O.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">1 X EM</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">Dilute 20 X EM in distilled water</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">AGAROSE G-10</td>
			<td style="width:208px;">Gene</td>
			<td style="width:208px;">121985</td>
			<td style="width:351px;">For preparing the 2% agar plates&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Trizol Reagent</td>
			<td style="width:208px;">Invitrogen</td>
			<td style="width:208px;">15596-026</td>
			<td style="width:351px;">For RNA isolation&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Meter glass</td>
			<td style="width:208px;">Shen Bo</td>
			<td style="width:208px;">250 ml</td>
			<td style="width:351px;">For preparing the 2% agar plates&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Microwave Oven</td>
			<td style="width:208px;">Midea</td>
			<td style="width:208px;">M1-211A</td>
			<td style="width:351px;">For heating the AGAR</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">TWEEZER DUMONT#5INOX</td>
			<td style="width:208px;">World Precision Instrument</td>
			<td style="width:208px;">500341</td>
			<td style="width:351px;">For dissection</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Stereomicroscope</td>
			<td style="width:208px;">Motic</td>
			<td style="width:208px;">SMZ168</td>
			<td style="width:351px;">For dissection</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Pure water equipment</td>
			<td style="width:208px;">Millipore</td>
			<td style="width:208px;"></td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="81">
			<td height="81" style="height:81px;width:208px;">Ringer&#8217;s solution</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">For a 1 liter needed: Add 6.78g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Transfer pipette</td>
			<td style="width:208px;">Samco</td>
			<td style="width:208px;">202, 204</td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Metal bath</td>
			<td style="width:208px;">QiLinbeier</td>
			<td style="width:208px;"></td>
			<td style="width:351px;">Model GL-150</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Microscope</td>
			<td style="width:208px;">Leica&#160;</td>
			<td style="width:208px;">M205 FA</td>
			<td style="width:351px;">For photomicrograph</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Centrifuge</td>
			<td style="width:208px;">Eppendorf</td>
			<td style="width:208px;">5417R</td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Micro Scale RNA Isolation Kit&#160;</td>
			<td style="width:208px;">Ambion</td>
			<td style="width:208px;">AM1931</td>
			<td style="width:351px;">For RNA isolation from gonad tissues</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Dnase I&#160;</td>
			<td style="width:208px;">Sigma</td>
			<td style="width:208px;">AMPD1-1KT</td>
			<td style="width:351px;">For DNA digestion in the RNA solution&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">RevertAid First Strand cDNA Synthesis Kit</td>
			<td style="width:208px;">Thermo Scientific</td>
			<td style="width:208px;">#K1631</td>
			<td style="width:351px;">For&#160; first-strand cDNA synthesis</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Rnase H&#160;</td>
			<td style="width:208px;">Thermo Scientific</td>
			<td style="width:208px;">#EN0202</td>
			<td style="width:351px;">For digesting the residual RNA in the cDNA solution.</td>
		</tr>
		<tr height="98">
			<td height="98" style="height:98px;width:208px;">SYBR Green Realtime PCR Master Mix</td>
			<td style="width:208px;">TOYOBO</td>
			<td style="width:208px;">QPK-201</td>
			<td style="width:351px;">This product is a Taq DNA polymerase-based 2 x master mix for real-time PCR and&#160; applicable for intercalation assay with SYBR Green I.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Spectrophotometer</td>
			<td style="width:208px;">Ne Drop</td>
			<td style="width:208px;">OD-2000+</td>
			<td>Measuring the concentration of the total RNA</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Mastercycler</td>
			<td style="width:208px;">Eppendorf</td>
			<td style="width:208px;">AG 22331 Hamburg</td>
			<td>gene expression profiling</td>
		</tr>
	</tbody>
</table>

dissection of larval zebrafish gonadal tissue

Obwohl wilde Zebrafische ZZ / Z-Chromosom besitzen, haben domestizierten Zebrabärbling das Geschlechtschromosom verloren. Sie nutzen eine polygene Geschlechtsbestimmung System, in dem mehrere Gene verteilt über das gesamte Genom kollektiv die Geschlechtsidentitäten einzelner Fische bestimmen. Derzeit beteiligt sich die Gene Gonadenentwicklung bei der Regulierung und wie sie bleiben schwer arbeiten. Normalerweise Gonadengewebe zu isolieren, ist der erste Schritt der Geschlechtsentwicklungsprozesse zu untersuchen. Hier stellen wir ein Verfahren Gonadengewebe von 17 dpf (Tage nach der Befruchtung) und 25 dpf Zebrabärblingembryonen zu isolieren. Das isolierte Gonadengewebe kann anschließend durch Morphologie und Genexpressionsanalysen untersucht werden.

