Name: directly measuring forces within reconstituted active microtubule bundles
Uploaded: 2022-05-10T15:00:00
Description: Watch this Scientific Journal Video about Directly Measuring Forces Within Reconstituted Active Microtubule Bundles at JoVE.com

The authors wish to acknowledge support from R21 AG067436 (to JP and SF), T32 AG057464 (to ET), and Rensselaer Polytechnic Institute School of Science Startup Funds (to SF).

1. Preparation of microtubules
NOTE: When employing GFP-labeled crosslinking proteins, red (e.g., rhodamine) and far-red (e.g., biotinylated HiLyte647, referred to as biotinylated far red in the rest of the text) organic fluorophore labeling of the microtubules works well. Minimal crosstalk between all three channels can be achieved during imaging by using a high-quality quad band total internal reflection fluorescence (TIRF) filter.
<ol>
	<li>Prepare GMPCPP microtubule seed...

Microtubule networks are employed by myriad cell types to accomplish a wide range of tasks that are fundamentally mechanical in nature. In order to describe how cells function in both healthy and disease states, it is critical to understand how these micron-scale networks are organized and regulated by the nanometer-sized proteins that collectively build them. Biophysical tools such as optical tweezers are well suited to probing the mechanochemistry of key proteins at this scale. Reflecting the diversity of microtubule n...

