Name: directly measuring forces within reconstituted active microtubule bundles
Uploaded: 2022-05-10T15:00:00
Description: Watch this Scientific Journal Video about Directly Measuring Forces Within Reconstituted Active Microtubule Bundles at JoVE.com

The authors wish to acknowledge support from R21 AG067436 (to JP and SF), T32 AG057464 (to ET), and Rensselaer Polytechnic Institute School of Science Startup Funds (to SF).

1. Preparation of microtubules
NOTE: When employing GFP-labeled crosslinking proteins, red (e.g., rhodamine) and far-red (e.g., biotinylated HiLyte647, referred to as biotinylated far red in the rest of the text) organic fluorophore labeling of the microtubules works well. Minimal crosstalk between all three channels can be achieved during imaging by using a high-quality quad band total internal reflection fluorescence (TIRF) filter.
<ol>
	<li>Prepare GMPCPP microtubule seed...

Microtubule networks are employed by myriad cell types to accomplish a wide range of tasks that are fundamentally mechanical in nature. In order to describe how cells function in both healthy and disease states, it is critical to understand how these micron-scale networks are organized and regulated by the nanometer-sized proteins that collectively build them. Biophysical tools such as optical tweezers are well suited to probing the mechanochemistry of key proteins at this scale. Reflecting the diversity of microtubule n...