Dissektionen der Gonaden wurden auf AB-Stamm Larven Zebrabärbling durchgeführt. Abbildung 1 zeigt typischen Gonadengewebe larvaler Zebrabärbling bei 17 dpf und 25 dpf. Zuerst wird die Haut und Muskeln von einer Seite des Bauches geschnitten, um die inneren Organe zu belichten. die Masse der inneren Organe, bleibt die Schwimmblase zusammen mit den Gonaden im Kofferraum nach dem Entfernen. Die Gonaden wurde auf der ventralen Seite der Schwimmblase angebrach...

Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Dissection of Larval Zebrafish Gonadal Tissue

Hier präsentieren wir ein Protokoll für Gonadengewebe der Larven Zebrabärbling Isolierung, die Untersuchungen von Zebrabärbling Geschlechtsdifferenzierung und Wartung erleichtert.

Dissection von Larval Zebrabärbling Gonadal Tissue

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex ...

dissection-of-larval-zebrafish-gonadal-tissue

Research

JoVE Journal

Developmental Biology

10.2K Aufrufe.  Fudan University.  Hier präsentieren wir ein Protokoll für Gonadengewebe der Larven Zebrabärbling Isolierung, die Untersuchungen von Zebrabärbling Geschlechtsdifferenzierung und Wartung erleichtert. 

Serie: Dissection of Larval Zebrafish Gonadal Tissue

Large-scale Zebrafish Embryonic Heart Dissection for Transcriptional Analysis

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the cardiac transcriptome from being masked by the global embryonic transcriptome, it is necessary to collect sufficient numbers of hearts for further analyses. Furthermore, as zebrafish cardiac development proceeds rapidly, heart collection and RNA extraction methods need to be quick in order to ensure homogeneity of the samples. Here, we present a rapid manual dissection protocol for collecting functional/beating hearts from zebrafish embryos. This is an essential prerequisite for subsequent cardiac-specific RNA extraction to determine cardiac-specific gene expression levels by transcriptome analyses, such as quantitative real-time polymerase chain reaction (RT-qPCR). The method is based on differential adhesive properties of the zebrafish embryonic heart compared with other tissues; this allows for the rapid physical separation of cardiac from extracardiac tissue by a combination of fluidic shear force disruption, stepwise filtration and manual collection of transgenic fluorescently labeled hearts.

To analyse cardiac gene expression profiles during zebrafish heart development, total RNA has to be extracted from isolated hearts. Here, we present a protocol for collecting functional/beating hearts by rapid manual dissection from zebrafish embryos to obtain cardiac-specific mRNA.

Großzebrafisch Embryonale Herz Dissection für Transkriptionsanalyse

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the ...

Forschung

Entwicklungsbiologie

Live Imaging of Innate Immune and Preneoplastic Cell Interactions Using an Inducible Gal4/UAS Expression System in Larval Zebrafish Skin

Here we describe a method to conditionally induce epithelial cell transformation by the use of the 4-Hydroxytamoxifen (4-OHT) inducible KalTA4-ERT2/UAS expression system1 in zebrafish larvae, and the subsequent live imaging of innate immune cell interaction with HRASG12V expressing skin cells. The KalTA4-ERT2/UAS system is both inducible and reversible which allows us to induce cell transformation with precise temporal/spatial resolution in vivo. This provides us with a unique opportunity to live image how individual preneoplastic cells interact with host tissues as soon as they emerge, then follow their progression as well as regression. Recent studies in zebrafish larvae have shown a trophic function of innate immunity in the earliest stages of tumorigenesis2,3. Our inducible system would allow us to live image the onset of cellular transformation and the subsequent host response, which may lead to important insights on the underlying mechanisms for the regulation of oncogenic trophic inflammatory responses. We also discuss how one might adapt our protocol to achieve temporal and spatial control of ectopic gene expression in any tissue of interest.

Studying the earliest events of preneoplastic cell progression and innate immune cell interaction is pivotal to understand and treat cancer. Here we describe a method to conditionally induce epithelial cell transformations and the subsequent live imaging of innate immune cell interaction with HRASG12V expressing skin cells in zebrafish larvae.

