Z. Lin was supported by National Institutes of Health HL138454-01 and Masonic Medical Research Institute funds.

All mice were maintained in pathogen-free conditions, and all procedures were approved by Masonic Medical research Institutional Animal Care and Use Committee (IACUC). UCP1::Cre9 and Rosa 26tdTomato mice lines13 were reported previously. All mice were kept at room temperature with a 12 h light/dark cycle.
1. Preparing the Solutions and brown adipose tissue (BAT)
<ol>
	<li>Prepare digestion solution and separation solution in 15 mL centrifuge tubes.</li>
	<li>10 mL of BAT Digestion solution: To 10 mL of sterile phosphate-buffered saline (PBS), add 3.5 mg/mL Dispase II, 1 mg/mL Collagenase II and 10 mM CaCl2 to make BAT digestion solution.</li>
	<li>10 mL of 12% iodixanol solution (separation solution): Mix 1 mL of 10x PBS, 2 mL of 60% iodixanol, 0.01 mL of 1 M MgCl2, 0.025 mL of 1 M KCl, 0.1 mL of 0.2 M ethylenediaminetetraacetic acid (EDTA) and 6.865 mL of ddH2O to obtain 12% iodixanol.</li>
	<li>Euthanize one adult mouse with CO2 overdose. Briefly, fill the mouse cage with 100% CO2 at a displacement rate of 10-30% cage volume per min. 5 min later, confirm death by checking for the absence of visibly breathing.</li>
	<li>Dissect the animal and collect interscapular BAT. Remove WAT and muscle layers under a stereo microscope.</li>
	<li>To have sufficient digestion, cut each BAT lobe into ~ 3 mm3 parts and place them into a clean 50 mL flask with a metal stir bar and 5 mL digestion solution. Before starting digestion, let the flask containing BAT and digestion buffer sit on ice for 1 h. 
	&#8203;NOTE: In the following steps, around 80 mg BAT was used for brown adipocytes isolation.</li>
</ol>
2. BAs isolation procedure
<ol>
	<li>Place the flask on a magnetic stirrer that is enclosed in an incubator. Set the stirring speed at 60 rpm and the temperature of the incubator at 35 &#176;C, respectively. The digestion will last for around 30 min. If the BAT slices form clumps around the stirrer bar during digestion, use a 1 mL pipette tip to disrupt the aggregated tissues.</li>
	<li>Place a 70 &#181;m strainer filter on top of a clean 50 mL centrifuge tube. Pipette around 4 mL cell suspension through the strainer. Wash the strainer with 4 mL of 12% iodixanol solution. Pipette up and down to mix the cells and the iodixanol solution. Transfer the cell mixture into two clear 5 mL polystyrene test tubes. 
	NOTE: At the end of digestion, the digestion solution should be cloudy, indicating sufficient digestion. Use fresh digestion solution every time. Once prepared, the digestion solution should be used within 2 h.</li>
	<li>Repeat step 2.2 and 2.3 once more if the digestion is not sufficient.</li>
	<li>Leave the clear polystyrene tubes containing the separation solution and BAs on ice for 1 h. The BAs will form a layer on the top.</li>
	<li>Take out 20 &#181;L of the isolated BAs for microscope examination.</li>
</ol>
3. RNA and protein isolation from BAs
<ol>
	<li>Pipette the BAs layer into two 1.7 mL microcentrifuge tubes for RNA and protein isolation. Carefully remove the excessive iodixanol solution without disrupting the BAs layer.</li>
	<li>Add 1 mL Trizol&#160;to simultaneously isolate RNA, DNA, and protein into the cell solution. Mix sufficiently to lyse the cells.</li>
	<li>Add 200 &#181;L of Chloroform to separate the phases.</li>
	<li>Centrifuge the tube for 9,981 x g for 10 min at 4 &#176;C.</li>
	<li>After centrifugation, use the aqueous phase for RNA isolation. In this study, total RNA was used for reverse transcription, and quantitative RT-PCR was carried out with Real-Time PCR. Primer sequences are listed in Table of Materials.</li>
	<li>Transfer 300 &#181;L of the organic phase into a 2 mL microcentrifuge tube.</li>
	<li>To the organic&#160;phase, add 2.5 volume 100% ethanol and vortex for 10 s.</li>
	<li>Add 200 &#181;L of 1-Bromo-3-chloropropane and vortex for 10 s.</li>
	<li>Add 600 &#181;L of double distilled water and vortex for 10 s.</li>
	<li>Let the mixed solution stand for 10 min at room temperature.</li>
	<li>Centrifuge at 9,981 x g for 10 min at 4 &#176;C. At this step, the phases will be separated. The protein phase is localized in the middle layer.</li>
	<li>Remove the top aqueous solution. Add 1 mL 100% ethanol into the remaining solution.</li>
	<li>Centrifuge for 10 min, 9,981 x g, 4 &#176;C. After centrifugation, the protein pellet will form. Discard the supernatant.</li>
	<li>Wash the pellet with 1 mL 100% ethanol.</li>
	<li>Centrifuge for 10 min, 9981 x g, 4 &#176;C. Save the pellet and discard the supernatant.</li>
	<li>Air-dry the pellet for 10 min at room temperature.</li>
	<li>Measure the weight of the wet pellet. Add in 1% SDS solution at a ratio of 20 &#181;L/mg pellet.</li>
	<li>Dissolve the pellet by putting the tube in a heated shaker. Set the temperature at 55 &#176;C, and the speed at 11 x g. It usually takes 5-10 min to completely dissolve the protein pellet. 
	NOTE: The concentration of the dissolved protein can be measured by BCA assay14.</li>
</ol>

<ol>
	<li>Zwick, R. K., Guerrero-Juarez, C. F., Horsley, V., Plikus, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anatomical,+physiological,+and+functional+diversity+of+adipose+tissue.">Anatomical, physiological, and functional diversity of adipose tissue.</a> Cell Metabolism. 27, 68-83 (2018).</li><li>Symonds, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+tissue+growth+and+development.">Brown adipose tissue growth and development.</a> Scientifica. 2013, 305763 (2013).</li><li>Giralt, M., Villarroya, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=White,+brown,+beige/brite:+Different+adipose+cells+for+different+functions.">White, brown, beige/brite: Different adipose cells for different functions.</a> Endocrinology. 154, 2992-3000 (2013).</li><li>Cannon, B., Nedergaard, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+tissue:+function+and+physiological+significance.">Brown adipose tissue: function and physiological significance.</a> Physiological Reviews. 84, 277-359 (2004).</li><li>Cinti, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+adipose+organ.">The adipose organ.</a> Prostaglandins, Leukotrienes and Essential Fatty Acids. 73, 9-15 (2005).</li><li>Wu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beige+adipocytes+are+a+distinct+type+of+thermogenic+fat+cell+in+mouse+and+human.">Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human.</a> Cell. 150, 366-376 (2012).</li><li>Cypess, A. M., Kahn, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+fat+as+a+therapy+for+obesity+and+diabetes.">Brown fat as a therapy for obesity and diabetes.</a> Current Opinion in Endocrinology, Diabetes and Obesity. 17, 143-149 (2010).</li><li>Schoettl, T., Fischer, I. P., Ussar, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterogeneity+of+adipose+tissue+in+development+and+metabolic+function.">Heterogeneity of adipose tissue in development and metabolic function.</a> Journal of Experimental Biology. 221, (2018).</li><li>Kong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRF4+is+a+key+thermogenic+transcriptional+partner+of+PGC-1&#945;.">IRF4 is a key thermogenic transcriptional partner of PGC-1&#945;.</a> Cell. 158, 69-83 (2014).</li><li>Lee, Y. H., Petkova, A. P., Konkar, A. A., Granneman, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+origins+of+cold-induced+brown+adipocytes+in+adult+mice.">Cellular origins of cold-induced brown adipocytes in adult mice.</a> The FASEB Journal. 29, 286-299 (2015).</li><li>Kim, W. -. S., Park, H. -. S., Sung, J. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+pivotal+role+of+PDGF+and+its+receptor+isoforms+in+adipose-derived+stem+cells.">The pivotal role of PDGF and its receptor isoforms in adipose-derived stem cells.</a> Histology and Histopathology. 30 (7), 793-799 (2015).</li><li>Hagberg, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometry+of+mouse+and+human+adipocytes+for+the+analysis+of+browning+and+cellular+heterogeneity.">Flow cytometry of mouse and human adipocytes for the analysis of browning and cellular heterogeneity.</a> Cell Report. 24, 2746-2756 (2018).</li><li>Madisen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+and+high-throughput+Cre+reporting+and+characterization+system+for+the+whole+mouse+brain.">A robust and high-throughput Cre reporting and characterization system for the whole mouse brain.</a> Nature Neuroscience. 13, 133-140 (2010).</li><li>Smith, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measurement+of+protein+using+bicinchoninic+acid.">Measurement of protein using bicinchoninic acid.</a> Analytical biochemistry. 150, 76-85 (1985).</li><li>Chey, S., Claus, C., Liebert, U. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+method+for+simultaneous+isolation+of+proteins+and+nucleic+acids.">Improved method for simultaneous isolation of proteins and nucleic acids.</a> Analytical Biochemistry. 411, 164-166 (2011).</li><li>Ford, T., Graham, J., Rickwood, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iodixanol:+A+nonionic+iso-osmotic+centrifugation+medium+for+the+formation+of+self-generated+gradients.">Iodixanol: A nonionic iso-osmotic centrifugation medium for the formation of self-generated gradients.</a> Analytical Biochemistry. 220, 360-366 (1994).</li><li>Kovacovicova, K., Vinciguerra, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+senescent+cells+by+iodixanol+(OptiPrep)+density+gradient-based+separation.">Isolation of senescent cells by iodixanol (OptiPrep) density gradient-based separation.</a> Cell Proliferation. 52, 12674 (2019).</li><li>Lock, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=versatile+manufacturing+of+recombinant+adeno-associated+viral+vectors+at+scale.">versatile manufacturing of recombinant adeno-associated viral vectors at scale.</a> Human Gene Therapy. 21, 1259-1271 (2010).</li><li>Marin, R. D., Crespo-Garcia, S., Wilson, A. M., Sapieha, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RELi+protocol:+Optimization+for+protein+extraction+from+white,+brown,+and+beige+adipose+tissues.">RELi protocol: Optimization for protein extraction from white, brown, and beige adipose tissues.</a> MethodsX. 6, 918-928 (2019).</li><li>Sonna, L. A., Fujita, J., Gaffin, S. L., Lilly, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invited+Review:+effects+of+heat+and+cold+stress+on+mammalian+gene+expression.">Invited Review: effects of heat and cold stress on mammalian gene expression.</a> Journal of Applied Physiology. 92, 1725-1742 (2002).</li><li>Gensch, N., Borchardt, T., Schneider, A., Riethmacher, D., Braun, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Different+autonomous+myogenic+cell+populations+revealed+by+ablation+of+Myf5-expressing+cells+during+mouse+embryogenesis.">Different autonomous myogenic cell populations revealed by ablation of Myf5-expressing cells during mouse embryogenesis.</a> Development. 135, 1597-1604 (2008).</li></ol>