Cells employ microtubule networks to perform a wide variety of mechanical tasks, ranging from vesicle transport1,2,3 to chromosome segregation during mitosis4,5,6. Many of the proteins that interact with microtubules, such as the molecular motor proteins kinesin and dynein, generate forces and are regulated by mechanical loads. To better understand how these critical molecules function, researchers have employed single-molecule biophysical methods, such as optical trapping and TIRF microscopy, to directly monitor critical parameters such as unloaded stepping rates, processivity, and force-velocity relationships for individual proteins. The most commonly used experimental geometry has been to attach motor proteins directly to trapping beads whose spherical geometry and size mimic vesicles undergoing motor-driven transport. Numerous kinesins, including kinesin-17,8,9, kinesin-210,11,12, kinesin-313,14,15,16 kinesin-517,18, kinesin-819,20, as well as dynein and dynein complexes21,22,23,24,25, have been studied with these methods.
In many cellular processes, however, motor and non-motor proteins use microtubules both as track and cargo26,27. Moreover, in these scenarios where microtubule filaments are crosslinked into higher-order bundles, these proteins function as ensembles rather than single units. For example, within dividing somatic cells, dense filament networks self-organize to build the mitotic spindle apparatus28,29,30. The interpolar spindle microtubule network is highly dynamic and is largely arranged with minus-ends pointing toward the spindle poles and plus-ends overlapping near the spindle equator. Filaments within the spindle are crosslinked by motor proteins such as kinesin-531,32,33, kinesin-1234,35,36, and kinesin-1437,38,39, or by non-motor proteins such as PRC140,41,42,43 or NuMA44,45,46. They frequently move or experience mechanical stress during processes such as poleward flux or while coordinating chromosome centering during metaphase or chromosome segregation during anaphase47,48,49,50,51,52. The integrity of the micron-scale spindle apparatus through mitosis, therefore, relies on a carefully regulated balance of pushing and pulling forces generated and sustained by this network of interacting filaments. However, the tools needed to probe this mechanical regulation and explain how protein ensembles work in concert to coordinate microtubule motions and produce the forces needed to properly assemble the spindle have only recently been developed, and we are just beginning to understand the biophysical rules that define dynamic microtubule networks.
The goal of this manuscript is to demonstrate the steps required to reconstitute crosslinked microtubule pairs in vitro, immobilize these bundles in a microscopy chamber that allows for simultaneous fluorescence visualization of both the microtubules and crosslinking proteins and nanoscale force measurement, and process these data robustly. We detail the steps needed to stably polymerize fluorescence-labeled microtubules, prepare microscope coverslips for attachment, prepare polystyrene beads for optical trapping experiments, and assemble crosslinked filament networks that preserve their in vivo functionality while allowing for direct biophysical manipulation.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>10W Ytterbium Fiber Laser, 1064nm</td>
			<td>IPG Photonics</td>
			<td>YLR-10-1064-LP</td>
			<td></td>
		</tr>
		<tr>
			<td>405/488/561/640nm Laser Quad Band Set for TIRF applications</td>
			<td>Chroma</td>
			<td>TRF89901v2</td>
			<td></td>
		</tr>
		<tr>
			<td>6x His Tag Antibody, Biotin Conjugate</td>
			<td>Invitrogen</td>
			<td>#MA1-21315-BTIN</td>
			<td></td>
		</tr>
		<tr>
			<td>Acetone, HPLC grade</td>
			<td>Fisher Scientific</td>
			<td>18-608-395</td>
			<td></td>
		</tr>
		<tr>
			<td>Alpha casein from bovine milk</td>
			<td>Sigma</td>
			<td>1002484390</td>
			<td></td>
		</tr>
		<tr>
			<td>ATP</td>
			<td>Fisher Scientific</td>
			<td>BP413-25</td>
			<td></td>
		</tr>
		<tr>
			<td>Benzonase</td>
			<td>Novagen</td>
			<td>70746-3</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotin-PEG-SVA-5000</td>
			<td>Laysan Bio, Inc.</td>
			<td>NC0479433</td>
			<td></td>
		</tr>
		<tr>
			<td>BL21 (DE3) Rosetta Cells</td>
			<td>Millipore Sigma</td>
			<td>71-400-3</td>
			<td></td>
		</tr>
		<tr>
			<td>Catalase</td>
			<td>MP Biomedicals LLC</td>
			<td>190311</td>
			<td></td>
		</tr>
		<tr>
			<td>CFI Apo 100X/1.49NA oil immersion TIRF objective</td>
			<td>Nikon</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloramphenicol</td>
			<td>ACROS Organics</td>
			<td>227920250</td>
			<td></td>
		</tr>
		<tr>
			<td>Coverslip Mini-Rack, for 8 coverslips</td>
			<td>Fisher Scientific</td>
			<td>C14784</td>
			<td></td>
		</tr>
		<tr>
			<td>Delicate Task Wipers</td>
			<td>Kimberly-Clark</td>
			<td>34120</td>
			<td></td>
		</tr>
		<tr>
			<td>Dextrose Anhydrous</td>
			<td>Fisher Scientific</td>
			<td>BP3501</td>
			<td></td>
		</tr>
		<tr>
			<td>D-Sucrose</td>
			<td>Fisher Scientific</td>
			<td>BP220-1</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT</td>
			<td>Fisher Scientific</td>
			<td>BP172-25</td>
			<td></td>
		</tr>
		<tr>
			<td>Ecoline Immersion Thermostat E100 with 003 Bath</td>
			<td>LAUDA-Brinkmann</td>
			<td>27709</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Fisher Scientific</td>
			<td>BP118-500</td>
			<td></td>
		</tr>
		<tr>
			<td>EGTA</td>
			<td>Millipore Corporation</td>
			<td>32462-25GM</td>
			<td></td>
		</tr>
		<tr>
			<td>FIJI / Image J</td>
			<td>https://fiji.sc/</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Frosted Microscope Slides</td>
			<td>Corning</td>
			<td>12-553-10</td>
			<td>75mmx25mm, with thickness of 0.9-1.1mm</td>
		</tr>
		<tr>
			<td>Glucose Oxidase</td>
			<td>MP Biomedicals LLC</td>
			<td>195196</td>
			<td>Type VII, without added oxygen</td>
		</tr>
		<tr>
			<td>GMPCPP</td>
			<td>Jena Biosciences</td>
			<td>JBS-NU-405S</td>
			<td>Can be stored for several months at -20 &#176;C and up to a year at -80 &#176;C</td>
		</tr>
		<tr>
			<td>Gold Seal-Cover Glass</td>
			<td>Thermo Scientific</td>
			<td>3405</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Fisher Scientific</td>
			<td>BP310-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Imidazole</td>
			<td>Fisher Scientific</td>
			<td>03196-500</td>
			<td></td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Fisher Scientific</td>
			<td>BP1755-10</td>
			<td></td>
		</tr>
		<tr>
			<td>Laboratory dessicator</td>
			<td>Bel-Art</td>
			<td>999320237</td>
			<td>190mm plate size</td>
		</tr>
		<tr>
			<td>Kanamycin Sulfate</td>
			<td>Fischer Scientific</td>
			<td>BP906-5</td>
			<td></td>
		</tr>
		<tr>
			<td>KIF5A K439 (aa:1-439)-6His</td>
			<td>Gilbert Lab, RPI</td>
			<td>N/A</td>
			<td>doi.org/10.1074/jbc.RA118.002182</td>
		</tr>
		<tr>
			<td>Kimwipe</td>
			<td>Kimberley Clark</td>
			<td>Z188956</td>
			<td>lint-free tissue</td>
		</tr>
		<tr>
			<td>Immersion Oil, Type B</td>
			<td>Cargille</td>
			<td>16484</td>
			<td></td>
		</tr>
		<tr>
			<td>Lens Tissue</td>
			<td>ThorLabs</td>
			<td>MC-5</td>
			<td></td>
		</tr>
		<tr>
			<td>LuNA Laser launch (4 channel: 405, 488, 561, 640nm)</td>
			<td>Nikon</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Lysozyme</td>
			<td>MP Biomedicals LLC</td>
			<td>100834</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium Acetate Tetrahydrate</td>
			<td>Fisher Scientific</td>
			<td>BP215-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Microfuge 18</td>
			<td>Beckman Coulter</td>
			<td>367160</td>
			<td></td>
		</tr>
		<tr>
			<td>MPEG-SVA MW-5000</td>
			<td>Laysan Bio, Inc.</td>
			<td>NC0107576</td>
			<td></td>
		</tr>
		<tr>
			<td>Neutravadin</td>
			<td>Invitrogen</td>
			<td>PI31000</td>
			<td></td>
		</tr>
		<tr>
			<td>Nikon Ti-E inverted microscope</td>
			<td>Nikon</td>
			<td>N/A</td>
			<td>Nikon LuN4 Laser</td>
		</tr>
		<tr>
			<td>Ni-NTA Resin</td>
			<td>Thermo Scientific</td>
			<td>88221</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide - CACCTATTCTGAGTTTGCGCGA 
			GAACTTTCAAAGGC</td>
			<td>IDT</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide - GCCTTTGAAAGTTCTCGCGCAA 
			ACTCAGAATAGGTG</td>
			<td>IDT</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Open-top thickwall polycarbonate tube, 0.2 mL, 7 mm x 22 mm</td>
			<td>Beckman Coulter</td>
			<td>343755</td>
			<td></td>
		</tr>
		<tr>
			<td>Optima-TLX Ultracentrifuge</td>
			<td>Beckman Coulter</td>
			<td>361544</td>
			<td></td>
		</tr>
		<tr>
			<td>Paclitaxel (Taxol equivalent)</td>
			<td>Thermo Fisher Scientific</td>
			<td>P3456</td>
			<td></td>
		</tr>
		<tr>
			<td>PIPES</td>
			<td>ACROS Organics</td>
			<td>172615000</td>
			<td></td>
		</tr>
		<tr>
			<td>PMSF</td>
			<td>Millipore</td>
			<td>7110-5GM</td>
			<td></td>
		</tr>
		<tr>
			<td>Porcine Tubulin, biotin label</td>
			<td>Cytoskeleton, Inc.</td>
			<td>T333P</td>
			<td></td>
		</tr>
		<tr>
			<td>Porcine Tubulin, HiLyte 647 Fluor</td>
			<td>Cytoskeleton, Inc.</td>
			<td>TL670M</td>
			<td>far red labelled</td>
		</tr>
		<tr>
			<td>Porcine Tubulin, Rhodamine</td>
			<td>Cytoskeleton, Inc.</td>
			<td>TL590M</td>
			<td></td>
		</tr>
		<tr>
			<td>Porcine Tubulin, Tubulin Protein</td>
			<td>Cytoskeleton, Inc.</td>
			<td>T240</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium Acetate</td>
			<td>Fisher Scientific</td>
			<td>BP364-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Prime 95B sCMOS camera</td>
			<td>Photometric</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Quadrant Detector Sensor Head</td>
			<td>ThorLabs</td>
			<td>PDQ80A</td>
			<td></td>
		</tr>
		<tr>
			<td>Quikchange Lightning Kit</td>
			<td>Agilent Technologies</td>
			<td>210518</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Bicarbonate</td>
			<td>Fisher Scientific</td>
			<td>S233-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Phosphate Dibasic Anhydrous</td>
			<td>Fisher Scientific</td>
			<td>BP332-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Square Cover Glasses</td>
			<td>Corning</td>
			<td>12-553-450</td>
			<td>18 mm x 18 mm, with thickness of 0.13-0.17 mm</td>
		</tr>
		<tr>
			<td>Streptavidin Microspheres</td>
			<td>Polysciences Inc.</td>
			<td>24162-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose-6 Column</td>
			<td>GE Healthcare</td>
			<td>29-0915--96</td>
			<td></td>
		</tr>
		<tr>
			<td>TCEP</td>
			<td>Thermo Scientific</td>
			<td>77720</td>
			<td></td>
		</tr>
		<tr>
			<td>TLA-100 Fixed-Angle Rotor</td>
			<td>Beckman Coulter</td>
			<td>343840</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultrasonic Cleaner (Sonicator)</td>
			<td>Vevor</td>
			<td>JPS-08A(DD)</td>
			<td>304 stainless steel, 40 kHz frequency, 60 W power</td>
		</tr>
		<tr>
			<td>Vectabond APTES solution</td>
			<td>Vector Laboratories</td>
			<td>SP-1800-7</td>
			<td></td>
		</tr>
		<tr>
			<td>Windex Powerized Glass Cleaner with Ammonia-D</td>
			<td>S.C. Johnson</td>
			<td>SJN695237</td>
			<td></td>
		</tr>
	</tbody>
</table>