Live-Imaging von angeborenen Immun und Präkanzeröse Zell-Interaktionen unter Verwendung eines induzierbaren Gal4 / UAS Expression System in Zebrafisch-Larven Haut

Here we describe a method to conditionally induce epithelial cell transformation by the use of the 4-Hydroxytamoxifen (4-OHT) inducible KalTA4-ERT2/UAS ...

Capturing Tissue Repair in Zebrafish Larvae with Time-lapse Brightfield Stereomicroscopy

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two layers of skin that enclose undifferentiated mesenchyme, and because the larval tail fin regenerates rapidly within 2-3 days. Using this system, we demonstrate a method for capturing the repair dynamics of the amputated tail fin with time-lapse video brightfield stereomicroscopy. We demonstrate that fin amputation triggers a contraction of the amputation wound and extrusion of cells around the wound margin, leading to their subsequent clearance. Fin regeneration proceeds from proximal to distal direction after a short delay. In addition, developmental growth of the larva can be observed during all stages. The presented method provides an opportunity for observing and analyzing whole tissue-scale behaviors such as fin development and growth in a simple microscope setting, which is easily adaptable to any stereomicroscope with time-lapse capabilities.

We present a protocol for capturing the dynamics of zebrafish larval tail fin regeneration on a whole-tissue scale using brightfield-based stereomicroscopy. This technique enables capturing the regeneration dynamics with single cell resolution. This methodology can be adapted to any stereomicroscope equipped with a CCD camera and time-lapse software.

Erfassen von Gewebereparatur in Zebrafisch-Larven mit Zeitrafferhellstereomikroskopie

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two ...

Visualizing the Interrenal Steroidogenic Tissue and Its Vascular Microenvironment in Zebrafish

This protocol introduces how to detect differentiated interrenal steroidogenic cells through a simple whole-mount enzymatic activity assay. Identifying differentiated steroidogenic tissues through chromogenic histochemical staining of 3-&#946;-Hydroxysteroid dehydrogenase /&#916;5-4 isomerase (3&#946;-Hsd) activity-positive cells is critical for monitoring the morphology and differentiation of adrenocortical and interrenal tissues in mammals and teleosts, respectively. In the zebrafish model, the optical transparency and tissue permeability of the developing embryos and larvae allow for whole-mount staining of 3&#946;-Hsd activity. This staining protocol, as performed on transgenic fluorescent reporter lines marking the developing pronephric and endothelial cells, enables the detection of the steroidogenic interrenal tissue in addition to the kidney and neighboring vasculature. In combination with vibratome sectioning, immunohistochemistry, and confocal microscopy, we can visualize and assay the vascular microenvironment of interrenal steroidogenic tissues. The 3&#946;-Hsd activity assay is essential for studying the cell biology of the zebrafish interrenal gland because to date, no suitable antibody is available for labeling zebrafish steroidogenic cells. Furthermore, this assay is rapid and simple, thus providing a powerful tool for mutant screens targeting adrenal (interrenal) genetic disorders as well as for determining disruption effects of chemicals on steroidogenesis in pharmaceutical or toxicological studies.

The interrenal gland in zebrafish is the teleostean counterpart of the mammalian adrenal gland. This protocol introduces how to perform the 3-&#946;-hydroxysteroid dehydrogenase (&#916;5-4 isomerase; 3&#946;-Hsd) enzymatic activity assay, which detects differentiated steroidogenic cells in the developing zebrafish.

Visualisierung der Interrenal- Steroidogenic Gewebe und seine Vascular Mikromilieu in Zebrabärbling

This protocol introduces how to detect differentiated interrenal steroidogenic cells through a simple whole-mount enzymatic activity assay. Identifying ...

Establishment of Larval Zebrafish as an Animal Model to Investigate Trypanosoma cruzi Motility In Vivo

Chagas disease is a parasitic infection caused by Trypanosoma cruzi, whose motility is not only important for localization, but also for cellular binding and invasion. Current animal models for the study of T. cruzi allow limited observation of parasites in vivo, representing a challenge for understanding parasite behavior during the initial stages of infection in humans. This protozoan has a flagellar stage in both vector and mammalian hosts, but there are no studies describing its motility in vivo.The objective of this project was to establish a live vertebrate zebrafish model to evaluate T. cruzi motility in the vascular system. Transparent zebrafish larvae were injected with fluorescently labeled trypomastigotes and observed using light sheet fluorescence microscopy (LSFM), a noninvasive method to visualize live organisms with high optical resolution. The parasites could be visualized for extended periods of time due to this technique&#39;s relatively low risk of photodamage compared to confocal or epifluorescence microscopy. T. cruzi parasites were observed traveling in the circulatory system of live zebrafish in different-sized blood vessels and the yolk. They could also be seen attached to the yolk sac wall and to the atrioventricular valve despite the strong forces associated with heart contractions. LSFM of T. cruzi-inoculated zebrafish larvae is a valuable method that can be used to visualize circulating parasites and evaluate their tropism, migration patterns, and motility in the dynamic environment of the cardiovascular system of a live animal.