Cells employ microtubule networks to perform a wide variety of mechanical tasks, ranging from vesicle transport1,2,3 to chromosome segregation during mitosis4,5,6. Many of the proteins that interact with microtubules, such as the molecular motor proteins kinesin and dynein, generate forces and are regulated by mechanical loads. To better understand how these critical molecules function, researchers have employed single-molecule biophysical methods, such as optical trapping and TIRF microscopy, to directly monitor critical parameters such as unloaded stepping rates, processivity, and force-velocity relationships for individual proteins. The most commonly used experimental geometry has been to attach motor proteins directly to trapping beads whose spherical geometry and size mimic vesicles undergoing motor-driven transport. Numerous kinesins, including kinesin-17,8,9, kinesin-210,11,12, kinesin-313,14,15,16 kinesin-517,18, kinesin-819,20, as well as dynein and dynein complexes21,22,23,24,25, have been studied with these methods.
In many cellular processes, however, motor and non-motor proteins use microtubules both as track and cargo26,27. Moreover, in these scenarios where microtubule filaments are crosslinked into higher-order bundles, these proteins function as ensembles rather than single units. For example, within dividing somatic cells, dense filament networks self-organize to build the mitotic spindle apparatus28,29,30. The interpolar spindle microtubule network is highly dynamic and is largely arranged with minus-ends pointing toward the spindle poles and plus-ends overlapping near the spindle equator. Filaments within the spindle are crosslinked by motor proteins such as kinesin-531,32,33, kinesin-1234,35,36, and kinesin-1437,38,39, or by non-motor proteins such as PRC140,41,42,43 or NuMA44,45,46. They frequently move or experience mechanical stress during processes such as poleward flux or while coordinating chromosome centering during metaphase or chromosome segregation during anaphase47,48,49,50,51,52. The integrity of the micron-scale spindle apparatus through mitosis, therefore, relies on a carefully regulated balance of pushing and pulling forces generated and sustained by this network of interacting filaments. However, the tools needed to probe this mechanical regulation and explain how protein ensembles work in concert to coordinate microtubule motions and produce the forces needed to properly assemble the spindle have only recently been developed, and we are just beginning to understand the biophysical rules that define dynamic microtubule networks.
The goal of this manuscript is to demonstrate the steps required to reconstitute crosslinked microtubule pairs in vitro, immobilize these bundles in a microscopy chamber that allows for simultaneous fluorescence visualization of both the microtubules and crosslinking proteins and nanoscale force measurement, and process these data robustly. We detail the steps needed to stably polymerize fluorescence-labeled microtubules, prepare microscope coverslips for attachment, prepare polystyrene beads for optical trapping experiments, and assemble crosslinked filament networks that preserve their in vivo functionality while allowing for direct biophysical manipulation.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>10W Ytterbium Fiber Laser, 1064nm</td>
			<td>IPG Photonics</td>
			<td>YLR-10-1064-LP</td>
			<td></td>
		</tr>
		<tr>
			<td>405/488/561/640nm Laser Quad Band Set for TIRF applications</td>
			<td>Chroma</td>
			<td>TRF89901v2</td>
			<td></td>
		</tr>
		<tr>
			<td>6x His Tag Antibody, Biotin Conjugate</td>
			<td>Invitrogen</td>
			<td>#MA1-21315-BTIN</td>
			<td></td>
		</tr>
		<tr>
			<td>Acetone, HPLC grade</td>
			<td>Fisher Scientific</td>
			<td>18-608-395</td>
			<td></td>
		</tr>
		<tr>
			<td>Alpha casein from bovine milk</td>
			<td>Sigma</td>
			<td>1002484390</td>
			<td></td>
		</tr>
		<tr>
			<td>ATP</td>
			<td>Fisher Scientific</td>
			<td>BP413-25</td>
			<td></td>
		</tr>
		<tr>
			<td>Benzonase</td>
			<td>Novagen</td>
			<td>70746-3</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotin-PEG-SVA-5000</td>
			<td>Laysan Bio, Inc.</td>
			<td>NC0479433</td>
			<td></td>
		</tr>
		<tr>
			<td>BL21 (DE3) Rosetta Cells</td>
			<td>Millipore Sigma</td>
			<td>71-400-3</td>
			<td></td>
		</tr>
		<tr>
			<td>Catalase</td>
			<td>MP Biomedicals LLC</td>
			<td>190311</td>
			<td></td>
		</tr>
		<tr>
			<td>CFI Apo 100X/1.49NA oil immersion TIRF objective</td>
			<td>Nikon</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloramphenicol</td>
			<td>ACROS Organics</td>
			<td>227920250</td>
			<td></td>
		</tr>
		<tr>
			<td>Coverslip Mini-Rack, for 8 coverslips</td>
			<td>Fisher Scientific</td>
			<td>C14784</td>
			<td></td>
		</tr>
		<tr>
			<td>Delicate Task Wipers</td>
			<td>Kimberly-Clark</td>
			<td>34120</td>
			<td></td>
		</tr>
		<tr>
			<td>Dextrose Anhydrous</td>
			<td>Fisher Scientific</td>
			<td>BP3501</td>
			<td></td>
		</tr>
		<tr>
			<td>D-Sucrose</td>
			<td>Fisher Scientific</td>
			<td>BP220-1</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT</td>
			<td>Fisher Scientific</td>
			<td>BP172-25</td>
			<td></td>
		</tr>
		<tr>
			<td>Ecoline Immersion Thermostat E100 with 003 Bath</td>
			<td>LAUDA-Brinkmann</td>
			<td>27709</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Fisher Scientific</td>
			<td>BP118-500</td>
			<td></td>
		</tr>
		<tr>
			<td>EGTA</td>
			<td>Millipore Corporation</td>
			<td>32462-25GM</td>
			<td></td>
		</tr>
		<tr>
