Name: evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts
Uploaded: 2018-05-11T14:30:00
Description: Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

The authors thank Nicole McRorie for help with the experiments. This work was supported by the University of Alberta Faculty of Medicine and Dentistry, Slipchuk SMA Research Foundation Research Grant, the Canadian Institutes of Health Research (CIHR), the Friends of Garrett Cumming Research Funds, HM Toupin Neurological Science Research Funds, the Muscular Dystrophy Canada, the Canada Foundation for Innovation, Alberta Enterprise and Advanced Education, and the Women and Children's Health Research Institute (WCHRI).

1. Cell culture
<ol>
	<li>Culture SMA patient fibroblasts in the growth medium (Dulbecco&#39;s modified Eagle medium 1:1 F-12 (Ham) with 10% fetal bovine serum (FBS) and 0.5% penicillin/streptomycin) in a CO2 incubator at 37 &#176;C.</li>
	<li>Determine cell concentration using an automated cell counter and dilute cells to 1 x 105 cells/mL in the growth medium, then seed on the appropriate plate. Use 12-well plates (1&#160;mL per well) for RT-PCR or qPCR.</li>
	<li>Incubate the plates for 24 h in ...

<ol>
	<li>Iascone, D. M., Henderson, C. E., Lee, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+muscular+atrophy:+from+tissue+specificity+to+therapeutic+strategies.">Spinal muscular atrophy: from tissue specificity to therapeutic strategies.</a> F1000Prime Rep. 7, 4 (2015).</li><li>Touznik, A., Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+developments+in+exon+skipping+and+splice+modulation+therapies+for+neuromuscular+diseases.">New developments in exon skipping and splice modulation therapies for neuromuscular diseases.</a> Expert Opin Biol Ther. 14 (6), 809-819 (2014).</li><li>Lefebvre, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+Characterization+of+a+Spinal+Muscular+Atrophy-Determining+Gene.">Identification and Characterization of a Spinal Muscular Atrophy-Determining Gene.</a> Cell. 80 (1), 155-165 (1995).</li><li>Lorson, C. L., Hahnen, E., Androphy, E. J., Wirth, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+in+the+SMN+gene+regulates+splicing+and+is+responsible+for+spinal+muscular+atrophy.">A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 96 (11), 6307-6311 (1999).</li><li>Monani, U. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+difference+that+alters+splicing+patterns+distinguishes+the+SMA+gene+SMN1+from+the+copy+gene+SMN2.">A single nucleotide difference that alters splicing patterns distinguishes the SMA gene SMN1 from the copy gene SMN2.</a> Hum Mol Genet. 8 (7), 1177-1183 (1999).</li><li>Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+therapy+in+neurology.">Antisense therapy in neurology.</a> J Pers Med. 3 (3), 144-176 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Ther. 27 (2), 67-69 (2017).</li><li>Hua, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peripheral+SMN+restoration+is+essential+for+long-term+rescue+of+a+severe+spinal+muscular+atrophy+mouse+model.">Peripheral SMN restoration is essential for long-term rescue of a severe spinal muscular atrophy mouse model.</a> Nature. 478 (7367), 123-126 (2011).</li><li>Hua, Y., Vickers, T. A., Baker, B. F., Bennett, C. F., Krainer, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+SMN2+exon+7+inclusion+by+antisense+oligonucleotides+targeting+the+exon.">Enhancement of SMN2 exon 7 inclusion by antisense oligonucleotides targeting the exon.</a> PLoS Biol. 5 (4), 73 (2007).</li><li>Passini, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+oligonucleotides+delivered+to+the+mouse+CNS+ameliorate+symptoms+of+severe+spinal+muscular+atrophy.">Antisense oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy.</a> Sci Transl Med. 3 (72), (2011).</li><li>Hammond, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systemic+peptide-mediated+oligonucleotide+therapy+improves+long-term+survival+in+spinal+muscular+atrophy.">Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 113 (39), 10962-10967 (2016).</li><li>Porensky, P. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+administration+of+morpholino+antisense+oligomer+rescues+spinal+muscular+atrophy+in+mouse.">A single administration of morpholino antisense oligomer rescues spinal muscular atrophy in mouse.</a> Hum Mol Genet. 21 (7), 1625-1638 (2012).</li><li>Touznik, A., Maruyama, R., Hosoki, K., Echigoya, Y., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA/DNA+mixmer-based+antisense+oligonucleotides+correct+alternative+splicing+of+the+SMN2+gene+and+restore+SMN+protein+expression+in+type+1+SMA+fibroblasts.">LNA/DNA mixmer-based antisense oligonucleotides correct alternative splicing of the SMN2 gene and restore SMN protein expression in type 1 SMA fibroblasts.