Establishment of Larval Zebrafish as an Animal Model to Investigate Trypanosoma cruzi Motility In Vivo

In this protocol, fluorescently labeled T. cruzi&#160;were injected into transparent zebrafish larvae, and parasite motility was observed in vivo using light sheet fluorescence microscopy.

Gründung der Larven Zebrafisch als Tier-Modell zu untersuchen Trypanosomen Trypanosoma Motilität In Vivo

Chagas disease is a parasitic infection caused by Trypanosoma cruzi, whose motility is not only important for localization, but also for cellular binding ...

Dissection and Staining of Drosophila Pupal Ovaries

Unlike adult Drosophila ovaries, pupal ovaries are relatively difficult to access and examine due to their small size, translucence, and encasing within a pupal case. The challenge of dissecting pupal ovaries also lies in their physical location within the pupa: the ovaries are surrounded by fat body cells inside the pupal abdomen, and these fat cells must be removed to allow for proper antibody staining. To overcome these challenges, this protocol utilizes customized Pasteur pipets to extract fat body cells from the pupal abdomen. Moreover, a chambered coverglass is used in place of a microcentrifuge tube during the staining process to improve visibility of the pupae. However, despite these and other advantages of the tools used in this protocol, successful execution of these techniques may still involve several days of practice due to the small size of pupal ovaries. The techniques outlined in this protocol could be applied to time course experiments in which ovaries are analyzed at various stages of pupal development.

Dissection and Staining of Drosophila Pupal Ovaries

The Drosophila ovary is an excellent model system for studying stem cell niche development. Though methods for dissecting larval and adult ovaries have been published, pupal ovary dissections require different techniques that have not been published in detail. Here we outline a protocol for dissecting, staining, and mounting pupal ovaries.

Präparation und Färbung von Drosophila Pupal Eierstöcke

Unlike adult Drosophila ovaries, pupal ovaries are relatively difficult to access and examine due to their small size, translucence, and encasing within a ...

Following Endocardial Tissue Movements via Cell Photoconversion in the Zebrafish Embryo

During embryogenesis, cells undergo dynamic changes in cell behavior, and deciphering the cellular logic behind these changes is a fundamental goal in the field of developmental biology. The discovery and development of photoconvertible proteins have greatly aided our understanding of these dynamic changes by providing a method to optically highlight cells and tissues. However, while photoconversion, time-lapse microscopy, and subsequent image analysis have proven to be very successful in uncovering cellular dynamics in organs such as the brain or the eye, this approach is generally not used in the developing heart due to challenges posed by the rapid movement of the heart during the cardiac cycle. This protocol consists of two parts. The first part describes a method for photoconverting and subsequently tracking endocardial cells (EdCs) during zebrafish atrioventricular canal (AVC) and atrioventricular heart valve development. The method involves temporally stopping the heart with a drug in order for accurate photoconversion to take place. Hearts are allowed to resume beating upon removal of the drug and embryonic development continues normally until the heart is stopped again for high-resolution imaging of photoconverted EdCs at a later developmental time point. The second part of the protocol describes an image analysis method to quantify the length of a photoconverted or non-photoconverted region in the AVC in young embryos by mapping the fluorescent signal from the three-dimensional structure onto a two-dimensional map. Together, the two parts of the protocol allows one to examine the origin and behavior of cells that make up the zebrafish AVC and atrioventricular heart valve, and can potentially be applied for studying mutants, morphants, or embryos that have been treated with reagents that disrupt AVC and/or valve development.

This protocol describes a method for the photoconversion of Kaede fluorescent protein in endocardial cells of the living zebrafish embryo that enables the tracking of endocardial cells during atrioventricular canal and atrioventricular heart valve development.

Folgenden endokardialen Gewebe Bewegungen über Zelle Ladungszustand des Zebrafish Embryos

During embryogenesis, cells undergo dynamic changes in cell behavior, and deciphering the cellular logic behind these changes is a fundamental goal in the ...