directly measuring forces within reconstituted active microtubule bundles

Microtubule networks are employed in cells to accomplish a wide range of tasks, ranging from acting as tracks for vesicle transport to working as specialized arrays during mitosis to regulate chromosome segregation. Proteins that interact with microtubules include motors such as kinesins and dynein, which can generate active forces and directional motion, as well as non-motor proteins that crosslink filaments into higher-order networks or regulate filament dynamics. To date, biophysical studies of microtubule-associated proteins have overwhelmingly focused on the role of single motor proteins needed for vesicle transport, and significant progress has been made in elucidating the force-generating properties and mechanochemical regulation of kinesins and dyneins. However, for processes in which microtubules act both as cargo and track, such as during filament sliding within the mitotic spindle, much less is understood about the biophysical regulation of ensembles of the crosslinking proteins involved. Here, we detail our methodology for directly probing force generation and response within crosslinked microtubule minimal networks reconstituted from purified microtubules and mitotic proteins. Microtubule pairs are crosslinked by proteins of interest, one microtubule is immobilized to a microscope coverslip, and the second microtubule is manipulated by an optical trap. Simultaneous total internal reflection fluorescence microscopy allows for multichannel visualization of all the components of this microtubule network as the filaments slide apart to generate force. We also demonstrate how these techniques can be used to probe pushing forces exerted by kinesin-5 ensembles and how viscous braking forces arise between sliding microtubule pairs crosslinked by the mitotic MAP PRC1. These assays provide insights into the mechanisms of spindle assembly and function and can be more broadly adapted to study dense microtubule network mechanics in diverse contexts, such as the axon and dendrites of neurons and polar epithelial cells.

The preparation of microtubule bundles suitable for biophysical analysis is considered successful if several of the key criteria are met. First, imaging in three colors should reveal two aligned microtubules with a concentration of crosslinking protein preferentially decorating the overlap region (Figure 5B,C and Figure 6B). Ideally, the distance between the overlap edge and the free end of the rhodamine microtubule should be at...

Watch this Scientific Journal Video about Directly Measuring Forces Within Reconstituted Active Microtubule Bundles at JoVE.com

Directly Measuring Forces Within Reconstituted Active Microtubule Bundles

Here, we present a protocol for reconstituting microtubule bundles in vitro and directly quantifying the forces exerted within them using simultaneous optical trapping and total internal reflection fluorescence microscopy. This assay allows for nanoscale-level measurement of the forces and displacements generated by protein ensembles within active microtubule networks.

Microtubule networks are employed in cells to accomplish a wide range of tasks, ranging from acting as tracks for vesicle transport to working as ...

Research

JoVE Journal

Biology

Induction and Monitoring of Active Delayed Type Hypersensitivity (DTH) in Rats

Induction and Monitoring of Active Delayed Type Hypersensitivity DTH in Rats

Delayed type hypersensitivity (DTH) is an inflammatory reaction mediated by CCR7- effector memory T lymphocytes that infiltrate the site of injection of ...

Microfabricated Post-Array-Detectors (mPADs): an Approach to Isolate Mechanical Forces

Microfabricated Post-Array-Detectors mPADs: an Approach to Isolate Mechanical Forces

In this video, we will present our approach to measure cellular traction forces using a microfabricated array of posts.  Traction forces are generated ...

Transplantation of Cells Directly into the Kidney of Adult Zebrafish

Regenerative medicine based on the transplantation of stem or progenitor cells into damaged tissues has the potential to treat a wide range of chronic ...

In vitro Reconstitution of the Active T. castaneum Telomerase

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Chromatographic Purification of Highly Active Yeast Ribosomes

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers.  ...

Production of Xenopus tropicalis Egg Extracts to Identify Microtubule-associated RNAs

Production of Xenopus tropicalis Egg Extracts to Identify Microtubule-associated RNAs

Many  organisms localize mRNAs to specific subcellular destinations to spatially and  temporally control gene expression. Recent studies have demonstrated ...

Robust 3D DNA FISH Using Directly Labeled Probes

3D DNA FISH has become a major tool for  analyzing three-dimensional organization of the nucleus, and several variations  of the technique have been ...

A Multi-hole Cryovial Eliminates Freezing Artifacts when Muscle Tissues are Directly Immersed in Liquid Nitrogen

Studies on skeletal muscle physiology face the technical challenge of appropriately processing the specimens to obtain sections with clearly visible ...

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

Emergent properties and external factors (population-level and ecosystem-level interactions, in particular) play important roles in mediating ...

Micron-scale Phenotyping Techniques of Maize Vascular Bundles Based on X-ray Microcomputed Tomography

It is necessary to accurately quantify the anatomical structures of maize materials based on high-throughput image analysis techniques. Here, we provide a ...