</a> Sci Rep. 7 (1), 3672 (2017).</li><li>Obika, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+2'-O,4'-C-methyleneuridine+and+-cytidine.+Novel+bicyclic+nucleosides+having+a+fixed+C-3,-endo+sugar+puckering.">Synthesis of 2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C-3,-endo sugar puckering.</a> Tetrahedron Letters. 38 (50), 8735-8738 (1997).</li><li>Singh, S. K., Nielsen, P., Koshkin, A. A., Wengel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA+(locked+nucleic+acids):+synthesis+and+high-affinity+nucleic+acid+recognition.">LNA (locked nucleic acids): synthesis and high-affinity nucleic acid recognition.</a> Chemical Communications. (4), 455-456 (1998).</li><li>Navarro, E., Serrano-Heras, G., Castano, M. J., Solera, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+detection+chemistry.">Real-time PCR detection chemistry.</a> Clin Chim Acta. 439, 231-250 (2015).</li><li>Urbanek, M. O., Nawrocka, A. U., Krzyzosiak, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+RNA+Detection+by+in+Situ+Hybridization+Methods.">Small RNA Detection by in Situ Hybridization Methods.</a> Int J Mol Sci. 16 (6), 13259-13286 (2015).</li><li>Wahlestedt, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+nontoxic+antisense+oligonucleotides+containing+locked+nucleic+acids.">Potent and nontoxic antisense oligonucleotides containing locked nucleic acids.</a> Proc Natl Acad Sci U S A. 97 (10), 5633-5638 (2000).</li><li>Rupaimoole, R., Slack, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+therapeutics:+towards+a+new+era+for+the+management+of+cancer+and+other+diseases.">MicroRNA therapeutics: towards a new era for the management of cancer and other diseases.</a> Nat Rev Drug Discov. 16 (3), 203-222 (2017).</li><li>Lanford, R. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+silencing+of+microRNA-122+in+primates+with+chronic+hepatitis+C+virus+infection.">Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection.</a> Science. 327 (5962), 198-201 (2010).</li><li>Shimo, T., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designing+Effective+Antisense+Oligonucleotides+for+Exon+Skipping.">Designing Effective Antisense Oligonucleotides for Exon Skipping.</a> Methods Mol Biol. 1687, 143-155 (2018).</li><li>Shimo, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+evaluation+of+locked+nucleic+acid-based+splice-switching+oligonucleotides+in+vitro.">Design and evaluation of locked nucleic acid-based splice-switching oligonucleotides in vitro.</a> Nucleic Acids Res. 42 (12), 8174-8187 (2014).</li><li>Nguyen, Q., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+Muscle+Cell+Model+to+Test+the+Exon+Skipping+Efficacy+for+Duchenne+Muscular+Dystrophy.">Immortalized Muscle Cell Model to Test the Exon Skipping Efficacy for Duchenne Muscular Dystrophy.</a> J. Pers. Med. 7 (4), 13 (2017).</li><li>Echigoya, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+Antisense+Screening+and+Optimization+for+Exon+51+Skipping+in+Duchenne+Muscular+Dystrophy.">Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.</a> Mol Ther. , (2017).</li><li>Saito, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+PMO+found+in+dystrophic+dog+model+was+effective+in+cells+from+exon+7-deleted+DMD+patient.">Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient.</a> PLoS One. 5 (8), 12239 (2010).</li><li>Donnelly, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+murine+model+of+SMA.">Characterization of a murine model of SMA.</a> Neurobiol Dis. 45 (3), 992-998 (2012).</li><li>Lim, K. R., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eteplirsen+in+the+treatment+of+Duchenne+muscular+dystrophy.">Eteplirsen in the treatment of Duchenne muscular dystrophy.</a> Drug Des Devel Ther. 11, 533-545 (2017).</li><li>Paton, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nusinersen:+antisense+oligonucleotide+to+increase+SMN+protein+production+in+spinal+muscular+atrophy.">Nusinersen: antisense oligonucleotide to increase SMN protein production in spinal muscular atrophy.</a> Drugs Today (Barc). 53 (6), 327-337 (2017).</li><li>Prakash, T. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparing+in+vitro+and+in+vivo+activity+of+2'-O-[2-(methylamino)-2-oxoethyl]-+and+2'-O-methoxyethyl-modified+antisense+oligonucleotides.">Comparing in vitro and in vivo activity of 2'-O-[2-(methylamino)-2-oxoethyl]- and 2'-O-methoxyethyl-modified antisense oligonucleotides.</a> J Med Chem. 51 (9), 2766-2776 (2008).</li><li>Aoki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bodywide+skipping+of+exons+45-55+in+dystrophic+mdx52+mice+by+systemic+antisense+delivery.">Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery.</a> Proc Natl Acad Sci U S A. 109 (34), 13763-13768 (2012).</li></ol>