			<td>FIJI / Image J</td>
			<td>https://fiji.sc/</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Frosted Microscope Slides</td>
			<td>Corning</td>
			<td>12-553-10</td>
			<td>75mmx25mm, with thickness of 0.9-1.1mm</td>
		</tr>
		<tr>
			<td>Glucose Oxidase</td>
			<td>MP Biomedicals LLC</td>
			<td>195196</td>
			<td>Type VII, without added oxygen</td>
		</tr>
		<tr>
			<td>GMPCPP</td>
			<td>Jena Biosciences</td>
			<td>JBS-NU-405S</td>
			<td>Can be stored for several months at -20 &#176;C and up to a year at -80 &#176;C</td>
		</tr>
		<tr>
			<td>Gold Seal-Cover Glass</td>
			<td>Thermo Scientific</td>
			<td>3405</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Fisher Scientific</td>
			<td>BP310-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Imidazole</td>
			<td>Fisher Scientific</td>
			<td>03196-500</td>
			<td></td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Fisher Scientific</td>
			<td>BP1755-10</td>
			<td></td>
		</tr>
		<tr>
			<td>Laboratory dessicator</td>
			<td>Bel-Art</td>
			<td>999320237</td>
			<td>190mm plate size</td>
		</tr>
		<tr>
			<td>Kanamycin Sulfate</td>
			<td>Fischer Scientific</td>
			<td>BP906-5</td>
			<td></td>
		</tr>
		<tr>
			<td>KIF5A K439 (aa:1-439)-6His</td>
			<td>Gilbert Lab, RPI</td>
			<td>N/A</td>
			<td>doi.org/10.1074/jbc.RA118.002182</td>
		</tr>
		<tr>
			<td>Kimwipe</td>
			<td>Kimberley Clark</td>
			<td>Z188956</td>
			<td>lint-free tissue</td>
		</tr>
		<tr>
			<td>Immersion Oil, Type B</td>
			<td>Cargille</td>
			<td>16484</td>
			<td></td>
		</tr>
		<tr>
			<td>Lens Tissue</td>
			<td>ThorLabs</td>
			<td>MC-5</td>
			<td></td>
		</tr>
		<tr>
			<td>LuNA Laser launch (4 channel: 405, 488, 561, 640nm)</td>
			<td>Nikon</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Lysozyme</td>
			<td>MP Biomedicals LLC</td>
			<td>100834</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium Acetate Tetrahydrate</td>
			<td>Fisher Scientific</td>
			<td>BP215-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Microfuge 18</td>
			<td>Beckman Coulter</td>
			<td>367160</td>
			<td></td>
		</tr>
		<tr>
			<td>MPEG-SVA MW-5000</td>
			<td>Laysan Bio, Inc.</td>
			<td>NC0107576</td>
			<td></td>
		</tr>
		<tr>
			<td>Neutravadin</td>
			<td>Invitrogen</td>
			<td>PI31000</td>
			<td></td>
		</tr>
		<tr>
			<td>Nikon Ti-E inverted microscope</td>
			<td>Nikon</td>
			<td>N/A</td>
			<td>Nikon LuN4 Laser</td>
		</tr>
		<tr>
			<td>Ni-NTA Resin</td>
			<td>Thermo Scientific</td>
			<td>88221</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide - CACCTATTCTGAGTTTGCGCGA 
			GAACTTTCAAAGGC</td>
			<td>IDT</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide - GCCTTTGAAAGTTCTCGCGCAA 
			ACTCAGAATAGGTG</td>
			<td>IDT</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Open-top thickwall polycarbonate tube, 0.2 mL, 7 mm x 22 mm</td>
			<td>Beckman Coulter</td>
			<td>343755</td>
			<td></td>
		</tr>
		<tr>
			<td>Optima-TLX Ultracentrifuge</td>
			<td>Beckman Coulter</td>
			<td>361544</td>
			<td></td>
		</tr>
		<tr>
			<td>Paclitaxel (Taxol equivalent)</td>
			<td>Thermo Fisher Scientific</td>
			<td>P3456</td>
			<td></td>
		</tr>
		<tr>
			<td>PIPES</td>
			<td>ACROS Organics</td>
			<td>172615000</td>
			<td></td>
		</tr>
		<tr>
			<td>PMSF</td>
			<td>Millipore</td>
			<td>7110-5GM</td>
			<td></td>
		</tr>
		<tr>
			<td>Porcine Tubulin, biotin label</td>
			<td>Cytoskeleton, Inc.</td>
			<td>T333P</td>
			<td></td>
		</tr>
		<tr>
			<td>Porcine Tubulin, HiLyte 647 Fluor</td>
			<td>Cytoskeleton, Inc.</td>
			<td>TL670M</td>
			<td>far red labelled</td>
		</tr>
		<tr>
			<td>Porcine Tubulin, Rhodamine</td>
			<td>Cytoskeleton, Inc.</td>
			<td>TL590M</td>
			<td></td>
		</tr>
		<tr>
			<td>Porcine Tubulin, Tubulin Protein</td>
			<td>Cytoskeleton, Inc.</td>
			<td>T240</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium Acetate</td>
			<td>Fisher Scientific</td>
			<td>BP364-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Prime 95B sCMOS camera</td>
			<td>Photometric</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Quadrant Detector Sensor Head</td>
			<td>ThorLabs</td>
			<td>PDQ80A</td>
			<td></td>
		</tr>
		<tr>
			<td>Quikchange Lightning Kit</td>
			<td>Agilent Technologies</td>
			<td>210518</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Bicarbonate</td>
			<td>Fisher Scientific</td>
			<td>S233-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Phosphate Dibasic Anhydrous</td>
			<td>Fisher Scientific</td>
			<td>BP332-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Square Cover Glasses</td>
			<td>Corning</td>
			<td>12-553-450</td>
			<td>18 mm x 18 mm, with thickness of 0.13-0.17 mm</td>
		</tr>
		<tr>
			<td>Streptavidin Microspheres</td>
			<td>Polysciences Inc.</td>
			<td>24162-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose-6 Column</td>
			<td>GE Healthcare</td>
			<td>29-0915--96</td>
			<td></td>
		</tr>
		<tr>
			<td>TCEP</td>
			<td>Thermo Scientific</td>
			<td>77720</td>
			<td></td>
		</tr>
		<tr>
			<td>TLA-100 Fixed-Angle Rotor</td>
			<td>Beckman Coulter</td>
			<td>343840</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultrasonic Cleaner (Sonicator)</td>
			<td>Vevor</td>
			<td>JPS-08A(DD)</td>
			<td>304 stainless steel, 40 kHz frequency, 60 W power</td>
		</tr>
		<tr>
			<td>Vectabond APTES solution</td>
			<td>Vector Laboratories</td>
			<td>SP-1800-7</td>
			<td></td>
		</tr>
		<tr>
			<td>Windex Powerized Glass Cleaner with Ammonia-D</td>
			<td>S.C. Johnson</td>
			<td>SJN695237</td>
			<td></td>
		</tr>
	</tbody>
</table>

