Name: a galleria mellonella oral administration model to study commensal-induced innate immune responses
Uploaded: 2019-03-21T15:00:00.000+00:00
Duration: 6 min 32 s
Description: Watch this Scientific Journal Video about A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses at JoVE.com

This work was funded by the DFG (SPP1656), the DFG research training group 1708, the Bundesministerium f&#252;r Bildung und Forschung (BMBF), and the German Center for Infection Research (DZIF).

1. G. mellonella rearing and preparation of the larvae for the experiments
NOTE: The cycle from egg to last instar larva takes approximately 5-6 weeks.
<ol>
	<li>Transfer the eggs laid by adult moths to 2 L boxes containing wax moth substrate (22% corn grits, 22% wheat meal, 17.5% beeswax, 11% skimmed milk powder, 11% honey, 11% glycerol, 5.5% dried yeast). Perform the whole breeding at 30 &#176;C in the dark.</li>
	<li>Transfer 25 g of substrate containing the larvae into fresh substrate after approximately 1-2 weeks when small and tiny larvae were visible. Synchronize the larvae after 2 weeks according to their size and keep groups of 30-40 larvae in 2 L containers on wax moth substrate for additional 2 weeks.</li>
	<li>Select the larvae for experiments by weight. Use only pale and fast moving larvae with a mass of 180-200 mg.</li>
</ol>
2. Cultivation and preparation of Bacteroides vulgatus and Escherichia coli for oral administration
<ol>
	<li>Grow the obligate anaerobic bacterium Bacteroides vulgatus mpk at 37 &#176;C anaerobically using jars and sachets for creating an anaerobic environment (see Table of Materials)15,16. Cultivate B. vulgatus for 2 days and grow an overnight subculture in brain heart infusion (BHI) broth.</li>
	<li>Grow the facultative anaerobic bacterium Escherichia coli mpk under aerobic conditions in Luria-Bertani (LB) broth at 37 &#176;C. Cultivate E. coli overnight in LB broth and grow subculture for 2 h at 37 &#176;C on the day of the experiment.</li>
	<li>Harvest the cultures by centrifugation at 1,700 x g for 5 min. Resuspend the bacterial pellets in DPBS (Dulbecco&#39;s Phosphate-Buffered Saline). Determine the optical density (OD) of the bacterial cultures at OD 600 nm and calculate the bacterial concentrations. The bacterial concentrations were adjusted to 109/mL.</li>
</ol>
3. Force-feeding of G. mellonella larvae with bacterial suspensions
<ol>
	<li>Force-feed each larva with 10 &#181;L of the adjusted bacterial suspension containing 107 bacteria per dose. Use an insulin syringe with a blunt-ended needle for oral application of the bacterial suspension.
	<ol>
		<li>Fix the syringe into a microsyringe pump (Figure 1) to ensure the accuracy of the applied suspension volume to each larva (see Table of Materials). Insert the syringe carefully between their mandibles. Do not force the syringe between the mandibles. Wait for the larvae to open it mouthparts and insert then the syringe.</li>
	</ol>
	</li>
	<li>Incubate the force-fed larvae in the dark at 37 &#176;C between 1-24 h. Use DPBS-administered larvae as mock background controls to exclude potential stress responses induced due to the handling of the larvae during force-feeding.</li>
</ol>
4. Processing of orally administered larvae and RNA isolation
<ol>
	<li>Work under a hood and wear safety glasses. Clean the hood and spray reagent to prevent RNase contamination.
	<ol>
		<li>Snap-freeze the living larvae after incubation in liquid nitrogen and homogenize them. Use a mortar and pistil for homogenization. Add liquid nitrogen to the mortar and grid each larval individual until powdered homogenates are produced.</li>
		<li>Pour the homogenate to a disposable weighing boat and wait for the liquid nitrogen to evaporate.</li>
	</ol>
	</li>
	<li>Mix the liquid nitrogen-free frozen powdered homogenates with 1 mL of Trizol in a 2 mL tube and incubate the mixture at room temperature for 1 h.</li>
	<li>Centrifuge the mixture at 8,000 x g for 15 min at room temperature and transfer the supernatant into a fresh tube and discard the pellet. Mix the supernatant with 200 &#181;L of 1-Bromo-3-Chloropropane (BCP). Vortex and incubate the mixture for 5 min at room temperature and for 10 min on ice.</li>
	<li>Centrifuge the BCP-added reactions at 18,000 x g for 15 min at 4 &#176;C. Transfer the upper transparent layer into a new 2 mL tube and discard the rest. Precipitate the RNA of the transferred upper layer with 500 &#181;L isopropanol by mixing and inverting the tube for 5 min.</li>
	<li>Centrifuge the tube at 18,000 x g for 15 min at 4 &#176;C. Wash the precipitated RNA pellet with 500 &#181;L of 75% ethanol.</li>
	<li>Dry the RNA pellet for 5-10 min at RT. Take care to not over dry it as it will be hard to dissolve later.</li>
	<li>Dilute ribonuclease inhibitor (1:100) in nuclease-free water and use 100 &#181;L of the solution to resuspend the dried RNA pellet. Vortex the tube carefully until the pellet is completely dissolved.</li>
	<li>Measure RNA quality and quantity. Ensure that the 260/280 ratio is approximately 2.0 and 260/230 ratio in the range of 2.0-2.2 (see Table of Materials).</li>
	<li>Use 5 &#181;g of the isolated RNA for DNase digestion. Mix 5 &#181;L of 10x buffer, 1 &#181;L of ribonuclease inhibitor enzyme, 2 &#181;L of DNase enzyme, 5 &#181;g of RNA, and fill up with nuclease-free water up to 50 &#181;L. Incubate for 30 min at RT.
	<ol>
		<li>Add 6 &#181;L of inactivation reagent and incubate for 2 min at RT and vortex reaction occasionally. Centrifuge reaction at 10,000 x g for 1 min. Transfer supernatant into fresh 1.5 mL tube. 
		NOTE: The RNA contains the larval RNA as well as the bacterial RNA of the respective strain used for oral administration.</li>