The in vitro evaluation method described here is fast, easy, and sensitive enough for the testing of various AONs. This protocol is widely applicable to exon skipping and inclusion of other genes and various cell types. In addition, most AON chemistries (except PMOs) can be transfected using this method. AONs can regulate splicing of pre-mRNA from both endogenous and artificially introduced genes, and can be co-transfected with plasmid vectors carrying targeted genes.
A critical step ...

Spinal muscular atrophy (SMA) is a fatal neuromuscular disorder inherited in an autosomal recessive pattern. It is characterized by the degradation of motor neurons and progressive trunk and limb muscle paralysis1,2. The majority of SMA occurrences are due to a homozygous mutation in the survival of motor neuron 1 (SMN1) gene3. The survival of motor neuron 2 (SMN2) gene is an inverse duplicate of SMN1, and has a nearly identical sequence differing by only five bases4,5. A C-to-T transition in SMN2 located in exon 7 makes the gene nearly nonfunctional because the mutation leads to the essential exon 7 being excluded in nearly 90% of SMN2 transcripts (Figure 1a). SMN2 mRNAs missing exon 7 cannot compensate for the SMN1 function because its protein product is unstable and is rapidly degraded.
Antisense therapy recently emerged as a very promising strategy for treating SMA6. The recent approval of nusinersen by the U.S. Food and Drug Administration (FDA) made it the first drug available for treating SMA7. Nusinersen is an 18-mer antisense oligonucleotide (AON) with a 2&#8242;-O-methoxyethyl modification (MOE) and a phosphorothioate backbone. The drug targets the intronic splicing silencer N1 (ISS-N1) located in intron 7 of the SMN2 gene. Binding of nusinersen to ISS-N1 promotes the recovery of functional full-length SMN protein expression from the endogenous SMN2 gene by inducing exon 7 inclusion (Figure 1a)8,9,10. Currently, many studies involving AON therapy for SMA focus on investigating novel AON chemistries that may be more effective and less toxic than nusinersen. It has been demonstrated that AONs with other chemistries also efficiently induce exon inclusion in SMN2 exon 7 both in vitro and in vivo11,12,13.
Locked nucleic acids (LNAs) are chemically modified RNA analogs containing a methylene bridge connecting the 4&#8242;-Carbon with the 2&#8242;-Oxygen within the furanose structure (Figure 1b)14,15. Compared to DNAs or RNAs, LNAs have an increased affinity for binding to complementary RNA sequences and have the added benefit of being highly resistant to endogenous nucleases. The LNA chemistry has been applied for use as probes for fluorescence in situ hybridization (FISH) and in qPCR16,17. Also, it is utilized to regulate gene expression both in vitro and in vivo. GapmeR AONs are a combination of single-stranded DNA molecules flanked by several LNAs at the 5&#8242; and 3&#8242; ends. They knock down gene expression by binding complementary to targeted mRNAs, causing them to be degraded by the activated RNase H18. LNA/DNA mixmers are AONs which are composed of DNA nucleotides integrated in between LNAs. Presented in this orientation they can bind miRNA to inhibit its function (LNA-antimiR)19. Some LNA-antimiRs have reached clinical development. For examples, miravirsen (AntimiR-122) is an LNA-antimiR that inhibits miR-122 to treat hepatitis C infection and several Phase II clinical trials are currently ongoing19,20. Recently, it has been demonstrated that LNA/DNA mixmers can also modulate RNA splicing21. It can bind a specific sequence of mRNA and induce exon skipping in dystrophin mRNA and exon inclusion in SMN2 mRNA in vitro13,22.
In this article, we outline a methodology for the induction of exon inclusion using AONs and the evaluation of efficacy at the RNA and protein levels. To exemplify this method, we used the LNA/DNA mixmers targeting ISS-N1 in intron 7 of SMN2. AONs transfected into SMA patient cells by lipotransfection induced exon 7 inclusion in the final SMN2 transcript and upregulation of SMN protein production. One of the advantages of using LNA/DNA mixmers to induce the exon inclusion is that the effective concentration for the transfection is significantly lower than other chemistries13. This method can be used for many other AONs except for phosphorodiamidate morpholino oligomers (PMOs), which, due to their neutral charge, need to enter cells through endocytosis induced by the Endo-Porter co-transfection reagent.