directly measuring forces within reconstituted active microtubule bundles

Microtubule networks are employed in cells to accomplish a wide range of tasks, ranging from acting as tracks for vesicle transport to working as specialized arrays during mitosis to regulate chromosome segregation. Proteins that interact with microtubules include motors such as kinesins and dynein, which can generate active forces and directional motion, as well as non-motor proteins that crosslink filaments into higher-order networks or regulate filament dynamics. To date, biophysical studies of microtubule-associated proteins have overwhelmingly focused on the role of single motor proteins needed for vesicle transport, and significant progress has been made in elucidating the force-generating properties and mechanochemical regulation of kinesins and dyneins. However, for processes in which microtubules act both as cargo and track, such as during filament sliding within the mitotic spindle, much less is understood about the biophysical regulation of ensembles of the crosslinking proteins involved. Here, we detail our methodology for directly probing force generation and response within crosslinked microtubule minimal networks reconstituted from purified microtubules and mitotic proteins. Microtubule pairs are crosslinked by proteins of interest, one microtubule is immobilized to a microscope coverslip, and the second microtubule is manipulated by an optical trap. Simultaneous total internal reflection fluorescence microscopy allows for multichannel visualization of all the components of this microtubule network as the filaments slide apart to generate force. We also demonstrate how these techniques can be used to probe pushing forces exerted by kinesin-5 ensembles and how viscous braking forces arise between sliding microtubule pairs crosslinked by the mitotic MAP PRC1. These assays provide insights into the mechanisms of spindle assembly and function and can be more broadly adapted to study dense microtubule network mechanics in diverse contexts, such as the axon and dendrites of neurons and polar epithelial cells.

The preparation of microtubule bundles suitable for biophysical analysis is considered successful if several of the key criteria are met. First, imaging in three colors should reveal two aligned microtubules with a concentration of crosslinking protein preferentially decorating the overlap region (Figure 5B,C and Figure 6B). Ideally, the distance between the overlap edge and the free end of the rhodamine microtubule should be at...

Watch this Scientific Journal Video about Directly Measuring Forces Within Reconstituted Active Microtubule Bundles at JoVE.com

Directly Measuring Forces Within Reconstituted Active Microtubule Bundles

Here, we present a protocol for reconstituting microtubule bundles in vitro and directly quantifying the forces exerted within them using simultaneous optical trapping and total internal reflection fluorescence microscopy. This assay allows for nanoscale-level measurement of the forces and displacements generated by protein ensembles within active microtubule networks.

Microtubule networks are employed in cells to accomplish a wide range of tasks, ranging from acting as tracks for vesicle transport to working as ...

Our protocol allows researchers to build cytoskeletal motifs out of purified components and directly measure the forces these networks generate in order to understand how these mechanical components of the cell function in both healthy and disease states. This method allows us to quantify forces and correlate these numbers directly to keep parameters of the proteins involved, including protein concentration and density. Parameters that are generally impossible to acquire within the cell.This method can provide insights into any type of cytoskeleton network, such as those involved in mitosis or neural development. It can readily be adapted to study networks involved in muscle contraction or cell migration by simply swapping out this specific proteins being used. The trickiest aspect of this method is the coordination of the different technologies, which include a single-beam optical trap, and a TIRF microscope.Additionally, single-molecule experiments require careful preparation of surfaces, such as the cover slip, so preparing high-quality samples is paramount. Start with constructing a humidity chamber by placing a folded-up, lint-free tissue dampened with ultrapure water at the bottom of an empty pipette tip box. Introduce all the reagents by pipetting the liquid at one end of the channel and wicking the liquid out at the opposite end.Using a 20-microliter-angled pipette tip, slowly flow in 10 microliters of 0.5 milligrams per milliliter streptavidin or NeutrAvidin. Incubate the slide in the humidity chamber for 4 minutes with the cover slip facing down. Flush out the chamber using 20 microliters of a 1x BRB80 using a lint-free tissue to draw out liquids.After repeating flowing reagents and incubation one more time, flush step with 10 microliters of 0.5 milligrams per milliliter casein blocking solution. Flow 10 microliters of diluted biotinylated-far-red microtubules into the chamber, then flush the chamber with 20 microliters of 1x BRB80. After flowing the reagent and incubating as demonstrated previously, flush the step with 10 microliters of an appropriate concentration of non-motor protein to be studied, then flow in 10 microliters of rhodamine microtubules and repeat the incubation and flushing.Next, combine 1 microliter of rigor kinesin-coated beads and 19 microliters of reaction buffer. Seal both edges of the chamber with clear nail polish and wait until the polish dries. Employ an inverted microscope instrument that has total internal reflection fluorescence imaging capabilities, and into which a single-beam optical trap has been constructed.Add 1 drop of immersion oil onto the cover slip of the sample chamber. With the cover slip side of the sample chamber facing downward, place the sample to be imaged on the microscope platform. Slowly bring the objective up so that there is contact between both the cover slip and the objective through the oil.Adjust the objective height so that the cover slip surface of the sample chamber is in focus. Record single-frame images of the samples in all three channels. For the experiments here, use 100 to 200 milliseconds of exposure.Adjust the laser power to achieve a good signal-to-noise ratio from the samples while minimizing photo bleaching over 2 to 5 minutes when the individual bundle is assayed. The frequency of microtubule bundles per field of view should be approximately three to four microtubule bundles per 100 microliters by 100 microliters field of view per chamber. Observe the density of beads in the sample using a bright field and the 100x objective on the microscope.Employ a concentration of beads such that the beads are a minimum of 10 micrometers from one another on average, and ensure that they are free from any kind of surface confinement or clustering. Ensure that the biotinylated far-red microtubules are firmly attached to the surface of the cover slip and that the rhodamine with no visible Brownian motion. Ensure that the rhodamine microtubules are attached to biotinylated microtubules via the cross-linking map and are visibly fluctuating at their free ends.Identify a suitable microtubule bundle that contains only two microtubules, one biotinylated with full surface attachment and one non-biotinylated microtubule that is partly free in solution and is aligned on either the x or y-axis. Use the optical trap to capture a free bead demonstrating Brownian motion. Once the bead has been trapped, carefully move the bead over to the selected microtubule bundle ensuring no other beads are pulled into the trap in the process.Ensure that the bead is several microns away from the overlap region containing cross-linking proteins. Carefully lower the bead in the z-axis until it makes contact with the edge of the free segment of the rhodamine microtubule. Pull up gently and move perpendicular to the microtubule axis to check for attachment by observing the rhodamine microtubule bending and following the bead position.Carefully realign the rhodamine microtubule along the microtubule axis of the surface-attached microtubule by moving the nano-positioning stage and set up the parameters for automated pulling of the microtubule bundle. Set the direction along the parallel axis of the microtubules. Set the desired pull speed and desired pull time depending on overlap length.Begin recording fluorescence data in the three channels at a rate of 1 to 2 frames per second. Use the optimized the laser powers and exposure times. Initiate automated stage motion and record trapping data from the position-sensitive detector stage and total internal reflection fluorescence camera stage.Deactivate the traps to release the bead and repeat the experiment as desired. Ensembles of the essential mitotic motor protein kinesin-5 can regulate microtubule sliding by generating both pushing and braking forces that scale linearly with overlap length. It was found that the C-terminal tail domain is required for efficient cross-linking and force generation.The full-length protein is able to generate sustained forces that plateau when all motor proteins reach their individual stall force. However, the kinesin-5 motor lacking its C-terminal tail generates maximum forces that are nearly fivefold smaller in magnitude. Ensembles of the non-motor mitotic protein PRC1 operate as a mechanical dash pod to resist microtubule sliding in anaphase spindle mid-zone.The resistive forces do not depend on the length of overlap regions between microtubule pairs or the local crosslinker density, but they do strongly depend on the total concentration of engaged PRC1 molecules. This method can be adapted to study diverse biological systems such as microbial organization and neurons by using alternate proteins. It can also readily be expanded to analyze actin-based network geometries to study muscle contraction or cell motility.This technique lets one study unique cell total geometries, where filaments are both track and cargo and are organized by small ensembles of proteins. These geometries better mimic what's happening in cells during numerous biological processes.

directly-measuring-forces-within-reconstituted-active-microtubule

Research

JoVE Journal

Biology

Single Cell Electroporation in vivo within the Intact Developing Brain

Single-cell electroporation (SCE) is a specialized technique allowing the delivery of DNA or other macromolecules into individual cells within intact tissue, including in vivo preparations. The distinct advantage of this technique is that experimental manipulations may be performed on individual cells while leaving the surrounding tissue unaltered, thereby distinguishing cell-autonomous effects from those resulting from global treatments. When combined with advanced in vivo imaging techniques, SCE of fluorescent markers permits direct visualization of cellular morphology, cell growth, and intracellular events over timescales ranging from seconds to days. While this technique is used in a variety of in vivo and ex vivo preparations, we have optimized this technique for use in Xenopus laevis tadpoles. In this video article, we detail the procedure for SCE of a fluorescent dye or plasmid DNA into neurons within the intact brain of the albino Xenopus tadpole. We also discuss methods to optimize yield, and show examples of live two-photon fluorescence imaging of neurons fluorescently labeled by SCE.

Single-cell electroporation (SCE) is a specialized technique allowing delivery of DNA or other macromolecules into individual cells within intact tissue, including in vivo preparations. Here we detail the procedure for SCE of a fluorescent dye or plasmid DNA into neurons within the intact brain of the Xenopus laevis tadpole.

Single-cell electroporation (SCE) is a specialized technique allowing the delivery of DNA or other macromolecules into individual cells within intact ...

Transplantation of Cells Directly into the Kidney of Adult Zebrafish

Regenerative medicine based on the transplantation of stem or progenitor cells into damaged tissues has the potential to treat a wide range of chronic diseases1. However, most organs are not easily accessible, necessitating the need to develop surgical methods to gain access to these structures. In this video article, we describe a method for transplanting cells directly into the kidney of adult zebrafish, a popular model to study regeneration and disease2. Recipient fish are pre-conditioned by irradiation to suppress the immune rejection of the injected cells3. We demonstrate how the head kidney can be exposed by a lateral incision in the flank of the fish, followed by the injection of cells directly in to the organ. Using fluorescently labeled whole kidney marrow cells comprising a mixed population of renal and hematopoietic precursors, we show that nephron progenitors can engraft and differentiate into new renal tissue - the gold standard of any cell-based regenerative therapy. This technique can be adapted to deliver purified stem or progenitor cells and/or small molecules to the kidney as well as other internal organs and further enhances the zebrafish as a versatile model to study regenerative medicine.

Cell transplantation is an essential technique for studying tissue regeneration and for developing cell-based therapies of disease. We demonstrate here a microsurgical technique that permits the transplantation of genetically labeled cells directly into the kidney of adult zebrafish fish.

Regenerative medicine based on the transplantation of stem or progenitor cells into damaged tissues has the potential to treat a wide range of chronic ...

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.
Telomerase is a specialized reverse transcriptase1 that adds short DNA repeats, called telomeres, to the 3' end of linear chromosomes2 that serve to protect them from end-to-end fusion and degradation. Following DNA replication, a short segment is lost at the end of the chromosome3 and without telomerase, cells continue dividing until eventually reaching their Hayflick Limit4. Additionally, telomerase is dormant in most somatic cells5 in adults, but is active in cancer cells6 where it promotes cell immortality7.
The minimal telomerase enzyme consists of two core components: the protein subunit (TERT), which comprises the catalytic subunit of the enzyme and an integral RNA component (TER), which contains the template TERT uses to synthesize telomeres8,9. Prior to 2008, only structures for individual telomerase domains had been solved10,11. A major breakthrough in this field came from the determination of the crystal structure of the active12, catalytic subunit of T. castaneum telomerase, TcTERT1.
Here, we present methods for producing large quantities of the active, soluble TcTERT for structural and biochemical studies, and the reconstitution of the telomerase RNP complex in vitro for telomerase activity assays. An overview of the experimental methods used is shown in Figure 1.

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Chromatographic Purification of Highly Active Yeast Ribosomes

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes.

Contamination of preparations of eukaryotic ribosomes purified by traditional methods by co-purifying nucleases and proteases negatively impacts on downstream biochemical and structural analyses. A rapid and simple chromatographic purification method is used to solve this problem using yeast ribosomes as a model system.

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers.  ...

Production of Xenopus tropicalis Egg Extracts to Identify Microtubule-associated RNAs

Many organisms localize mRNAs to specific subcellular destinations to spatially and temporally control gene expression. Recent studies have demonstrated that the majority of the transcriptome is localized to a nonrandom position in cells and embryos. One approach to identify localized mRNAs is to biochemically purify a cellular structure of interest and to identify all associated transcripts. Using recently developed high-throughput sequencing technologies it is now straightforward to identify all RNAs associated with a subcellular structure. To facilitate transcript identification it is necessary to work with an organism with a fully sequenced genome. One attractive system for the biochemical purification of subcellular structures are egg extracts produced from the frog Xenopus laevis. However, X. laevis currently does not have a fully sequenced genome, which hampers transcript identification. In this article we describe a method to produce egg extracts from a related frog, X. tropicalis, that has a fully sequenced genome. We provide details for microtubule polymerization, purification and transcript isolation. While this article describes a specific method for identification of microtubule-associated transcripts, we believe that it will be easily applied to other subcellular structures and will provide a powerful method for identification of localized RNAs.

Production of Xenopus tropicalis Egg Extracts to Identify Microtubule-associated RNAs

We describe the collection of unfertilized Xenopus tropicalis eggs and production of a meiosis II-arrested egg extract. This egg extract can be used to purify microtubules and microtubule-associated RNAs.

Many  organisms localize mRNAs to specific subcellular destinations to spatially and  temporally control gene expression. Recent studies have demonstrated ...

Robust 3D DNA FISH Using Directly Labeled Probes

3D DNA FISH has become a major tool for analyzing three-dimensional organization of the nucleus, and several variations of the technique have been published. In this article we describe a protocol which has been optimized for robustness, reproducibility, and ease of use. Brightly fluorescent directly labeled probes are generated by nick-translation with amino-allyldUTP followed by chemical coupling of the dye. 3D DNA FISH is performed using a freeze-thaw step for cell permeabilization and a heating step for simultaneous denaturation of probe and nuclear DNA. The protocol is applicable to a range of cell types and a variety of probes (BACs, plasmids, fosmids, or Whole Chromosome Paints) and allows for high-throughput automated imaging. With this method we routinely investigate nuclear localization of up to three chromosomal regions.

We describe a robust and versatile protocol for analyzing nuclear architecture by 3D DNA FISH using directly labeled fluorescent probes.

3D DNA FISH has become a major tool for  analyzing three-dimensional organization of the nucleus, and several variations  of the technique have been ...

Using plusTipTracker Software to Measure Microtubule Dynamics in Xenopus laevis Growth Cones

Microtubule (MT) plus-end-tracking proteins (+TIPs) localize to the growing plus-ends of MTs and regulate MT dynamics1,2. One of the most well-known and widely-utilized +TIPs for analyzing MT dynamics is the End-Binding protein, EB1, which binds all growing MT plus-ends, and thus, is a marker for MT polymerization1. Many studies of EB1 behavior within growth cones have used time-consuming and biased computer-assisted, hand-tracking methods to analyze individual MTs1-3. Our approach is to quantify global parameters of MT dynamics using the software package, plusTipTracker4, following the acquisition of high-resolution, live images of tagged EB1 in cultured embryonic growth cones5. This software is a MATLAB-based, open-source, user-friendly package that combines automated detection, tracking, visualization, and analysis for movies of fluorescently-labeled +TIPs. Here, we present the protocol for using plusTipTracker for the analysis of fluorescently-labeled +TIP comets in cultured Xenopus laevis growth cones. However, this software can also be used to characterize MT dynamics in various cell types6-8.

Using plusTipTracker Software to Measure Microtubule Dynamics in Xenopus laevis Growth Cones

The MATLAB-based, open source software package, plusTipTracker, can be used to analyze image series of fluorescently-labeled +TIPs to quantify microtubule dynamics.

Microtubule (MT) plus-end-tracking proteins (+TIPs) localize to the growing plus-ends of MTs and regulate MT dynamics1,2. One of the most well-known and ...