Adult Zebrafish Injury Models to Study the Effects of Prednisolone in Regenerating Bone Tissue

Zebrafish are able to regenerate various organs, including appendages (fins) after amputation. This involves the regeneration of bone, which regrows within roughly two weeks after injury. Furthermore, zebrafish are able to heal bone rapidly after trepanation of the skull, and repair fractures that can be easily introduced into zebrafish bony fin rays. These injury assays represent feasible experimental paradigms to test the effect of administered drugs on rapidly forming bone. Here, we describe the use of these 3 injury models and their combined use with systemic glucocorticoid treatment, which exerts bone inhibitory and immunosuppressive effects. We provide a workflow on how to prepare for immunosuppressive treatment in adult zebrafish, illustrate how to perform fin amputation, trepanation of calvarial bones, and fin fractures, and describe how the use of glucocorticoids affects both bone forming osteoblasts and cells of the monocyte/macrophage lineage as part of innate immunity in bone tissue.

Here, we describe 3 adult zebrafish injury models and their combined use with immunosuppressive drug treatment. We provide guidance on imaging of regenerating tissues and on detecting bone mineralization therein.

Erwachsenen Zebrafisch Verletzungen Modelle zur Untersuchung der Auswirkungen von Prednisolon bei der Regeneration von Knochengewebe

Zebrafish are able to regenerate various organs, including appendages (fins) after amputation. This involves the regeneration of bone, which regrows ...

Electroretinogram Recording in Larval Zebrafish using A Novel Cone-Shaped Sponge-tip Electrode

The zebrafish (Danio rerio) is commonly used as a vertebrate model in developmental studies and is particularly suitable for visual neuroscience. For functional measurements of visual performance, electroretinography (ERG) is an ideal non-invasive method, which has been well established in higher vertebrate species. This approach is increasingly being used for examining the visual function in zebrafish, including during the early developmental larval stages. However, the most commonly used recording electrode for larval zebrafish ERG to date is the glass micropipette electrode, which requires specialized equipment for its manufacture, presenting a challenge for laboratories with limited resources. Here, we present a larval zebrafish ERG protocol using a cone-shaped sponge-tip electrode. The novel electrode is easier to manufacture and handle, more economical, and less likely to damage the larval eye than the glass micropipette. Like previously published ERG methods, the current protocol can assess outer retinal function through photoreceptor and bipolar cell responses, the a- and b-wave, respectively. The protocol can clearly illustrate the refinement of visual function throughout the early development of zebrafish larvae, supporting the utility, sensitivity, and reliability of the novel electrode. The simplified electrode is particularly useful when establishing a new ERG system or modifying existing small-animal ERG apparatus for zebrafish measurement, aiding researchers in the visual neurosciences to use the zebrafish model organism.

Here, we present a protocol that simplifies the measurement of light evoked electroretinogram responses from larval zebrafish. A novel cone-shaped sponge-tip electrode can help to make the study of visual development in larval zebrafish using the electroretinogram ERG easier to achieve with reliable outcomes and lower cost.

Elektroretinogramm Aufnahme im Larvenstadium Zebrafisch mit A Roman kegelförmigen Schwamm-Tip Elektrode

The zebrafish (Danio rerio) is commonly used as a vertebrate model in developmental studies and is particularly suitable for visual neuroscience. For ...

Quantifying Liver Size in Larval Zebrafish Using Brightfield Microscopy

In several transgenic zebrafish models of hepatocellular carcinoma (HCC), hepatomegaly can be observed during early larval stages. Quantifying larval liver size in zebrafish HCC models provides a means to rapidly assess the effects of drugs and other manipulations on an oncogene-related phenotype. Here we show how to fix zebrafish larvae, dissect the tissues surrounding the liver, photograph livers using bright-field microscopy, measure liver area, and analyze results. This protocol enables rapid, precise quantification of liver size. As this method involves measuring liver area, it may underestimate differences in liver volume, and complementary methodologies are required to differentiate between changes in cell size and changes in cell number. The dissection technique described herein is an excellent tool to visualize the liver, gut, and pancreas in their natural positions for myriad downstream applications including immunofluorescence staining and in situ hybridization. The described strategy for quantifying larval liver size is applicable to many aspects of liver development and regeneration.

Here we demonstrate a method for quantifying liver size in larval zebrafish, providing a way to assess the effects of genetic and pharmacologic manipulations on liver growth and development.

Quantifizierung der Lebergröße in Larval Zebrafischen mit Brightfield-Mikroskopie

In several transgenic zebrafish models of hepatocellular carcinoma (HCC), hepatomegaly can be observed during early larval stages. Quantifying larval ...