	</ol>
	</li>
</ol>
5. Quantification of the bacterial 16S copy numbers after force-feeding
NOTE: The copy numbers of the expressed bacterial 16S was determined using cDNA synthesized from the RNA extracted in section 4. Final quantification is calculated with the help of a standard curve of plasmid in which the 16S PCR fragment of either B. vulgatus or E. coli was cloned.
<ol>
	<li>Preparation of plasmid standards
	<ol>
		<li>Amplify 16S fragments from E. coli mpk or B. vulgatus mpk genomic DNA by PCR. Mix 10 &#181;L of 5x buffer, 1 &#181;L of 10 mM dNTP solution, 2.5 &#181;L of 10 &#181;M forward primer and 2.5 &#181;L of 10 &#181;M reverse primer dilution, 1 &#181;L of DMSO, 1 &#181;L of genomic DNA template, 31.5 &#181;L of nuclease-free water and 0.5 &#181;L of proof-reading enzyme.</li>
		<li>Run the PCR (initial denaturation: 98 &#176;C for 30 s, denaturation: 98 &#176;C for 10 s, annealing: 60 &#176;C for 30s, extension: 72 &#176;C for 30 s, final extension: 72 &#176;C for 5 min, repeat denaturation, annealing and extension for 30 cycles).
		<ol>
			<li>Use 16S E. coli primers (p_forward: GTTAATACCTTTGCTCATTGA, p_reverse: ACCAGGGTATCTAATCCTGTT17, 320 bp) or 16S B. vulgatus primers (p_forward: AACCTGCCGTCTACTCTT, p_reverse: CAACTGACTTAAACATCCAT18, 400 bp) for amplification.</li>
		</ol>
		</li>
		<li>Use the E. coli and B. vulgatus 16S PCR fragments for blunt-end cloning into a cloning vector. Set up ligation and mix 10 &#181;L of 2x buffer, 1 &#181;L of non-purified PCR product, 1 &#181;L of blunt-end cloning plasmid, 7 &#181;L of nuclease-free water and 1 &#181;L of T4 DNA Ligase. Incubate ligation for 10 min at RT.</li>
		<li>Prepare E. coli DH5&#945; competent cells.
		<ol>
			<li>Inoculate 100 mL of LB medium in an Erlenmeyer flask with 1 mL of an overnight culture. Grow the culture until OD 600 nm is between 0.4-0.6. Split the resulting culture into two 50 mL tubes and incubate the cultures on ice for 10 min.</li>
			<li>Centrifuge the cultures at 1,700 x g for 10 min at 4 &#176;C. Discard the supernatant and resuspend each pellet carefully with 5 mL of RFI solution (30 mM CH3COOK, 100 mM KCl, 10 mM CaCl, 50 mM MnCl2, adjust pH 5.8 with glacial acid, sterile filtered). Fill each tube with additional 45 mL of RFI solution.</li>
			<li>Centrifuge the cultures at 1,700 x g for 10 min at 4 &#176;C. Discard the supernatant and resuspend each pellet carefully with 6 mL of RFII (10 mM MOPS, 15 mM CaCl2, 10 mM KCl, 15% glycerol, autoclaved) solution. Pool both fractions and incubate the 12 mL suspension on ice for 15 min. Prepare cell suspension aliquots (200 &#181;L). Store the aliquots at -80 &#176;C.</li>
		</ol>
		</li>
		<li>Transfer the ligation reaction to one aliquot of competent E. coli DH5&#945; cells and leave the reaction on ice for 15 min. Heat shock the cells for 45 s at 42 &#176;C and add 1 mL of LB medium.
		<ol>
			<li>Incubate transformation for 45 min at 37 &#176;C. Add 100 &#181;L of the transformation to a LB agar plate containing ampicillin and incubate overnight at 37 &#176;C.</li>
		</ol>
		</li>
		<li>Perform colony PCR of 8 resulting transformants from the LB agar plate of step 5.1.5. Pick each colony with a toothpick, dip it onto a fresh LB plate containing ampicillin (master plate) and then dip the same toothpick into a well containing 5.5 &#181;L of nuclease-free water in a PCR stripe.
		<ol>
			<li>Add 7.5 &#181;L of 2x PCR mix, 0.5 &#181;L of 10 &#181;M forward primer and 0.5 &#181;L of 10 &#181;M reverse primer dilution. Use the same primer pairs mentioned in section 5.1.1.</li>
			<li>Run PCR (initial denaturation: 95 &#176;C for 5 min, denaturation: 95 &#176;C for 1 min, annealing: 60 &#176;C for 30s, extension: 72 &#176;C for 1 min, final extension: 72 &#176;C for 7 min, repeat denaturation, annealing and extension for 35 cycles).</li>
		</ol>
		</li>
		<li>Verify the size of the 16S fragments on a 1% agarose gel. Use 0.5x Tris-Borate-EDTA (TBE) buffer to dissolve 1 g of agarose and boil it in a microwave. Add 1:50,000 dye to gel and pour it. Add the colony PCR reactions and a 100 bp DNA ladder to the gel, and run the gel for 45 min at 110 V.</li>
		<li>Inoculate a 5 mL LB overnight culture containing ampicillin with one clone from the master plate (section 5.1.6) for each E. coli and B. vulgatus 16S plasmid that contains the right insert size.
		<ol>
			<li>Centrifuge the bacterial overnight cultures in a 2 mL tube at 1,700 x g. Discard the supernatant and resuspend the pellet in 600 &#181;L sterile water.</li>
			<li>Add 100 &#181;L of lysis buffer and mix by inverting the tube 6 times. Add 350 &#181;L of cold (4&#176;C) neutralization solution and mix thoroughly by inverting the tube.</li>
			<li>Centrifuge at maximum speed in a centrifuge for 3 min. Transfer the supernatant (~900 &#181;L) to a spin column and centrifuge at maximum speed in a centrifuge for 15 s.</li>
			<li>Discard the flowthrough and add 200 &#181;L of endotoxin removal wash and centrifuge at maximum speed in a centrifuge for 15 s.</li>
			<li>Add 400 &#181;L of wash solution to the column and centrifuge at maximum speed in a centrifuge for 30 s. Transfer the column to a clean 1.5 mL tube, add 30 &#181;L of elution buffer to the column incubate it for 1 min at room temperature.</li>
			<li>Centrifuge at maximum speed in a centrifuge for 30 s (see Table of Materials).</li>
		</ol>
		</li>
		<li>Determine the plasmid DNA concentration by mixing 1 &#181;L of plasmid DNA with 199 &#181;L of working solution (1 &#181;L of fluorescent dye per 199 &#181;L of buffer for each reaction). Prepare two standards by mixing 10 &#181;L of standard 1 or 10 &#181;L of standard 2 with 190 &#181;L. Vortex the sample and standard tubes and incubate reaction for 2 min. Measure the concentration (see Table of Materials).</li>
		<li>Prepare standard concentrations in 10-fold serial dilutions in a range of 10-100,000 copies: Calculation the mass of the single plasmid (m = (n) x (1.096x10-21 g/bp), n = plasmid size, m = mass). Calculate the mass of plasmid DNA needed to contain the desired copy numbers of interest (copy number of interest x mass of single plasmid = mass of plasmid DNA needed).</li>
	</ol>
	</li>
	<li>Preparation of samples for quantification
	<ol>
		<li>Synthesize cDNA. Mix 2 &#181;L of 7x buffer, 1 &#181;L of DNase-digested RNA from section 4 and 11 &#181;L of nuclease-free water. Incubate for 2 min at 42 &#176;C.
		<ol>
			<li>Place reaction immediately on ice. Mix 4 &#181;L of 5x RT Buffer, 1 &#181;L of RT (Reverse Transcriptase) primer mix, 1 &#181;L of RT enzyme and the reaction of step 5.2.1. Incubate for 15 min at 42 &#176;C. Incubate for 3 min at 95&#176;C to inactivate RT enzyme.</li>
		</ol>
		</li>
		<li>Quantify cDNA concentrations fluorometrically like described in step 5.1.9.</li>
	</ol>
	</li>
	<li>Measurement of bacterial load
	<ol>
		<li>Adjust cDNA concentrations to 5 ng per 12 &#181;L reaction for quantitative PCR. Mix 2x RT-PCR mix, 0.25 &#181;L of 100 &#181;M forward primer, 0.25 &#181;L of 100 &#181;M reverse primer (5.1.1) and 12 &#181;L of adjusted cDNA. Run qPCR (initial denaturation: 95 &#176;C for 5 min, denaturation: 95 &#176;C for 10 s, annealing: 60 &#176;C for 30 s, repeat denaturation and annealing for 35 cycles, melting: 95 &#176;C, cool down to 4 &#176;C).</li>
		<li>Plot log10 concentrations of plasmid standard curve (10-100,000 copies), i.e. 1-5 (x-axis), against the corresponding ct-values (y-axis). Perform linear regression to obtain the regression equation. Solve the equation for x (concentration). Use the formula to calculate the log10 of the copy numbers by inserting ct-value into the formula. Calculate the antilogarithm to obtain copy numbers.</li>
	</ol>
	</li>
</ol>
6. Determination of innate immune marker gene using quantitative RT-PCR
<ol>
	<li>Check primers for gene-specificity by PCR and subsequent agarose gel electrophoresis to verify the correct fragment size. Perform PCR like described in section 5.1.5. 
	Ubiquitin 130 bp: forward TCAATGCAAGTAGTCCGGTTC, reverse CCAGTCTGCTGCTGATAAACC19 (housekeeping) 
	Nox-4 159 bp: forward TGGCACGGCATCAGTTATCA, reverse ACAGCGACTGTCATGTGGAA8 
	Nos 76 bp: forward ATGAAGGTGCTGAAGTCACAA, reverse GCCATTTTACAATCGCCACAA8 
	Gst 156 bp: forward GACAGAAGTCCTCCGGTCAG, reverse TCCGTCTTCAAGCAAAGGCA8 
	ApoIII 265 bp: forward AGACTTGCACGCCATCAAGA, reverse TGCATGCTGTTTGTCACTGC8 
	hemolin 267 bp: forward CTCCCTCACGGAGGACAAAC, reverse GCCACGCACATGTATTCACC8 
	gallerimycin 161 bp: forward GAAGTCTACAGAATCACACGA, reverse ATCGAAGACATTGACATCCA8 
	cecropin 158 bp: forward CTGTTCGTGTTCGCTTGTGT, reverse GTAGCTGCTTCGCCTACCAC8 
	gloverin 101 bp: forward GTGTTGAGCCCGTATGGGAA, reverse CCGTGCATCTGCTTGCTAAC8 
	moricin 124 bp: forward GCTGTACTCGCTGCACTGAT, reverse TGGCGATCATTGCCCTCTTT8)</li>
	<li>Assess primer efficiency to be E=2.
	<ol>
		<li>Pool 2 &#181;L of 5-10 different positive samples (i.e., samples that are expressing the gene for which the primer pair needs to be investigated).</li>
		<li>Prepare a 1:5 dilution series of the sample pool: standard 1 (S1): undiluted pool; S2: 2 &#181;L of S1 + 8 &#181;L nuclease-free water; S3: 2 &#181;L of S2 + 8 &#181;L nuclease-free water; S4: 2 &#181;L of S3 + 8 &#181;L nuclease-free water.</li>
		<li>Apply 1 &#181;L of S1-S4 and a non-template control (nuclease-free water) to a 96-well qPCR plate. Add 5 &#181;L of RT master mix, 0.1 &#181;L of each 100 &#181;M forward and reverse primer, 3.7 &#181;L of nuclease-free water and 0.1 &#181;L of RT mix per well.</li>
		<li>Run quantitative RT-PCR (reverse transcription: 50 &#176;C for 10 min, initial denaturation: 95 &#176;C for 5 min, denaturation: 95 &#176;C for 10 s, annealing: 60 &#176;C for 30 s, repeat denaturation and annealing for 40 cycles, melting: 95 &#176;C, cool down to 4 &#176;C).</li>
		<li>Plot log10 of relative units for S1-S4 (1, 0.2, 0.04, 0.008) (x-axis) against the corresponding ct-values (y-axis). Perform linear regression and determine the slope of the standard curve. Calculate the efficiency E: E= 10-(1/slope).20 
		NOTE: A slope of -3.32 indicates ideal reaction conditions and primer efficiency of E=2.00. This means: the amount of PCR product doubles during each cycle.</li>
	</ol>
	</li>
	<li>Use 100 ng of digested RNA (100 ng/&#181;L) as a template for RT-PCR. Mix RT-PCR reagents and run RT-PCR like mentioned in section 6.2. Measure all bacteria- and DPBS-administered samples with both housekeeping primer pair and target primer pairs. Always run the S1-S4 dilutions with the housekeeping primer pair and S1-S4 with the target primer pair on the same plate for efficiency determination.</li>
	<li>Calculate ratio (R) of RNA gene expression according to the following formula using the experimentally determined primer efficiency of both the housekeeping and the target primer pair. Normalize bacteria stimulated samples to mock controls20. 
	<img alt="Equation 1" src="/files/ftp_upload/59270/59270eq1.jpg" /> 
	R: ratio 
	Etarget: efficiency of S1-4 measured with target primer pair 
	Ehousekeeping: efficiency of S1-4 measured with housekeeping primer pair 
	&#916;cttarget(control-sample): &#916;ct of (ct of DPBS-fed sample)-(ct of bacteria-fed sample) measured with target primer pair 
	&#916;cthousekeeping(control-sample): &#916;ct of (ct of DPBS-fed sample)-(ct of bacteria-fed sample) measured with housekeeping primer pair</li>
</ol>

<ol>
	<li>Nell, S., Suerbaum, S., Josenhans, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+impact+of+the+microbiota+on+the+pathogenesis+of+IBD:+lessons+from+mouse+infection+models.">The impact of the microbiota on the pathogenesis of IBD: lessons from mouse infection models.</a> Nature Reviews Microbiology. 8 (8), 564-577 (2010).</li><li>Muniz, L. R., Knosp, C., Yeretssian, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+antimicrobial+peptides+during+homeostasis,+infection,+and+disease.">Intestinal antimicrobial peptides during homeostasis, infection, and disease.</a> Frontiers in Immunology. 3, 310 (2012).</li><li>Ivanov, I. I., Honda, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+commensal+microbes+as+immune+modulators.">Intestinal commensal microbes as immune modulators.</a> Cell Host Microbe. 12 (4), 496-508 (2012).</li><li>Ayres, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammasome-microbiota+interplay+in+host+physiologies.">Inflammasome-microbiota interplay in host physiologies.</a> Cell Host Microbe. 14 (5), 491-497 (2013).</li><li>Champion, O. L., Titball, R. W., Bates, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Standardization+of+G.+mellonella+Larvae+to+Provide+Reliable+and+Reproducible+Results+in+the+Study+of+Fungal+Pathogens.">Standardization of G. mellonella Larvae to Provide Reliable and Reproducible Results in the Study of Fungal Pathogens.</a> Journal of Fungi (Basel). 4 (3), (2018).</li><li>Wojda, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunity+of+the+greater+wax+moth+Galleria+mellonella.">Immunity of the greater wax moth Galleria mellonella.</a> Insect Science. , (2016).</li><li>Buchmann, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+of+Innate+Immunity:+Clues+from+Invertebrates+via+Fish+to+Mammals.">Evolution of Innate Immunity: Clues from Invertebrates via Fish to Mammals.</a> Frontiers in Immunology. 5, 459 (2014).</li><li>Lange, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Galleria+mellonella:+A+Novel+Invertebrate+Model+to+Distinguish+Intestinal+Symbionts+From+Pathobionts.">Galleria mellonella: A Novel Invertebrate Model to Distinguish Intestinal Symbionts From Pathobionts.</a> Frontiers in Immunology. 9 (2114), (2018).</li><li>Tsai, C. J., Loh, J. M., Proft, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Galleria+mellonella+infection+models+for+the+study+of+bacterial+diseases+and+for+antimicrobial+drug+testing.">Galleria mellonella infection models for the study of bacterial diseases and for antimicrobial drug testing.</a> Virulence. , 1-16 (2016).</li><li>Bolouri Moghaddam, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+potential+of+the+Galleria+mellonella+innate+immune+system+is+maximized+by+the+co-presentation+of+diverse+antimicrobial+peptides.">The potential of the Galleria mellonella innate immune system is maximized by the co-presentation of diverse antimicrobial peptides.</a> Biological Chemistry. 397 (9), 939-945 (2016).</li><li>Casanova-Torres, A. M., Goodrich-Blair, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+Signaling+and+Antimicrobial+Peptide+Expression+in+Lepidoptera.">Immune Signaling and Antimicrobial Peptide Expression in Lepidoptera.</a> Insects. 4 (3), 320-338 (2013).</li><li>Mukherjee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Galleria+mellonella+as+a+model+system+for+studying+Listeria+pathogenesis.">Galleria mellonella as a model system for studying Listeria pathogenesis.</a> Applied and Environmental Microbiology. 76 (1), 310-317 (2010).</li><li>Brennan, M., Thomas, D. Y., Whiteway, M., Kavanagh, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correlation+between+virulence+of+Candida+albicans+mutants+in+mice+and+Galleria+mellonella+larvae.">Correlation between virulence of Candida albicans mutants in mice and Galleria mellonella larvae.</a> FEMS Immunological and Medical Microbiology. 34 (2), 153-157 (2002).</li><li>Miyata, S., Casey, M., Frank, D. W., Ausubel, F. M., Drenkard, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+the+Galleria+mellonella+caterpillar+as+a+model+host+to+study+the+role+of+the+type+III+secretion+system+in+Pseudomonas+aeruginosa+pathogenesis.">Use of the Galleria mellonella caterpillar as a model host to study the role of the type III secretion system in Pseudomonas aeruginosa pathogenesis.</a> Infection and Immunity. 71 (5), 2404-2413 (2003).</li><li>Waidmann, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacteroides+vulgatus+protects+against+Escherichia+coli-induced+colitis+in+gnotobiotic+interleukin-2-deficient+mice.">Bacteroides vulgatus protects against Escherichia coli-induced colitis in gnotobiotic interleukin-2-deficient mice.</a> Gastroenterology. 125 (1), 162-177 (2003).</li><li>Lange, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extensive+Mobilome-Driven+Genome+Diversification+in+Mouse+Gut-Associated+Bacteroides+vulgatus+mpk.">Extensive Mobilome-Driven Genome Diversification in Mouse Gut-Associated Bacteroides vulgatus mpk.</a> Genome Biology and Evolution. 8 (4), 1197-1207 (2016).</li><li>Hermann-Bank, M. L., Skovgaard, K., Stockmarr, A., Larsen, N., Molbak, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Gut+Microbiotassay:+a+high-throughput+qPCR+approach+combinable+with+next+generation+sequencing+to+study+gut+microbial+diversity.">The Gut Microbiotassay: a high-throughput qPCR approach combinable with next generation sequencing to study gut microbial diversity.</a> BMC Genomics. 14, 788 (2013).</li><li>Sato, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=OmpA+variants+affecting+the+adherence+of+ulcerative+colitis-derived+Bacteroides+vulgatus.">OmpA variants affecting the adherence of ulcerative colitis-derived Bacteroides vulgatus.</a> Journal of Medical and Dental Science. 57 (1), 55-64 (2010).</li><li>Freitak, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+maternal+transfer+of+bacteria+can+mediate+trans-generational+immune+priming+in+insects.">The maternal transfer of bacteria can mediate trans-generational immune priming in insects.</a> Virulence. 5 (4), 547-554 (2014).</li><li>Pfaffl, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+mathematical+model+for+relative+quantification+in+real-time+RT-PCR.">A new mathematical model for relative quantification in real-time RT-PCR.</a> Nucleic Acids Research. 29 (9), 45 (2001).</li><li>Ramarao, N., Nielsen-Leroux, C., Lereclus, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+insect+Galleria+mellonella+as+a+powerful+infection+model+to+investigate+bacterial+pathogenesis.">The insect Galleria mellonella as a powerful infection model to investigate bacterial pathogenesis.</a> Journal of Visualized Experiments. (70), e4392 (2012).</li><li>Ramarao, N., Nielsen-Leroux, C., Lereclus, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+insect+Galleria+mellonella+as+a+powerful+infection+model+to+investigate+bacterial+pathogenesis.">The insect Galleria mellonella as a powerful infection model to investigate bacterial pathogenesis.</a> Journal of Visualized Experiments. (70), e4392 (2012).</li></ol>

The authors have nothing to disclose.

The G. mellonella model is a frequently used model to assess bacterial virulence factors in a systemic infection approach21. Since many pathogens and bacteria enter the host via the oral colonization or infection route, new insights need to be found to evaluate G. mellonella as a model for oral colonization and infection.
The possibility to rear G. mellonella between 15-37 &#176;C is a great advantage since most mammalian models maintain body ...

The intestinal microbiome is an essential component for maintenance of homeostasis, and involves both innate and adaptive immune responses1,2. The commensal microbiota community is characterized by different main commensal constituents: symbionts that confer beneficial effects by important immunomodulatory functions, and pathobionts that can have detrimental effects in genetically predisposed hosts and promote and trigger intestinal inflammation3,4. Many studies on symbionts and pathobionts and their influence on the host immune system have been published mainly studying adaptive immune responses.
Since these studies involve many animals for the investigations and the protection and replacement of animals used for experimentation is of increasing public interest, we seek to find a replacement model to allow for a screening of different bacterial immunogenic properties. Insects, especially Galleria mellonella, are a widely used replacement model in infection research. G. mellonella combines different advantages such as low costs and high throughput; it allows oral administration of bacteria, which is the natural exposure route, and it allows for systemic infection5,6. G. mellonella further enables incubation at 37 &#176;C, which is the physiological body temperature of mammals and the optimum for bacterial virulence factor expression5. The main advantage of G. mellonella is the conserved innate immune system that enables the discrimination of self from non-self and encodes a variety of pattern recognition receptors like apolipophorin or the opsonin hemolin6,7. Upon microbe recognition, G. mellonella can trigger different downstream humoral immune responses. It can induce oxidative stress responses and secrete reactive oxygen species (ROS) which involves the activity of NOS (nitric oxidase synthase) and NOX (NADPH oxidase)6,8. In addition, G. mellonella activates a potent antimicrobial peptide (AMP) response, which results in the secretion of a mixture of different AMPs such as gloverin, moricin, cecropin or the defensin-like gallerimycin6,8,9,10. Generally, AMPs have quite broad host specificity against Gram-positive and Gram-negative bacteria and fungi and have to provide an potent response since insects are lacking any adaptive response10. Gloverin is an AMP active against bacteria and fungi and inhibits outer membrane formation6,11. Moricins exhibit their antimicrobial function against Gram-positive and Gram-negative bacteria by penetrating the membrane and forming a pore9,11. Cecropins provide activity against bacteria and fungi and permeabilize the membrane similarly like moricins9,10. Gallerimycin is a defensin-like peptide with anti-fungal properties9. Interestingly, it was found that the combination of cecropin and gallerimycin had a synergistic activity against E. coli10.
Due to their easy-to-use character G. mellonella larvae are an often used infection model to assess bacterial pathogenicity. In particular, studies in which data obtained from G. mellonella correlate with data obtained from mice support the strength of this alternative host model. It was found that the most pathogenic serotypes of Listeria monocytogenes in a mouse infection model lead also to higher mortality rates in G. mellonella after systemic infection. Further, less virulent serotypes turned out to be also less virulent in the G. mellonella model12. Similar observations have been made with the human pathogenic fungi Candida albicans. Virulence of different C. albicans strains has been assessed by systemic infection and subsequent monitoring of larval survival. Mouse avirulent strains were also avirulent or exhibited reduced virulence in G. mellonella, whereas the mouse virulent strains lead also to high larval mortality13. The G. mellonella model could further be used to identify type 3 secretion system pathogenicity factors of Pseudomonas aeruginosa14.
Since most investigations involving G. mellonella were focused on virulence factors using the systemic infection approach we were especially interested in providing a method suitable for the analysis of intestinal commensals in an oral force-feeding model in which we can apply a distinct dosage of bacteria per larvae and not only observe the larval mortality rate but analyze different hallmarks of innate immune responses to maintain intestinal homeostasis.
Our method helps to increase the use of G. mellonella as a replacement model since we combine the application of bacteria and the analysis of RNA expression. It is not only useful to strengthen the meaning of bacterial pathogenesis studies when including the analysis of immune responses after oral administration and not only the observation of mortality rates after systemic infection. Our methods allows for the analysis of immunogenic properties of bacterial non-pathogenic commensals since it is provides more complex conditions than cell culture by offering an intestinal barrier in a living organism.

<table><tbody><tr><td>1.5 mL tubes</td><td>Eppendorf</td><td>0030120086</td><td></td></tr><tr><td>100 bp DNA ladder&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>15628019</td><td></td></tr><tr><td>1-Bromo-3-Chloropropane (BCP)</td><td>Sigma-Aldrich</td><td>B9673</td><td></td></tr><tr><td>2 mL tubes</td><td>Eppendorf</td><td>0030120094</td><td></td></tr><tr><td>2x Mangomix</td><td>Bioline</td><td>BIO-25033</td><td>Colony PCR</td></tr><tr><td>50 mL tubes</td><td>Greiner Bio-One</td><td>210 261</td><td></td></tr><tr><td>Agarose</td><td>Biozym</td><td>840004</td><td></td></tr><tr><td>Beeswax</td><td>Mixed-Store.de</td><td>&amp;nbsp;-</td><td></td></tr><tr><td>Brain heart infusion broth</td><td>Thermo Fisher Scientific</td><td>CM1135</td><td></td></tr><tr><td>CloneJET PCR Cloning Kit</td><td>Thermo Fisher Scientific</td><td>K1232</td><td>Cloning vector for 16S fragments</td></tr><tr><td>Corn grits</td><td>Osterm&amp;uuml;hle Naturkost GmbH</td><td>306</td><td>Organic cultivation</td></tr><tr><td>Difco LB Agar, Miller (Luria-Bertani)</td><td>Becton Dickinson</td><td>BD</td><td></td></tr><tr><td>Difoco LB Broth, Miller (Luria-Bertani)</td><td>Becton Dickinson</td><td>244610</td><td></td></tr><tr><td>DNA-free DNA Removal Kit&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>244510</td><td>&amp;nbsp;Dnase digestion</td></tr><tr><td>Dried yeast</td><td>Rapunzel</td><td>&amp;nbsp;-</td><td>Organic cultivation</td></tr><tr><td>Dulbecco&#039;s Phosphate-Buffered Saline (DPBS)</td><td>Thermo Fisher Scientific</td><td>14040</td><td></td></tr><tr><td>Ethanol</td><td>VWR</td><td>20821.330</td><td></td></tr><tr><td>Glycerol</td><td>Sigma-Aldrich</td><td>W252506</td><td></td></tr><tr><td>Honey</td><td>Osterm&amp;uuml;hle Naturkost GmbH</td><td>487</td><td></td></tr><tr><td>Isopropanol&amp;nbsp;</td><td>VWR</td><td>20842.330</td><td></td></tr><tr><td>Lightcycler 480 Instrument II</td><td>Roche Molecular Systems</td><td>5015278001</td><td></td></tr><tr><td>LightCycler 480 Multiwell Plate 96, white</td><td>Roche Molecular Systems</td><td>4729692001</td><td></td></tr><tr><td>Manual Microsyringe Pump with Digital Display</td><td>World Precision Instruments</td><td>DMP</td><td></td></tr><tr><td>Micro-Fine+ U-100 insulin syringe 0.3 x 8 mm</td><td>Becton Dickinson</td><td>324826</td><td>Oral administration</td></tr><tr><td>Mortar, unglazed</td><td>VWR</td><td>410-9327&amp;nbsp;</td><td></td></tr><tr><td>Nanodrop</td><td>Thermo Fisher Scientific</td><td>13-400-518</td><td></td></tr><tr><td>Nuclease-free water&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>10977035</td><td></td></tr><tr><td>Oxoid AnaeroGen sachets&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>AN0025A</td><td>Quality and quantity of RNA</td></tr><tr><td>PCR stripes</td><td>Biozym</td><td>710970</td><td></td></tr><tr><td>Pestle, unglazed grinding surface</td><td>VWR</td><td>410-9324&amp;nbsp;</td><td></td></tr><tr><td>Phusion proof-reading enzyme&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>F553S</td><td></td></tr><tr><td>Primers</td><td>Biomers</td><td>&amp;nbsp;-</td><td></td></tr><tr><td>PureYield Plasmid Miniprep System</td><td>Promega</td><td>A1222</td><td></td></tr><tr><td>QuantiFast SYBR Green PCR kit&amp;nbsp;</td><td>Qiagen</td><td>204056</td><td>qPCR for bacterial copy number measurment</td></tr><tr><td>QuantiFast SYBR Green RT-PCR Kit&amp;nbsp;</td><td>Qiagen</td><td>204156</td><td>qRT-PCR for gene expression measurements</td></tr><tr><td>QuantiTect Reverse Transcription Kit&amp;nbsp;</td><td>Qiagen</td><td>205311</td><td>cDNA synthesis</td></tr><tr><td>Qubit Assay Tubes</td><td>Thermo Fisher Scientific</td><td>Q32856</td><td></td></tr><tr><td>Qubit dsHS DNA kit&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>Q32851</td><td>Quantification of plasmid and cDNA samples</td></tr><tr><td>Qubit fluorometer</td><td>Thermo Fisher Scientific</td><td>Q33226</td><td>Quantification of plasmid and cDNA samples</td></tr><tr><td>RNase-ExitusPlus</td><td>AppliChem</td><td>A7153</td><td></td></tr><tr><td>Rnasin Ribonuclease Inhibitor</td><td>Promega</td><td>N2511</td><td></td></tr><tr><td>Skimmed milk powder</td><td>Sucofin</td><td>&amp;nbsp;-</td><td></td></tr><tr><td>SYBR safe DNA Gel Stain</td><td>Thermo Fisher Scientific</td><td>S33102</td><td></td></tr><tr><td>TRI reagent&amp;nbsp;</td><td>Sigma-Aldrich</td><td>T9424</td><td></td></tr><tr><td>Weighing boat</td><td>VWR</td><td>10803-148</td><td></td></tr><tr><td>Wheat meal</td><td>Osterm&amp;uuml;hle Naturkost GmbH</td><td>6462</td><td>Organic cultivation</td></tr></tbody></table>