In this study, a new method of isolating BAs for gene and protein expression analysis was developed.
In a published BAs isolation protocol, 3% BSA solution was used to enrich BAs12. Nevertheless, the enriched BAs achieved by this published protocol could not be directly used for protein expression analysis. This is because the concentrated BSA existing in the BAs solution interferes with following-up protein extraction. When the BAs enriched in the 3% BSA solution were ...

Both mice and humans have two types of adipose tissues: white adipose tissue (WAT) and brown adipose tissue (BAT)1. WAT stores energy in the form of triglycerides in white adipocytes, and the brown adipocytes (BAs) of BAT dissipate chemical energy as heat2. Based on their developmental origin, BAs are further categorized into classical BAs (cBAs) that formed during embryo development and white adipocytes derived BAs (beige/brite cells, converted from white adipocytes under stress conditions)3. BAs are multilocular and express the thermogenic protein uncoupling protein 1 (UCP1)4. Interscapular BAT (iBAT) depot is one of the primary cBAs depots in small mammals5, whereas beige cells are dispersed within WAT6. 
Due to their nature of dissipating energy, BAs have received much attention as a therapeutic target for reducing obesity7. To exploit BAs for the purpose of treating obesity, it is essential to understand the molecular mechanisms that control BAs function, survival, and recruitment. Adipose tissues including BAT and WAT are heterogeneous. Except for adipocytes, adipose tissues contain many other cell types, such as endothelial cells, mesenchymal stem cells and macrophages8. Although genetic tools to specifically deplete candidate genes in mice BAs are available, such as UCP1::Cre line9, techniques for purifying BAs from BAT or WAT are limited, making it hard to study BAs at a single-cell type level. Additionally, without obtaining pure BAs, the relationship between BAs and non-BAs will not be clearly delineated. For instance, platelet-derived growth factor receptor alpha (PDGFR&#945;) has been used as a marker for undifferentiated mesenchymal cells, and it is expressed in the endothelial and interstitial cells of BAT. In cold stressed BAT, PDGFR&#945; positive progenitor cells give rise to new BAs10. PDGFR&#945; is activated by its ligand PDGF, a growth factor that regulates the growth and proliferation of mesenchymal cells11; however, it is unclear whether BAs influence the behavior of PDGFR&#945; positive progenitor cells by secreting PDGF. 
Recently, a BAs isolation protocol has been published, which is based on fluorescence-activated cell sorting (FACS)12. In this protocol, 3% bovine serum albumin (BSA) solution was used to separate BAs from non-BAs, and the enriched BAs were further purified by FACS. The application of this protocol is limited by the requirement of FACS process, which relies on both equipment and FACS operation experiences. In this study, a new protocol for isolating BAs from BAT was developed. The BAs isolated by this protocol can be directly used for gene and protein expression studies. Furthermore, data from this study suggest that BAs are a major PDGF resource.

<table><tbody><tr><td>&lt;strong&gt;Antibodies&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Antigen&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog&lt;/strong&gt;</td><td></td></tr><tr><td>PPAR&amp;gamma;</td><td>LSBio</td><td>Ls-C368478</td><td></td></tr><tr><td>PDGFRa</td><td>Santa Cruz</td><td>sc-398206</td><td></td></tr><tr><td>UCP1</td><td>R&amp;amp;D system</td><td>IC6158P</td><td></td></tr><tr><td>&lt;strong&gt;Chemical and solutions&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Collagenase, Type II</td><td>Thermo Fisher Scientific</td><td>17101015</td><td></td></tr><tr><td>1-Bromo-3-chloropropane</td><td>Sigma-Aldrich</td><td>B62404</td><td></td></tr><tr><td>Bovine Serum Albumin (BSA)&amp;nbsp;</td><td>Goldbio</td><td>A-421-10</td><td></td></tr><tr><td>Calcium chloride</td><td>Bio Basic</td><td>CT1330</td><td></td></tr><tr><td>Chloroform</td><td>IBI Scientific</td><td>IB05040</td><td></td></tr><tr><td>Dispase II, protease</td><td>Sigma-Aldrich</td><td>D5693</td><td></td></tr><tr><td>EDTA</td><td>Bio Basic</td><td>EB0107</td><td></td></tr><tr><td>Ethanol</td><td>IBI Scientific</td><td>IB15724</td><td></td></tr><tr><td>LiQuant Universal Green qPCR Master Mix</td><td>LifeSct</td><td>LS01131905Y</td><td></td></tr><tr><td>Magnesium Chloride Hexahydrate</td><td>Boston BioProducts</td><td>P-855</td><td></td></tr><tr><td>OneScrip Plus cDNA Synthesis SuperMix</td><td>ABM</td><td>G454</td><td></td></tr><tr><td>OptiPrep (Iodixanol)</td><td>Cosmo Bio USA</td><td>AXS-1114542</td><td></td></tr><tr><td>PBS (10x)</td><td>Caisson Labs</td><td>PBL07</td><td></td></tr><tr><td>PBS (1x)</td><td>Caisson Labs</td><td>PBL06</td><td></td></tr><tr><td>Pierce BCA Protein Assay Kit</td><td>Thermo Fisher Scientific</td><td>23227</td><td></td></tr><tr><td>Potassium Chloride</td><td>Boston BioProducts</td><td>P-1435</td><td></td></tr><tr><td>SimplyBlue safe Stain</td><td>Invitrogen</td><td>LC6060</td><td></td></tr><tr><td>Sodium dodecyl sulfate (SDS)</td><td>Sigma-Aldrich</td><td>75746</td><td></td></tr><tr><td>Trizol reagent</td><td>Life technoologies</td><td>15596018</td><td></td></tr><tr><td>&lt;strong&gt;Primers&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Gene name (Species)&amp;nbsp;</td><td>Forward</td><td>Reverse</td><td></td></tr><tr><td>Pdgfra (Mouse)</td><td>CTCAGCTGTCTCCTCACAgG</td><td>CAACGCATCTCAGAGAAAAGG</td><td></td></tr><tr><td>Pdgfa (Mouse)</td><td>TGTGCCCATTCGCAGGAAGAG</td><td>TTGGCCACCTTGACACTGCG</td><td></td></tr><tr><td>36B4(Mouse)</td><td>TGCTGAACATCTCCCCCTTCTC</td><td>TCTCCACAGACAATGCCAGGAC</td><td></td></tr><tr><td>Ucp1</td><td>ACTGCCACACCTCCAGTCATT</td><td>CTTTGCCTCACTCAGGATTGG</td><td></td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Application&lt;/strong&gt;</td><td></td></tr><tr><td>Keyence BZ-X700</td><td>Keyence</td><td>Imaging brown adipocytes</td><td></td></tr><tr><td>Magnetic stirrer</td><td>VWR</td><td>Dissociate BAT</td><td></td></tr><tr><td>QuantStudio 6 Flex Real-Time PCR System</td><td>Applied Biosystem</td><td>Quantitative PCR</td><td></td></tr><tr><td>The Odyssey Fc Imaging system</td><td>LI-COR</td><td>Western blot immaging</td><td></td></tr></tbody></table>

isolating brown adipocytes from murine interscapular brown adipose tissue for gene and protein expression analysis

Brown adipose tissue (BAT) is responsible for non-shivering thermogenesis in mammals, and brown adipocytes (BAs) are the functional units of BAT. BAs contain both multilocular lipid droplets and abundant mitochondria, and they express uncoupling protein 1 (UCP1). BAs are categorized into two sub-types based on their origin: embryo derived classical BAs (cBAs) and white adipocytes derived BAs. Due to their relatively low density, BAs cannot be isolated from BAT with traditional centrifugation method. In this study, a new method was developed to isolate BAs from mice for gene and protein expression analysis. In this protocol, interscapular BAT from adult mice was digested with Collagenase and Dispase solution, and the dissociated BAs were enriched with 6% iodixanol solution. Isolated BAs were then lysed with Trizol&#160;reagent for simultaneous isolation of RNA, DNA, and protein. After RNA isolation, the organic phase of the lysate was used for protein extraction. Our data showed that 6% iodixanol solution efficiently enriched BAs without interfering with follow-up gene and protein expression studies. Platelet-derived growth factor (PDGF) is a growth factor that regulates the growth and proliferation of mesenchymal cells. Compared to the brown adipose tissue, isolated BAs had significantly higher expression of Pdgfa. In summary, this new method provides a platform for studying the biology of brown adipocytes at a single cell-type level.

Preparation of interacapular BAT for brown adipocytes isolation 
The brown adipocytes (BAs) isolation process is depicted in Figure 1A. The whole process, from preparing BAT and digestion/separation solutions to obtaining isolated BAs will take around 4 h.
In adult mice, abundant BAT exists in the interscapular region. This interscapular BAT (iBAT) is covered by muscle layers and WAT (Figure 1B). Before starting ...

Watch this Scientific Journal Video about Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis at JoVE.com

Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis

This study describes a new method of isolating murine brown adipocytes for gene and protein expression analysis.

Brown adipose tissue (BAT) is responsible for non-shivering thermogenesis in mammals, and brown adipocytes (BAs) are the functional units of BAT. BAs ...

isolating-brown-adipocytes-from-murine-interscapular-brown-adipose

Research

JoVE Journal

Immunology and Infection

5.3K Views.  Masonic Medical Research Institute. This study describes a new method of isolating murine brown adipocytes for gene and protein expression analysis.

Video: Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis

Chromatin Immunoprecipitation of Murine Brown Adipose Tissue

Most cellular processes are regulated by transcriptional modulation of specific gene programs. Such modulation is achieved through the combined actions of a wide range of transcription factors (TFs) and cofactors mediating transcriptional activation or repression via changes in chromatin structure. Chromatin immunoprecipitation (ChIP) is a useful molecular biology approach for mapping histone modifications and profiling transcription factors/cofactors binding to DNA, thus providing a snapshot of the dynamic nuclear changes occurring during different biological processes.
To study transcriptional regulation in adipose tissue, samples derived from in vitro cell cultures of immortalized or primary cell lines are often favored in ChIP assays because of the abundance of starting material and reduced biological variability. However, these models represent a limited snapshot of the actual chromatin state in living organisms. Thus, there is a critical need for optimized protocols to perform ChIP on adipose tissue samples derived from animal models.
Here we describe a protocol for efficient ChIP-seq of both histone modifications and non-histone proteins in brown adipose tissue (BAT) isolated from a mouse. The protocol is optimized for investigating genome-wide localization of proteins of interest and epigenetic markers in the BAT, which is a morphologically and physiologically distinct tissue amongst fat depots.

Here we describe a protocol for efficient chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) of brown adipose tissue (BAT) isolated from a mouse. This protocol is suitable for both mapping histone modifications and investigating genome-wide localization of non-histone proteins of interest in vivo.

Most cellular processes are regulated by transcriptional modulation of specific gene programs. Such modulation is achieved through the combined actions of ...

Genetics

Isolation of Adipose Tissue Nuclei for Single-Cell Genomic Applications

Brown and beige fat are specialized adipose tissues that dissipate energy for thermogenesis by UCP1 (Uncoupling Protein-1)-dependent and independent pathways. Until recently, thermogenic adipocytes were considered a homogeneous population. However, recent studies have indicated that there are multiple subtypes or subpopulations that are distinct in developmental origin, substrate use, and transcriptome. Despite advances in single-cell genomics, unbiased decomposition of adipose tissues into cellular subtypes has been challenging because of the fragile nature of lipid-filled adipocytes. The protocol presented was developed to circumvent these obstacles by effective isolation of single nuclei from adipose tissue for downstream applications, including RNA sequencing. Cellular heterogeneity can then be analyzed by RNA sequencing and bioinformatic analyses.

This publication describes a protocol for the isolation of nuclei from mature adipocytes, purification by fluorescence-activated sorting, and single-cell level transcriptomics.

Brown and beige fat are specialized adipose tissues that dissipate energy for thermogenesis by UCP1 (Uncoupling Protein-1)-dependent and independent ...

Isolation and Processing of Murine White Adipocytes for Transcriptome and Epigenome Analyses

Obesity is a complex disease influenced by genetics, epigenetics, the environment, and their interactions. Mature adipocytes represent the major cell type in white adipose tissue. Understanding how adipocytes function and respond to (epi)genetic and environmental signals is essential for identifying the cause(s) of obesity. RNA and chromatin have previously been isolated from adipocytes using enzymatic digestion. In addition, protocols have been developed for nuclear isolation, where purification is achieved by fluorescence-activated cell sorting (FACS) of adipocyte-specific transgenic reporters. One of the greatest challenges to achieving high yield and quality during such protocols is the substantial amount of lipid contained in adipose tissue. The present protocol describes an optimized procedure for isolating mature adipocytes that leverages heptane to separate lipids from the targets of interest (RNA/chromatin). The resulting RNA has high integrity and generates high-quality RNA-seq results. Likewise, the procedure improves nuclei yield rate and generates reproducible ChIP-seq results across samples. Therefore, the current study provides a reliable and universal murine adipocyte isolation protocol suitable for whole-genome transcriptome and epigenome studies.

The present protocol summarizes a universal method for isolating, purifying, and upstream processing of murine white adipocytes optimized for downstream total RNA sequencing, Nuclei Extraction by SONication (NEXSON), and ChIP-seq.

Obesity is a complex disease influenced by genetics, epigenetics, the environment, and their interactions. Mature adipocytes represent the major cell type ...

Localization, Identification, and Excision of Murine Adipose Depots

Obesity has increased dramatically in the last few decades and affects over one third of the adult US population. The economic effect of obesity in 2005 reached a staggering sum of $190.2 billion in direct medical costs alone. Obesity is a major risk factor for a wide host of diseases. Historically, little was known regarding adipose and its major and essential functions in the body. Brown and white adipose are the two main types of adipose but current literature has identified a new type of fat called brite or beige adipose. Research has shown that adipose depots have specific metabolic profiles and certain depots allow for a propensity for obesity and other related disorders. The goal of this protocol is to provide researchers the capacity to identify and excise adipose depots that will allow for the analysis of different factorial effects on adipose; as well as the beneficial or detrimental role adipose plays in disease and overall health. Isolation and excision of adipose depots allows investigators to look at gross morphological changes as well as histological changes. The adipose isolated can also be used for molecular studies to evaluate transcriptional and translational change or for in vitro experimentation to discover targets of interest and mechanisms of action. This technique is superior to other published techniques due to the design allowing for isolation of multiple depots with simplicity and minimal contamination.

Due to the drastic and negative connection between obesity and other comorbidities, research on the role adipose plays in disease and overall health is warranted. We present a protocol for the isolation and excision of adipose depots allowing for the study of adipose using in situ and in vitro methods.

Obesity has increased dramatically in the last few decades and affects over one third of the adult US population. The economic effect of obesity in 2005 ...

Medicine

Isolation and Differentiation of Stromal Vascular Cells to Beige/Brite Cells

Brown adipocytes have the ability to uncouple the respiratory chain in mitochondria and dissipate chemical energy as heat. Development of UCP1-positive brown adipocytes in white adipose tissues (so called beige or brite cells) is highly induced by a variety of environmental cues such as chronic cold exposure or by PPAR&gamma; agonists, therefore, this cell type has potential as a therapeutic target for obesity treatment. Although most immortalized adipocyte lines cannot recapitulate the process of "browning" of white fat in culture, primary adipocytes isolated from stromal vascular fraction in subcutaneous white adipose tissue (WAT) provide a reliable cellular system to study the molecular control of beige/brite cell development. Here we describe a protocol for effective isolation of primary preadipocytes and for inducing differentiation to beige/brite cells in culture. The browning effect can be assessed by the expression of brown fat-selective markers such as UCP1.

Primary white preadipocytes isolated from white adipose tissues in mice can be differentiated into beige/brite cells. Presented here is a reliable cellular model system to study the molecular regulation of "browning" of white fat.

Brown adipocytes have the ability to uncouple the  respiratory chain in mitochondria and dissipate chemical energy as heat.  Development of UCP1-positive ...

Biology

Isolation of Adipogenic and Fibro-Inflammatory Stromal Cell Subpopulations from Murine Intra-Abdominal Adipose Depots

The stromal-vascular fraction (SVF) of white adipose tissue (WAT) is remarkably heterogeneous and consists of numerous cell types that contribute functionally to the expansion and remodeling of WAT in adulthood. A tremendous barrier to studying the implications of this cellular heterogeneity is the inability to readily isolate functionally distinct cell subpopulations from WAT SVF for in vitro and in vivo analyses. Single-cell sequencing technology has recently identified functionally distinct fibro-inflammatory and adipogenic PDGFR&#946;+ perivascular cell subpopulations in intra-abdominal WAT depots of adult mice. Fibro-inflammatory progenitors (termed, &#8220;FIPs&#8221;) are non-adipogenic collagen producing cells that can exert a pro-inflammatory phenotype. PDGFR&#946;+ adipocyte precursor cells (APCs) are highly adipogenic both in vitro and in vivo upon cell transplantation. Here, we describe multiple methods for the isolation of these stromal cell subpopulations from murine intra-abdominal WAT depots. FIPs and APCs can be isolated by fluorescence-activated cell sorting (FACS) or by taking advantage of biotinylated antibody-based immunomagnetic bead technology. Isolated cells can be used for molecular and functional analysis. Studying the functional properties of stromal cell subpopulation in isolation will expand our current knowledge of adipose tissue remodeling under physiological or pathological conditions on the cellular level.

This protocol describes the technical approach to isolate adipogenic and fibro-inflammatory stromal cell subpopulations from murine intra-abdominal white adipose tissue (WAT) depots by fluorescence-activated cell sorting or immunomagnetic bead separation.

The stromal-vascular fraction (SVF) of white adipose tissue (WAT) is remarkably heterogeneous and consists of numerous cell types that contribute ...

Isolation and Differentiation of Primary White and Brown Preadipocytes from Newborn Mice

The understanding of the mechanisms underlying adipocyte differentiation and function has greatly benefited from the use of immortalized white preadipocyte cell lines. These cultured cell lines, however, have limitations. They do not fully capture the diverse functional spectrum of the heterogenous adipocyte populations that are now known to exist within white adipose depots. To provide a more physiologically relevant model to study the complexity of white adipose tissue, a protocol has been developed and optimized to enable simultaneous isolation of primary white and brown adipocyte progenitors from newborn mice, their rapid expansion in culture, and their differentiation in vitro into mature, fully functional adipocytes. The primary advantage of isolating primary cells from newborn, rather than adult mice, is that the adipose depots are actively developing and are, therefore, a rich source of proliferating preadipocytes. Primary preadipocytes isolated using this protocol differentiate rapidly upon reaching confluence and become fully mature in 4-5 days, a temporal window that accurately reflects the appearance of developed fat pads in newborn mice. Primary cultures prepared using this strategy can be expanded and studied with high reproducibility, making them suitable for genetic and phenotypic screens and enabling the study of the cell-autonomous adipocyte phenotypes of genetic mouse models. This protocol offers a simple, rapid, and inexpensive approach to study the complexity of adipose tissue in vitro.

This report describes a protocol for the simultaneous isolation of primary brown and white preadipocytes from newborn mice. Isolated cells can be grown in culture and induced to differentiate into fully mature white and brown adipocytes. The method enables genetic, molecular, and functional characterization of primary fat cells in culture.

The understanding of the mechanisms underlying adipocyte differentiation and function has greatly benefited from the use of immortalized white ...

Differentiation and Imaging of Brown Adipocytes from the Stromal Vascular Fraction of Interscapular Adipose Tissue from Newborn Mice

Brown adipose tissue (BAT) is only present in mammals and has a thermogenic function. Brown adipocytes are characterized by a multilocular cytoplasm with multiple lipid droplets, a central nucleus, a high mitochondrial content, and the expression of uncoupling protein 1 (UCP1). BAT has been proposed as a potential therapeutic target for obesity and its associated metabolic disorders due to its ability to dissipate metabolic energy as heat. To investigate BAT function and regulation, brown adipocyte culturing is indispensable. The present protocol optimizes tissue processing and cell differentiation for culturing brown adipocytes from newborn mice. Additionally, procedures for the imaging of differentiated adipocytes with both confocal immunofluorescence and transmission electron microscopy are shown. In the brown adipocytes differentiated with the techniques described herein, the major defining features of classical BAT are preserved, including high UCP1 levels, increased mitochondrial mass, and very close physical contact between the lipid droplets and mitochondria, making this method a valuable tool for BAT studies.

Preadipocytes are isolated from the stromal vascular fraction of interscapular brown adipose tissue from newborn mice and differentiated into cells that accumulate lipid droplets, express molecular markers, and show the mitochondrial morphology of mature brown adipocytes. These cells are further analyzed by immunofluorescence and transmission electron microscopy.

Brown adipose tissue (BAT) is only present in mammals and has a thermogenic function. Brown adipocytes are characterized by a multilocular cytoplasm with ...

Semi-Automated Isolation of Murine White Adipose Tissue

Semi-Automated Isolation of the Stromal Vascular Fraction from Murine White Adipose Tissue Using a Tissue Dissociator

The in vitro study of white, brown, and beige adipocyte differentiation enables the investigation of cell-autonomous functions of adipocytes and their mechanisms. Immortalized white preadipocyte cell lines are publicly available and widely used. However, the emergence of beige adipocytes in white adipose tissue in response to external cues is difficult to recapitulate to the full extent using publicly available white adipocyte cell lines. Isolation of the stromal vascular fraction (SVF) from murine adipose tissue is commonly executed to obtain primary preadipocytes and perform adipocyte differentiation. However, mincing and collagenase digestion of adipose tissue by hand can result in experimental variation and is prone to contamination. Here, we present a modified semi-automated protocol that utilizes a tissue dissociator for collagenase digestion to achieve easier isolation of the SVF, with the aim of reducing experimental variation, reducing contamination, and increasing reproducibility. The obtained preadipocytes and differentiated adipocytes can be used for functional and mechanistic analyses.

Author Spotlight: Semi-Automated Isolation of the Stromal Vascular Fraction from Murine White Adipose Tissue Using a Tissue Dissociator  

This protocol describes the semi-automated isolation of the stromal vascular fraction (SVF) from murine adipose tissue to obtain preadipocytes and achieve adipocyte differentiation in vitro. Using a tissue dissociator for collagenase digestion reduces experimental variation and increases reproducibility.

The in vitro study of white, brown, and beige adipocyte differentiation enables the investigation of cell-autonomous functions of adipocytes and their ...

Morphological and Molecular Characterization of the scBAT in Mice

Dissection, Histological Processing, and Gene Expression Analysis of Murine Supraclavicular Brown Adipose Tissue

Brown adipose tissue (BAT)-mediated thermogenesis plays an important role in the regulation of metabolism, and its morphology and function can be greatly impacted by environmental stimuli in mice and humans. Currently, murine interscapular BAT (iBAT), which is located between two scapulae in the upper dorsal flank of mice, is the main BAT depot used by research laboratories to study BAT function. Recently, a few previously unknown BAT depots were identified in mice, including one analogous to human supraclavicular brown adipose tissue. Unlike iBAT, murine supraclavicular brown adipose tissue (scBAT) is situated in the intermediate layer of the neck and thus cannot be accessed as readily.
To facilitate the study of newly identified mouse scBAT, presented herein is a protocol detailing the steps to dissect intact scBAT from postnatal and adult mice. Due to scBAT&#39;s small size relative to other adipose depots, procedures have been modified and optimized specifically for processing scBAT. Among these modifications is the use of a dissecting microscope during tissue collection to increase the precision and homogenization of frozen scBAT samples to raise the efficiency of subsequent qPCR analysis. With these optimizations, the identification of, morphological appearance of, and molecular characterization of the scBAT can be determined in mice.

Author Spotlight: Optimizing Supraclavicular Brown Adipose Tissue Extraction for Genetic Analysis

Here, we provide a practical procedure for dissecting and performing histological and gene expression analyses of murine supraclavicular brown adipose tissue.

Brown adipose tissue (BAT)-mediated thermogenesis plays an important role in the regulation of metabolism, and its morphology and function can be greatly ...