A Multi-hole Cryovial Eliminates Freezing Artifacts when Muscle Tissues are Directly Immersed in Liquid Nitrogen

Studies on skeletal muscle physiology face the technical challenge of appropriately processing the specimens to obtain sections with clearly visible cytoplasmic compartments. Another hurdle is the tight apposition of myofibers to the surrounding tissues. Because the process of tissue fixation and paraffin embedding leads to the shrinkage of muscle fibers, freezing is an optimal means of hardening muscle tissue for sectioning. However, a commonly encountered issue, the formation of ice crystals, occurs during the preparation of frozen sections because of the high water content of muscle. The protocol presented here first describes a simple and efficient method for properly freezing muscle tissues by immersing them in liquid nitrogen. The problem with using liquid nitrogen alone is that it causes the formation of a nitrogen gas barrier next to the tissue, which acts as an insulator and inhibits the cooling of the tissues. To avoid this "vapor blanket" effect, a new cryovial was designed to increase the speed of liquid flow around the tissue surface. This was achieved by punching a total of 14 inlet holes in the wall of the vial. According to bubble dynamics, a higher rate of liquid flow results in smaller bubbles and fewer chances to form a gas barrier. When liquid nitrogen flows into the cryovial through the inlet holes, the flow velocity around the tissue is fast enough to eliminate the gas barrier. Compared to the method of freezing muscle tissues using pre-chilled isopentane, this protocol is simpler and more efficient and can be used to freeze muscle in a throughput manner. Furthermore, this method is optimal for institutions that do not have access to isopentane, which is extremely flammable at room temperature.

This protocol describes a procedure to freeze muscle tissues by plunging them directly into liquid nitrogen. This protocol also highlights a new cryovial that can avoid the &#34;blanket effect&#34; of nitrogen gas when liquid nitrogen contacts the tissue surface of a specimen.

Studies on skeletal muscle physiology face the technical challenge of appropriately processing the specimens to obtain sections with clearly visible ...

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

Emergent properties and external factors (population-level and ecosystem-level interactions, in particular) play important roles in mediating ecologically-important endpoints, though they are rarely considered in toxicological studies. D. melanogaster is emerging as a toxicology model for the behavioral, neurological, and genetic impacts of toxicants, to name a few. More importantly, species in the genus Drosophila can be utilized as a model system for an integrative framework approach to incorporate emergent properties and answer ecologically-relevant questions in&#160;toxicology research. The aim of this paper is to provide a protocol for exposing species in the genus Drosophila to pollutants to be used as a model system for a range of phenotypic outputs and ecologically-relevant questions. More specifically, this protocol can be used to 1) link multiple biological levels of organization and understand the impact of toxicants on both individual- and population-level fitness; 2) test the impact of toxicants at different stages of developmental exposure; 3) test multigenerational and evolutionary implications of pollutants; and 4) test multiple contaminants and stressors simultaneously.

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

In this paper, we provide a detailed protocol for exposing species in the genus Drosophila to pollutants with the goal of studying the impact of exposure on a range of phenotypic outputs at different developmental stages and for more than one generation.

Emergent properties and external factors (population-level and ecosystem-level interactions, in particular) play important roles in mediating ...

Micron-scale Phenotyping Techniques of Maize Vascular Bundles Based on X-ray Microcomputed Tomography

It is necessary to accurately quantify the anatomical structures of maize materials based on high-throughput image analysis techniques. Here, we provide a 'sample preparation protocol' for maize materials (i.e., stem, leaf, and root) suitable for ordinary microcomputed tomography (micro-CT) scanning. Based on high-resolution CT images of maize stem, leaf, and root, we describe two protocols for the phenotypic analysis of vascular bundles: (1) based on the CT image of maize stem and leaf, we developed a specific image analysis pipeline to automatically extract 31 and 33 phenotypic traits of vascular bundles; (2) based on the CT image series of maize root, we set up an image processing scheme for the three-dimensional (3-D) segmentation of metaxylem vessels, and extracted two-dimensional (2-D) and 3-D phenotypic traits, such as volume, surface area of metaxylem vessels, etc. Compared with traditional manual measurement of vascular bundles of maize materials, the proposed protocols significantly improve the efficiency and accuracy of micron-scale phenotypic quantification.

We provide a novel method to improve the X-ray absorption contrast of maize tissue suitable for ordinary microcomputed tomography scanning. Based on CT images, we introduce a set of image-processing workflows for different maize materials to effectively extract microscopic phenotypes of vascular bundles of maize.

It is necessary to accurately quantify the anatomical structures of maize materials based on high-throughput image analysis techniques. Here, we provide a ...