a galleria mellonella oral administration model to study commensal-induced innate immune responses

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal host-microbe interactions. It is well established that different commensals exhibit a different potential to stimulate the host intestinal immune system. Such investigations involve vertebrate animals, especially rodents. Since increasing ethical concerns are linked with experiments involving vertebrates, there is a high demand for invertebrate replacements models. 
Here, we provide a Galleria mellonella oral administration model using commensal non-pathogenic bacteria and the possible assessment of the immunogenic potential of commensals on the G. mellonella immune system. We demonstrate that G. mellonella is a useful alternative invertebrate replacement model that allows the analysis of commensals with different immunogenic potential such as Bacteroides vulgatus and Escherichia coli. Interestingly, the bacteria exhibited no killing effect on the larvae, which is similar to mammals. The immune responses of G. mellonella were comparable with vertebrate innate immune responses and involve recognition of the bacteria and production of antimicrobial molecules. We propose that G. mellonella was able to restore previous microbiota balance, which is well known from healthy mammalian individuals. Although providing comparable innate immune responses in both G. mellonella and vertebrates, G. mellonella does not harbor an adaptive immune system. Since the investigated components of the innate immune system are evolutionary conserved, the model allows a prescreening and first analysis of bacterial immunogenic properties.

The G. mellonella hemolymph infection model in widely used to analyze the virulence factors of a huge variety of pathogens. Most measurements include the analysis of larvae mortality, which is a quite easy method. Nevertheless, this method does not allow conclusions about immune responses in general and link the results of G. mellonella immune responses with vertebrate immune mechanisms. The G. mellonella oral administration model on the other hand is only rarel...

Watch this Scientific Journal Video about A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses at JoVE.com

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

Here, we provide a detailed protocol for an oral administration model using Galleria mellonella larvae and how to characterize induced innate immune responses. Using this protocol, researchers without practical experience will be able to use the G. mellonella force-feeding method.

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

a-galleria-mellonella-oral-administration-model-to-study-commensal

Research

JoVE Journal

Immunology and Infection

7.9K Views.  University of Tübingen. Here, we provide a detailed protocol for an oral administration model using Galleria mellonella larvae and how to characterize induced innate immune responses. Using this protocol, researchers without practical experience will be able to use the G. mellonella force-feeding method.

Video: A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

The Insect Galleria mellonella as a Powerful Infection Model to Investigate Bacterial Pathogenesis

The study of bacterial virulence often requires a suitable animal model. Mammalian models of infection are costly and may raise ethical issues. The use of insects as infection models provides a valuable alternative. Compared to other non-vertebrate model hosts such as nematodes, insects have a relatively advanced system of antimicrobial defenses and are thus more likely to produce information relevant to the mammalian infection process. Like mammals, insects possess a complex innate immune system1. Cells in the hemolymph are capable of phagocytosing or encapsulating microbial invaders, and humoral responses include the inducible production of lysozyme and small antibacterial peptides2,3. In addition, analogies are found between the epithelial cells of insect larval midguts and intestinal cells of mammalian digestive systems. Finally, several basic components essential for the bacterial infection process such as cell adhesion, resistance to antimicrobial peptides, tissue degradation and adaptation to oxidative stress are likely to be important in both insects and mammals1. Thus, insects are polyvalent tools for the identification and characterization of microbial virulence factors involved in mammalian infections.
Larvae of the greater wax moth Galleria mellonella have been shown to provide a useful insight into the pathogenesis of a wide range of microbial infections including mammalian fungal (Fusarium oxysporum, Aspergillus fumigatus, Candida albicans) and bacterial pathogens, such as Staphylococcus aureus, Proteus vulgaris, Serratia marcescens Pseudomonas aeruginosa, Listeria monocytogenes or Enterococcus faecalis4-7. Regardless of the bacterial species, results obtained with Galleria larvae infected by direct injection through the cuticle consistently correlate with those of similar mammalian studies: bacterial strains that are attenuated in mammalian models demonstrate lower virulence in Galleria, and strains causing severe human infections are also highly virulent in the Galleria model8-11. Oral infection of Galleria is much less used and additional compounds, like specific toxins, are needed to reach mortality.
G. mellonella larvae present several technical advantages: they are relatively large (last instar larvae before pupation are about 2 cm long and weight 250 mg), thus enabling the injection of defined doses of bacteria; they can be reared at various temperatures (20 &deg;C to 30 &deg;C) and infection studies can be conducted between 15 &deg;C to above 37 &deg;C12,13, allowing experiments that mimic a mammalian environment. In addition, insect rearing is easy and relatively cheap. Infection of the larvae allows monitoring bacterial virulence by several means, including calculation of LD5014, measurement of bacterial survival15,16 and examination of the infection process17. Here, we describe the rearing of the insects, covering all life stages of G. mellonella. We provide a detailed protocol of infection by two routes of inoculation: oral and intra haemocoelic. The bacterial model used in this protocol is Bacillus cereus, a Gram positive pathogen implicated in gastrointestinal as well as in other severe local or systemic opportunistic infections18,19.

The Insect Galleria mellonella as a Powerful Infection Model to Investigate Bacterial Pathogenesis

Oral and intra haemocolic infection of larvae of the greater wax moth Galleria mellonella is described. This insect can be used to study virulence factors of entomopathogenic as well as mammalian opportunistic bacteria. Rearing of the insects, methods of infection and examples of in vivo analysis are described.

The study of bacterial virulence often requires a suitable animal model. Mammalian models of infection are costly and may raise ethical issues. The use of ...

An In vitro Model to Study Immune Responses of Human Peripheral Blood Mononuclear Cells to Human Respiratory Syncytial Virus Infection

Human respiratory syncytial virus (HRSV) infections present a broad spectrum of disease severity, ranging from mild infections to life-threatening bronchiolitis. An important part of the pathogenesis of severe disease is an enhanced immune response leading to immunopathology.	Here, we describe a protocol used to investigate the immune response of human immune cells to an HRSV infection. First, we describe methods used for culturing, purification and quantification of HRSV. Subsequently, we describe a human in vitro model in which peripheral blood mononuclear cells (PBMCs) are stimulated with live HRSV. This model system can be used to study multiple parameters that may contribute to disease severity, including the innate and adaptive immune response. These responses can be measured at the transcriptional and translational level. Moreover, viral infection of cells can easily be measured using flow cytometry. Taken together, stimulation of PBMC with live HRSV provides a fast and reproducible model system to examine mechanisms involved in HRSV-induced disease.

An In vitro Model to Study Immune Responses of Human Peripheral Blood Mononuclear Cells to Human Respiratory Syncytial Virus Infection

Human respiratory syncytial virus (HRSV) can cause severe bronchiolitis in young infants. Part of the pathogenesis of severe HRSV disease is caused by the host immune response. Stimulation of primary human immune cells with HRSV provides a fast and reproducible model system to study activation of inflammatory pathways and infection.

Human respiratory syncytial  virus (HRSV) infections present a broad spectrum of disease severity, ranging  from mild infections to life-threatening ...

Use of Galleria mellonella as a Model Organism to Study Legionella pneumophila Infection

Legionella pneumophila, the causative agent of a severe pneumonia named Legionnaires&#39; disease, is an important human pathogen that infects and replicates within alveolar macrophages. Its virulence depends on the Dot/Icm type IV secretion system (T4SS), which is essential to establish a replication permissive vacuole known as the Legionella containing vacuole (LCV). L. pneumophila infection can be modeled in mice however most mouse strains are not permissive, leading to the search for novel infection models. We have recently shown that the larvae of the wax moth Galleria mellonella are suitable for investigation of L. pneumophila infection. G. mellonella is increasingly used as an infection model for human pathogens and a good correlation exists between virulence of several bacterial species in the insect and in mammalian models. A key component of the larvae&#39;s immune defenses are hemocytes, professional phagocytes, which take up and destroy invaders. L. pneumophila is able to infect, form a LCV and replicate within these cells. Here we demonstrate protocols for analyzing L. pneumophila virulence in the G. mellonella model, including how to grow infectious L. pneumophila, pretreat the larvae with inhibitors, infect the larvae and how to extract infected cells for quantification and immunofluorescence microscopy. We also describe how to quantify bacterial replication and fitness in competition assays. These approaches allow for the rapid screening of mutants to determine factors important in L. pneumophila virulence, describing a new tool to aid our understanding of this complex pathogen.

Use of Galleria mellonella as a Model Organism to Study Legionella pneumophila Infection

The larva of the wax moth Galleria mellonella was recently established as an in vivo model to study Legionella pneumophila infection. Here, we demonstrate fundamental techniques to characterize the pathogenesis of Legionella in the larvae, including inoculation, measurement of bacterial virulence and replication as well as extraction and analysis of infected hemocytes.

Legionella pneumophila, the causative agent of a severe pneumonia named Legionnaires&#39; disease, is an important human pathogen that infects and ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of causing systemic disease in both fish and humans. A better understanding of S. iniae disease pathogenesis requires an appropriate model system. The genetic tractability and the optical transparency of the early developmental stages of zebrafish allow for the generation and non-invasive imaging of transgenic lines with fluorescently tagged immune cells. The adaptive immune system is not fully functional until several weeks post fertilization, but zebrafish larvae have a conserved vertebrate innate immune system with both neutrophils and macrophages. Thus, the generation of a larval infection model allows the study of the specific contribution of innate immunity in controlling S. iniae infection.
The site of microinjection will determine whether an infection is systemic or initially localized. Here, we present our protocols for otic vesicle injection of zebrafish aged 2-3 days post fertilization as well as our techniques for fluorescent confocal imaging of infection. A localized infection site allows observation of initial microbe invasion, recruitment of host cells and dissemination of infection. Our findings using the zebrafish larval model of S. iniae infection indicate that zebrafish can be used to examine the differing contributions of host neutrophils and macrophages in localized bacterial infections. In addition, we describe how photolabeling of immune cells can be used to track individual host cell fate during the course of infection.

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Here, we present a protocol for the generation and imaging of a localized bacterial infection in the zebrafish otic vesicle.

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Increased Recovery Time and Decreased LPS Administration to Study the Vagus Nerve Stimulation Mechanisms in Limited Inflammatory Responses

Inflammation is a local response to infection and tissue damage mediated by activated macrophages, monocytes, and other immune cells that release cytokines and other mediators of inflammation. For a long time, humoral and cellular mechanisms have been studied for their role in regulating the immune response, but recent advances in the field of immunology and neuroscience have also unraveled specific neural mechanisms with interesting therapeutic potential. The so-called cholinergic anti-inflammatory pathway (CAP) has been described to control innate immune responses and inflammation in a very potent manner. In the early 2000s, Tracey and collaborators developed a technique that stimulates the vagus nerve and mimics the effect of the pathway. The methodology is based on the electrical stimulation of the vagus nerve at low voltage and frequency, in order to avoid any side effects of overstimulation, such as deregulation of heart rate variability. Electrical devices for stimulation are now available, making it easy to set up the methodology in the laboratory. The goal of this research was to investigate the potential involvement of prostaglandins in the CAP. Unfortunately, based on earlier attempts, we failed to use the original protocol, as the induced inflammatory response either was too high or was not suitable for enzymatic metabolism properties. The different settings of the original surgery protocol remained mostly unchanged, but the conditions regarding inflammatory induction and the time point before sacrifice were improved to fit our purposes (i.e., to investigate the involvement of the CAP in more limited inflammatory responses). 
The modified version of the original protocol, presented here, includes a longer time range between vagus nerve stimulation and analysis, which is associated with a lower induction of inflammatory responses. Additionally, while decreasing the level of lipopolysaccharides (LPS) to inject, we also came across new observations regarding mechanistic properties in the spleen.

Vagus nerve stimulation has proven to have a strong efficacy for decreasing peripheral inflammation. Here, we present a modified vagus nerve stimulation protocol that allows for further examinations of the cholinergic anti-inflammatory mechanisms in limited inflammatory responses.

Inflammation is a local response to infection and tissue damage mediated by activated macrophages, monocytes, and other immune cells that release ...

The Galleria mellonella Waxworm Infection Model for Disseminated Candidiasis

Candida species are common fungal commensals of humans colonizing the skin, mucosal surfaces, and gastrointestinal tract. Under certain conditions, Candida can overgrow their natural niches resulting in debilitating mucosal infections as well as life-threatening systemic infections, which are a major focus of investigation due to their associated high mortality rates. Animal models of disseminated infection exist for studying disease progression and dissecting the characteristics of Candida pathogenicity. Of these, the Galleria mellonella waxworm infection model provides a cost-effective experimental tool for high-throughput investigations of systemic virulence. Many other bacterial and eukaryotic infectious agents have been effectively studied in G. mellonella to understand pathogenicity, making it a widely accepted model system. Yet, variation in the method used to infect G. mellonella can alter phenotypic outcomes and complicate interpretation of the results. Here, we outline the benefits and drawbacks of the waxworm model to study systemic Candida pathogenesis and detail an approach to improve reproducibility. Our results highlight the range of mortality kinetics in G. mellonella and describe the variables which can modulate these kinetics. Ultimately, this method stands as an ethical, rapid, and cost-effective approach to study virulence in a model of disseminated candidiasis.

The Galleria mellonella Waxworm Infection Model for Disseminated Candidiasis

Galleria mellonella serves as an invertebrate model for disseminated candidiasis. Here, we detail the infection protocol and provide supporting data for the model&#39;s effectiveness.

Candida species are common fungal commensals of humans colonizing the skin, mucosal surfaces, and gastrointestinal tract. Under certain conditions, ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence rates of S. aureus infection climbing annually, there is a demand for additional research in its&#160;pathogenicity. Animal models of infectious disease advance our understanding of the host-pathogen response and lead to the development of effective therapeutics. Neutrophils play a primary role in the innate immune response that controls S. aureus infections by forming an abscess to wall off the infection and facilitate bacterial clearance; the number of neutrophils that infiltrate an S. aureus skin infection often correlates with disease outcome. LysM-EGFP mice, which possess the enhanced green fluorescent protein (EGFP) inserted in the Lysozyme M (LysM) promoter region (expressed primarily by neutrophils), when used in conjunction with in vivo whole animal fluorescence imaging (FLI) provide&#160;a means of quantifying neutrophil emigration noninvasively and longitudinally into wounded skin. When combined with a bioluminescent S. aureus strain and sequential in vivo whole animal bioluminescent imaging (BLI), it is possible to longitudinally monitor both the neutrophil recruitment dynamics and in vivo bacterial burden at the site of infection in anesthetized mice from onset of infection to resolution or death. Mice are more resistant to a number of virulence factors produced by S. aureus that facilitate effective colonization and infection in humans. Immunodeficient mice provide a more sensitive animal model to examine persistent S. aureus infections and the ability of therapeutics to boost innate immune responses. Herein, we characterize responses in LysM-EGFP mice that have been bred to MyD88-deficient mice (LysM-EGFP&#215;MyD88-/- mice) along with wild-type LysM-EGFP mice to investigate S. aureus skin wound infection. Multispectral simultaneous detection enabled study of neutrophil recruitment dynamics by using in vivo FLI, bacterial burden by using in vivo BLI, and wound healing longitudinally and noninvasively over time.

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

An approach is described for real-time detection of the innate immune response to cutaneous wounding and Staphylococcus aureus infection of mice. By comparing LysM-EGFP mice (which possess fluorescent neutrophils) with a LysM-EGFP crossbred immunodeficient mouse strain, we advance our understanding of infection and the development of approaches to combat infection.

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

Use of the Invertebrate Galleria mellonella as an Infection Model to Study the Mycobacterium tuberculosis Complex

Tuberculosis is the leading global cause of infectious disease mortality and roughly a quarter of the world&#8217;s population is believed to be infected with Mycobacterium tuberculosis. Despite decades of research, many of the mechanisms behind the success of M. tuberculosis as a pathogenic organism remain to be investigated, and the development of safer, more effective antimycobacterial drugs are urgently needed to tackle the rise and spread of drug resistant tuberculosis. However, the progression of tuberculosis research is bottlenecked by traditional mammalian infection models that are expensive, time consuming, and ethically challenging. Previously we established the larvae of the insect Galleria mellonella (greater wax moth) as a novel, reproducible, low cost, high-throughput and ethically acceptable infection model for members of the M. tuberculosis complex. Here we describe the maintenance, preparation, and infection of G. mellonella with bioluminescent Mycobacterium bovis BCG lux. Using this infection model, mycobacterial dose dependent virulence can be observed, and a rapid readout of in vivo mycobacterial burden using bioluminescence measurements is easily achievable and reproducible. Although limitations exist, such as the lack of a fully annotated genome for transcriptomic analysis, ontological analysis against genetically similar insects can be carried out. As a low cost, rapid, and ethically acceptable model for tuberculosis, G. mellonella can be used as a pre-screen to determine drug efficacy and toxicity, and to determine comparative mycobacterial virulence prior to the use of conventional mammalian models. The use of the G. mellonella-mycobacteria model will lead to a reduction in the substantial number of animals currently used in tuberculosis research.

Use of the Invertebrate Galleria mellonella as an Infection Model to Study the Mycobacterium tuberculosis Complex

Galleria mellonella was recently established as a reproducible, cheap, and ethically acceptable infection model for the Mycobacterium tuberculosis complex. Here we describe and demonstrate the steps taken to establish successful infection of G. mellonella with bioluminescent Mycobacterium bovis BCG lux.

Tuberculosis is the leading global cause of infectious disease mortality and roughly a quarter of the world&#8217;s population is believed to be infected ...

Standardized Galleria mellonella Models for Preclinical Antimicrobial Testing

Galleria mellonella as an Antimicrobial Screening Model

To combat the rising global issue of antibiotic resistance, the accelerated development of novel antibiotics is essential. Current preclinical antimicrobial development yields a significant number of leads that prove unsuitable either prior to or during clinical trials. To increase the efficiency of preclinical development, relevant, standardized, accessible, and cost-effective models must be developed. Galleria mellonella (greater wax moth) larvae are widely used as an infection model to assess microbial virulence, conduct drug toxicity testing, and serve as a preliminary means of evaluating the in vivo efficacy of novel antimicrobial compounds. These infection models have greater biological relevance than many in vitro screens of comparable throughput and decrease reliance on mammalian models when used as a pre-screen for antimicrobial testing. This protocol describes a standardized methodology for the optimization of G. mellonella infection models, which can be applied to bacterial species and antimicrobial therapeutics of choice. Using the WHO priority pathogen Pseudomonas aeruginosa as an exemplar, we outline steps that can be undertaken to develop a reproducible model of infection and therapeutic testing. This includes recommendations on experimental setup, sample preparation, and infection and treatment protocols. Integration of this model within preclinical antimicrobial development pipelines would decrease reliance on mammalian models, reduce the number of ineffective compounds reaching clinical trials, and ultimately increase the efficiency of preclinical antimicrobial development.

Author Spotlight: Characterizing Airway Environments to Advance Model Systems and Antimicrobial Discovery in Cystic Fibrosis and Chronic Respiratory Infections

This study presents a standardized framework for optimizing G. mellonella infection models for use in preclinical antimicrobial assessment. The application of a G. mellonella model as part of a preclinical antimicrobial development pipeline could decrease the number of ineffective compounds progressing to clinical trials.

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

Summary

Explore More Videos

Chapters in this video

The Insect Galleria mellonella as a Powerful Infection Model to Investigate Bacterial Pathogenesis

An In vitro Model to Study Immune Responses of Human Peripheral Blood Mononuclear Cells to Human Respiratory Syncytial Virus Infection

Use of Galleria mellonella as a Model Organism to Study Legionella pneumophila Infection

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Increased Recovery Time and Decreased LPS Administration to Study the Vagus Nerve Stimulation Mechanisms in Limited Inflammatory Responses

The Galleria mellonella Waxworm Infection Model for Disseminated Candidiasis

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Use of the Invertebrate Galleria mellonella as an Infection Model to Study the Mycobacterium tuberculosis Complex

Galleria mellonella as an Antimicrobial Screening Model