<table border="0" cellpadding="0" cellspacing="0" style="width:655px;" width="655">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">SMA Fibroblasts</td>
			<td style="width:153px;">Coriell NIGMS human genetic cell repository</td>
			<td style="width:119px;">GM03813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">11320033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fetal Bovine Serum</td>
			<td style="width:153px;">Sigma-Aldrich</td>
			<td style="width:119px;">F1051</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Penicillin-Streptomycin (10,000 U/mL)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15140122</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Trypsin-EDTA (0.05%), phenol red</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">25300062</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Serum-deprived media</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">31985070</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Transfection reagent</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15338100</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">guanidinium thiocyanate-phenol-chloroform (TRIzol)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15596-018</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">RT-PCR Primers</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>Sequence 5&#39; to 3&#39;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SMN2 forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>CTGCCTCCATTTCCTTCTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TGGTGTCATTTAGTGCTGCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TCCCTGAGCTGAACGGGAAG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GGAGGAGTTTGGTCGCTGT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">qPCR Primers</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">full-length SMN2 forward:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GCTATCATACTGGCTATTATATGGGTTTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">full-length SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>CTCTATGCCAGCATTTCTCCTTAAT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">&#8710;7&#160;SMN2 forward:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TCTGGACCACCAATAATTCCCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">&#8710;7&#160;SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>ATGCCAGCATTTCCATATAATAGCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GCAAATTCCATGGCACCGT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH reverse:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>AGGGATCTCGCTCCTGGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chloroform</td>
			<td style="width:153px;">Sigma-Aldrich</td>
			<td style="width:119px;">P3803</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glycogen, RNA grade</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">R0551</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">ImageJ Software</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Protease cocktail inhibitor&#160;</td>
			<td style="width:153px;">Roche</td>
			<td style="width:119px;">11836153001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cathode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.025 M Tris base + 40&#160;mM 6-aminocaproic acid + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Anode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.03 M Tris Base + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Concentred Anode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.3 M Tris base + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Beta Mercaptoethanol&#160;</td>
			<td style="width:153px;">Millipore</td>
			<td style="width:119px;">ES-007-E</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PVDF membrane&#160;</td>
			<td style="width:153px;">GE</td>
			<td style="width:119px;">10600021</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Loading/sample buffer for Western blotting</td>
			<td style="width:153px;">NuPage Invitrogen</td>
			<td style="width:119px;">NP007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">One-Step RT-PCR kit&#160;</td>
			<td style="width:153px;">Qiagen&#160;</td>
			<td style="width:119px;">210210</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">dNTPs</td>
			<td style="width:153px;">Clontech</td>
			<td style="width:119px;">3040</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts

Spinal muscular atrophy (SMA), a lethal neurological disease caused by the loss of SMN1, presents a unique case in the field of antisense oligonucleotide (AON)-mediated therapy. While SMN1 mutations are responsible for the disease, AONs targeting intronic splice silencer (ISS) sites in SMN2, including FDA-approved nusinersen, have been shown to restore SMN expression and ameliorate the symptoms. Currently, many studies involving AON therapy for SMA focus on investigating novel AON chemistries targeting SMN2 that may be more effective and less toxic than nusinersen. Here, we describe a protocol for in vitro evaluation of exon inclusion using lipotransfection of AONs followed by reverse transcription polymerase chain reaction (RT-PCR), quantitative polymerase chain reaction (qPCR), and Western blotting. This method can be employed for various types of AON chemistries. Using this method, we demonstrate that AONs composed of alternating locked nucleic acids (LNAs) and DNA nucleotides (LNA/DNA mixmers) lead to efficient SMN2 exon inclusion and restoration of SMN protein at a very low concentration, and therefore, LNA/DNA mixmer-based antisense oligonucleotides may be an attractive therapeutic strategy to treat splicing defects caused by genetic diseases. The in vitro evaluation method described here is fast, easy, and sensitive enough for the testing of various novel AONs.

Using SMA patient fibroblasts, we targeted the ISS-N1 silencer region in intron 7 of the SMN2 gene with eight different antisense LNA/DNA mixmers that were transfected at a 5 nM concentration (Figure 3). Each of the mixmers contained a modified phosphorothioated backbone which enabled them to resist nuclease degradation. To evaluate the efficacy of the mixmers, the rate of SMN2 exon 7 inclusion was quantified by RT-PCR and qPCR using primers...

Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts

Various antisense oligonucleotides (AONs) have been shown to induce exon inclusion (splice modulation) and rescue SMN expression for spinal muscular atrophy (SMA). Here, we describe a protocol for AON lipotransfection to induce exon inclusion in the SMN2 gene and the evaluation methods to determine the efficacy in SMA patient fibroblasts.

Spinal muscular atrophy (SMA), a lethal neurological disease caused by the loss of SMN1, presents a unique case in the field of antisense oligonucleotide ...

Research

JoVE Journal

Medicine

Vascular Occlusion Training for Inclusion Body Myositis: A Novel Therapeutic Approach

Inclusion body myositis (IBM) is a rare idiopathic inflammatory myopathy. It is known to produces remarkable muscle weakness and to greatly compromise ...

Experimental Generation of Carcinoma-Associated Fibroblasts (CAFs) from Human Mammary Fibroblasts

Experimental Generation of Carcinoma-Associated Fibroblasts CAFs from Human Mammary Fibroblasts

Carcinomas are complex tissues comprised of neoplastic cells and a non-cancerous compartment referred to as the 'stroma'. The stroma consists of ...

Mouse Model of Intraluminal MCAO: Cerebral Infarct Evaluation by Cresyl Violet Staining

Stroke is the third  cause of mortality and the leading cause of disability in the World. Ischemic  stroke accounts for approximately 80% of all strokes. ...

Cardiac Stress Test Induced by Dobutamine and Monitored by Cardiac Catheterization in Mice

Dobutamine is a &beta;-adrenergic agonist with an affinity higher for receptor expressed in the heart (&beta;1) than for receptors expressed in the ...

Evaluation of Lung Metastasis in Mouse Mammary Tumor Models by Quantitative Real-time PCR

Metastatic disease is the spread of malignant tumor cells from the primary cancer site to a distant organ and is the primary cause of cancer associated ...

Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy

Duchenne muscular dystrophy (DMD) is one of the most common lethal genetic diseases worldwide, caused by mutations in the dystrophin (DMD) gene. Exon ...

A Model of Glaucoma Induced by Circumlimbal Suture in Rats and Mice

The circumlimbal suture is a technique for inducing experimental glaucoma in rodents by chronically elevating intraocular pressure (IOP), a well-known ...

Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain

Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain

Imaging techniques that reflect dynamic bone turnover may aid in characterizing a wide range of bone pathologies. Bone is a dynamic tissue undergoing ...

Invasive Hemodynamic Assessment for the Right Ventricular System and Hypoxia-Induced Pulmonary Arterial Hypertension in Mice

Pulmonary arterial hypertension (PAH) is a chronic and severe cardiopulmonary disorder. Mice are a popular animal model used to mimic this disease. ...

Characterizing Exon Skipping Efficiency in DMD Patient Samples in Clinical Trials of Antisense Oligonucleotides

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations ...