This research was supported by the Research and Development Funding from Aptagen LLC.

NOTE: Figure 2 shows the main steps of the ITC experiment for determining the thermodynamic and kinetic association of a DNA aptamer and tetracycline.
1. Preparation of samples
NOTE: Samples for ITC need to be prepared in the same buffer for both the aptamer and ligand to avoid heat release caused by mixing different buffers from the sample cell and syringe. This is typically achieved through dialysis of all materials into the same buffer. The buffer is exchanged using a protocol adapted from the protocol of a 3 kDa molecular weight cutoff (MWC) concentrator with some modifications, as below:
<ol>
	<li>Activate the membrane of the dialysis column (3 kDa MWC) with 1x PBS, pH 7.4, purchased from the manufacturer, using the following steps: fill with 1x buffer (PBS), equilibrate for 10 min at RT, and centrifuge at 5,000 x g for 15 min.</li>
	<li>Remove the buffer and load 500 &#181;L of aptamer samples into the column, centrifuge at 5,000 x g, and repeat it 4x to exchange the original buffer for 1x PBS. When the buffer goes through the membrane, all molecules with a mass less than 3 kDa will go through the membrane, and the aptamer will remain on the upper side of the membrane.</li>
	<li>Collect the dialyzed DNA aptamer using a pipet and transfer it to the new 1.5 mL tube(s).</li>
	<li>Collect the last flowthrough buffer to dissolve tetracycline. Tetracycline powder is pure and small, so dialysis is not needed. However, use the previous dialyzed buffer for DNA for the target to ensure that the buffer for the experiment in the syringe matches the buffer in the reference cell.</li>
	<li>Determine the aptamer concentration again using a UV-visible spectrometer. Use the last exchange buffer to adjust the concentration to 40 &#181;M tetracycline and 2 &#181;M aptamer.</li>
	<li>Fold the DNA aptamer by heating at 90 &#176;C for 10 min, cooling at 4 &#176;C for 10 min, and then returning to RT for 20 min.</li>
	<li>Degas the folded aptamer and dialyzed tetracycline using a degassing station or vacuum pump set to 600 mmHg at 25 &#176;C for 25 min to eliminate dissolved gases.</li>
</ol>
2. Washing the instrument and running the test kit
<ol>
	<li>Clean the solvent ports to ensure the entire sample path is clear. Clean by discarding the waste solution and loading them with pure methanol, water, and buffer. Each port contains more than 250 mL to ensure enough solution for cleaning. 
	NOTE: The cleaning process is automatically completed by user-programmable ITC control software.</li>
	<li>Test the cleanliness of the machine by running ITC using buffer into a buffer (i.e., 1x PBS into 1x PBS). 
	NOTE: A normal noise baseline is visible between the tiny buffer into buffer injection peaks. When the titration syringe and cannulas are adequately cleaned and completely dry, the baseline will be stable; an increase or decrease in the baseline reflects dirty instrumentation or bubbles inside the instrument, which need to be corrected before running actual samples.</li>
	<li>Test the accuracy of the machine with a standard kit that includes EDTA and CaCl2 (Figure 3), using the default program and following the instructions from the manufacturer.</li>
</ol>
3. Running the sample to determine the binding between aptamer and tetracycline
<ol>
	<li>Set up the running parameters: a stirring rate of 200 rpm, running at 25 &#176;C, 2 &#181;M aptamer and 40 &#181;M tetracycline, 30 injections with 2.0 &#181;L each, a delaying time of 180 s.</li>
	<li>Check the required volumes using a running program calculator. With this running parameter, perform ITC measurement with 230 &#181;L of 40 &#181;M tetracycline in the ITC syringe and 485 &#181;L of 2 &#181;M aptamer in the ITC sample cell using the ITC.</li>
	<li>Load the dialyzed tetracycline syringe plates and the folded aptamer into the sample cell, avoiding bubbles, using a pipette.</li>
	<li>Start running the ITC instrument by clicking on the start button on the software. 
	&#8203;NOTE: The ITC instrument running process is fully automated after manually filling the reference cell and titrant sample plates.</li>
</ol>
4. Analyzing data using software
<ol>
	<li>Open the data analysis software by double clicking to start analyzing the data.</li>
	<li>Open the path of the saved raw data to know the tendency of binding.</li>
	<li>Open the modeling tab and use different binding models to find the best fit for the data curve. Then, the software automatically calculates the ITC thermogram and various thermodynamic parameters, including enthalpy (&#916;H), entropy (&#916;S), free energy (&#916;G), equilibrium binding constant (Ka), and stoichiometry.</li>
	<li>Collect the thermodynamic parameters determined from the data and fitting model information.</li>
	<li>Create a report, including pictures of the ITC thermogram and various thermodynamic parameters, as shown in Figure 4 and Table 1.</li>
</ol>

<ol>
	<li>Ellington, A. D., Szostak, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+selection+of+RNA+molecules+that+bind+specific+ligands.">In vitro selection of RNA molecules that bind specific ligands.</a> Nature. 346 (6287), 818-822 (1990).</li><li>Tuerk, C., Gold, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+evolution+of+ligands+by+exponential+enrichment:+RNA+ligands+to+bacteriophage+T4+DNA+polymerase.">Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase.</a> Science. 249 (4968), 505-510 (1990).</li><li>Kim, S. H., Thoa, T. T. T., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptasensors+for+environmental+monitoring+of+contaminants+in+water+and+soil.">Aptasensors for environmental monitoring of contaminants in water and soil.</a> Current Opinion in Environmental Science &amp; Health. 10, 9-21 (2019).</li><li>Dunn, M. R., Jimenez, R. M., Chaput, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+aptamer+discovery+and+technology.">Analysis of aptamer discovery and technology.</a> Nature Reviews Chemistry. 1, 0076 (2017).</li><li>Stoltenburg, R., Reinemann, C., Strehlitz, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SELEX--A+(r)evolutionary+method+to+generate+high-affinity+nucleic+acid+ligands.">SELEX--A (r)evolutionary method to generate high-affinity nucleic acid ligands.</a> Biomolecular Engineering. 24 (4), 381-403 (2007).</li><li>Wang, Y., Wang, G., Moitessier, N., Mittermaier, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzyme+kinetics+by+isothermal+titration+calorimetry:+Allostery,+inhibition,+and+dynamics.">Enzyme kinetics by isothermal titration calorimetry: Allostery, inhibition, and dynamics.</a> Frontiers in Molecular Biosciences. 7, 583826 (2020).</li><li>Velazquez-Campoy, A., Freire, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isothermal+titration+calorimetry+to+determine+association+constants+for+high-affinity+ligands.">Isothermal titration calorimetry to determine association constants for high-affinity ligands.</a> Nature Protocols. 1 (1), 186-191 (2006).</li><li>Niazi, J. H., Lee, S. J., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-stranded+DNA+aptamers+specific+for+antibiotics+tetracyclines.">Single-stranded DNA aptamers specific for antibiotics tetracyclines.</a> Bioorganic and Medicinal Chemistry. 16 (15), 7245-7253 (2008).</li><li>Kim, Y. J., Kim, Y. S., Niazi, J. H., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrochemical+aptasensor+for+tetracycline+detection.">Electrochemical aptasensor for tetracycline detection.</a> Bioprocess and Biosystems Engineering. 33 (1), 31-37 (2010).</li><li>Wang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+an+indirect+competitive+assay-based+aptasensor+for+highly+sensitive+detection+of+tetracycline+residue+in+honey.">Development of an indirect competitive assay-based aptasensor for highly sensitive detection of tetracycline residue in honey.</a> Biosensors &amp; Bioelectronics. 57, 192-198 (2014).</li><li>Kim, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+colorimetric+aptasensor+using+gold+nanoparticle+for+a+highly+sensitive+and+specific+detection+of+oxytetracycline.">A novel colorimetric aptasensor using gold nanoparticle for a highly sensitive and specific detection of oxytetracycline.</a> Biosensors &amp; Bioelectronics. 26 (4), 1644-1649 (2010).</li><li>Thoa, T. T., Minagawa, N., Aigaki, T., Ito, Y., Uzawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+photosensitisation+processes+by+an+RNA+aptamer.">Regulation of photosensitisation processes by an RNA aptamer.</a> Scientific Reports. 7, 43272 (2017).</li><li>Horowitz, E. D., Lilavivat, S., Holladay, B. W., Germann, M. W., Hud, N. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+structure+and+thermodynamics+of+2',5'+RNA+intercalation.">Solution structure and thermodynamics of 2',5' RNA intercalation.</a> Journal of the American Chemical Society. 131 (16), 5831-5838 (2009).</li><li>Sigurskjold, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exact+analysis+of+competition+ligand+binding+by+displacement+isothermal+titration+calorimetry.">Exact analysis of competition ligand binding by displacement isothermal titration calorimetry.</a> Analytical Biochemistry. 277 (2), 260-266 (2000).</li><li>Neves, M. A. D., Slavkovic, S., Churcher, Z. R., Johnson, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salt-mediated+two-site+ligand+binding+by+the+cocaine-binding+aptamer.">Salt-mediated two-site ligand binding by the cocaine-binding aptamer.</a> Nucleic Acids Research. 45 (3), 1041-1048 (2017).</li><li>Turnbull, W. B., Daranas, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+value+of+c:+Can+low+affinity+systems+be+studied+by+isothermal+titration+calorimetry.">On the value of c: Can low affinity systems be studied by isothermal titration calorimetry.</a> Journal of the American Chemical Society. 125 (48), 14859-14866 (2003).</li><li>Van Ness, J., Van Ness, L. K., Galas, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isothermal+reactions+for+the+amplification+of+oligonucleotides.">Isothermal reactions for the amplification of oligonucleotides.</a> Proceedings of the National Academy of Sciences of the United States of America. 100 (8), 4504-4509 (2003).</li></ol>

The authors declare no competing financial interests.

The method presented here was modified according to instruction from TA Instruments and is sufficient to determine the binding affinity and thermodynamics of many selected aptamers and targets at our center. Crucial steps from this procedure include exchanging the buffer to have a target matching the ligand, running samples with proper parameters, and finding the appropriate binding fitting model to analyze the data. Continuous recording of heat release requires eliminating all noise heat, such as from mismatch of the bu...

Aptamers are ssDNA or RNA fragments selected through an evolution process with high binding affinity and specificity to the desired targets1,2, which can work as advanced recognition elements or chemical antibodies3,4,5. Thus, the binding affinity and specificity of aptamers to their targets play a crucial role in the selection and application of an aptamer, and Isothermal Titration Calorimetry (ITC) has been widely used for these characterization purposes. Many approaches have been used to determine the affinity of aptamers, including ITC, surface plasmon resonance (SPR), colorimetric titration, microscale thermophoresis (MST), and Bio-Layer Interferometry (BLI). Among them, ITC is one of the latest techniques to determine the thermodynamic and kinetic association of two molecules in the solution phase. This approach conducts continuous titration using label-free molecules and records released heat over time upon the binding events produced by each titration6,7. Unlike other methods, ITC can offer binding affinity, several binding sites, and thermodynamic and kinetic association&#160;(Figure 1A). From these initial parameters, the Gibbs free energy changes and entropy changes are determined using the following relationship:
&#916;G = &#916;H-T&#916;S
That means that ITC offers a complete thermodynamic profile of the molecular interaction to elucidate the binding mechanisms (Figure 1B). Determining the binding affinity for small molecules with an aptamer is difficult due to the drastically different sizes between aptamer and target. Meanwhile, ITC can provide sensitive measurement without labeling and immobilizing molecules, which provides a means of keeping the natural structure of the aptamer and target during measurement. With the mentioned attributes, ITC can be used as the standard method for the characterization of binding between an aptamer and small targets.
After selection by the Gu group, this aptamer was integrated with different platforms, including electrochemical aptamer-based biosensors, a competitive enzyme-linked aptamer assay, and a microtiter plate, which can achieve high-throughput detection of tetracycline8,9,10. However, its binding characteristics have not been elucidated well enough to choose the proper platform8; it is worth characterizing the binding of the aptamer to the tetracycline using ITC.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5&#39;-CGTACGGAATTCG CTAGCCCCCCGGCAGGCCACGG 
			C TTGGGTTGGTCCCACTGCGCG 
			TGGATCCGAGCTCCAC GTG-3&#39;</td>
			<td>Integrated DNA Technologies, Inc</td>
			<td></td>
			<td>The sequence is adopted from Gu&#39;s research, which has not identified Kd using ITC (refer references 8 and 9)</td>
		</tr>
		<tr>
			<td>Affinity ITC Auto Low Volume (190 &#181;L) System Complete&#8211;Gold Cells</td>
			<td>TA Instruments</td>
			<td>61000.901</td>
			<td>Isothermal titration calorimetry system</td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>Avantor (VWR)</td>
			<td>E506-100ML</td>
			<td>Calcium chloride 1 M in aqueous solution, Biotechnology Grade, sterile</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5417R</td>
			<td>The Eppendorf 5417R is unsurpassed in safety, reliability and ease-of-use. Very easy to maintain with a brushless motor that spins up to 16,400 RPM with maximum RCF up to 25,000 x g.</td>
		</tr>
		<tr>
			<td>Complete Degassing Station (110/230V)</td>
			<td>TA Instruments</td>
			<td>6326</td>
			<td>This degasser provides a self-contained stirring platform, vacuum chamber, vacuum port, temperature control and electronic timer for proper sample preparation.</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>TekNova</td>
			<td>E0375</td>
			<td>EDTA 500 mM, pH 7.5</td>
		</tr>
		<tr>
			<td>NanoDrop One Microvolume UV-Vis Spectrophotometer</td>
			<td>ThermoFisher</td>
			<td>ND-ONE-W</td>
			<td>UV-Vis Spectrophotometer</td>
		</tr>
		<tr>
			<td>Nanosep, Nanosep MF and NAB Centrifugal Devices</td>
			<td>Pall Laboratory</td>
			<td>OD030C34</td>
			<td>3 kDa molecular weight cutoff concentrator</td>
		</tr>
		<tr>
			<td>PBS pH 7.4</td>
			<td>IBI Scientific</td>
			<td>IB70165</td>
			<td>Buffer containing Sodium phosphate, Sodium chloride, Potassium phosphate, and Potassium chloride Ultra-Pure Grade Sterile filtered using 0.2 &#181;m filter. Autoclaved at 121 &#176;C for greater than 20 min.</td>
		</tr>
		<tr>
			<td>Posi-Click 1.7 mL Large Cap Microcentrifuge Tubes</td>
			<td>labForce (a Thomas Scientific Brand)</td>
			<td>1149K01</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline, Hydrochoride</td>
			<td>EMD Millipore Corperation</td>
			<td>CAS64-75-5</td>
			<td></td>
		</tr>
	</tbody>
</table>

determining the thermodynamic and kinetic association of a dna aptamer and tetracycline using isothermal titration calorimetry

The determination of binding affinity and behavior between an aptamer and its target is the most crucial step in selecting and using an aptamer for application. Due to the drastic differences between the aptamer and small molecules, scientists need to put much effort into characterizing their binding properties. Isothermal Titration Calorimetry (ITC) is a powerful approach for this purpose. ITC goes beyond determining disassociation constants (Kd) and can provide the enthalpy changes and binding stoichiometry of the interaction between two molecules in the solution phase. This approach conducts continuous titration using label-free molecules and records released heat over time upon the binding events produced by each titration, so the process can sensitively measure the binding between macromolecules and their small targets. Herein, the article introduces a step-by-step procedure of the ITC measurement of a selected aptamer with a small target, tetracycline. This example proves the versatility of the technique and its potential for other applications.

ITC provides an accurate disassociation constant (Kd), the binding stoichiometry, and the thermodynamic parameters of two-molecule interactions6. In this example, the aptamer selected by Kim et al.9,11 binds to tetracycline with binding affinities of Kd 1 = 13 &#181;M, Kd 2 = 53 nM. Interestingly, this binding was determined using the equilibrium filtration method and a reported K...

Watch this Scientific Journal Video about Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry at JoVE.com

Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry

The present protocol describes the use of Isothermal Titration Calorimetry (ITC) to analyze the association and dissociation kinetics of the binding between a DNA aptamer and tetracycline, including sample preparation, running standards and samples, and interpreting the resulting data.

The determination of binding affinity and behavior between an aptamer and its target is the most crucial step in selecting and using an aptamer for ...

determining-thermodynamic-kinetic-association-dna-aptamer

Research

JoVE Journal

Biochemistry

2.8K Views.  Aptagen LLC. The present protocol describes the use of Isothermal Titration Calorimetry (ITC) to analyze the association and dissociation kinetics of the binding between a DNA aptamer and tetracycline, including sample preparation, running standards and samples, and interpreting the resulting data. 

Video: Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry

Mapping the Binding Site of an Aptamer on ATP Using MicroScale Thermophoresis

Characterization of molecular interactions in terms of basic binding parameters such as binding affinity, stoichiometry, and thermodynamics is an essential step in basic and applied science. MicroScale Thermophoresis (MST) is a sensitive biophysical method to obtain this important information. Relying on a physical effect called thermophoresis, which describes the movement of molecules through temperature gradients, this technology allows for the fast and precise determination of binding parameters in solution and allows the free choice of buffer conditions (from buffer to lysates/sera). MST uses the fact that an unbound molecule displays a different thermophoretic movement than a molecule that is in complex with a binding partner. The thermophoretic movement is altered in the moment of molecular interaction due to changes in size, charge, and hydration shell. By comparing the movement profiles of different molecular ratios of the two binding partners, quantitative information such as binding affinity (pM to mM) can be determined. Even challenging interactions between molecules of small sizes, such as aptamers and small compounds, can be studied by MST. Using the well-studied model interaction between the DH25.42 DNA aptamer and ATP, this manuscript provides a protocol to characterize aptamer-small molecule interactions. This study demonstrates that MST is highly sensitive and permits the mapping of the binding site of the 7.9 kDa DNA aptamer to the adenine of ATP.

MicroScale Thermophoresis (MST) is a sensitive technology to characterize aptamer-target interactions. This manuscript describes an MST protocol to characterize aptamer-small molecule interactions.

Characterization of molecular interactions in terms of basic binding parameters such as binding affinity, stoichiometry, and thermodynamics is an ...

Differential Scanning Calorimetry &#8212; A Method for Assessing the Thermal Stability and Conformation of Protein Antigen

Differential scanning calorimetry (DSC) is an analytical technique that measures the molar heat capacity of samples as a function of temperature. In the case of protein samples, DSC profiles provide information about thermal stability, and to some extent serves as a structural &#8220;fingerprint&#8221; that can be used to assess structural conformation. It is performed using a differential scanning calorimeter that measures the thermal transition temperature (melting temperature; Tm) and the energy required to disrupt the interactions stabilizing the tertiary structure (enthalpy; &#8710;H) of proteins. Comparisons are made between formulations as well as production lots, and differences in derived values indicate differences in thermal stability and structural conformation. Data illustrating the use of DSC in an industrial setting for stability studies as well as monitoring key manufacturing steps are provided as proof of the effectiveness of this protocol. In comparison to other methods for assessing the thermal stability of protein conformations, DSC is cost-effective, requires few sample preparation steps, and also provides a complete thermodynamic profile of the protein unfolding process.

Differential scanning calorimetry measures the thermal transition temperature(s) and total heat energy required to denature a protein. Results obtained are used to assess the thermal stability of protein antigens in vaccine formulations.

Differential scanning calorimetry (DSC) is an analytical technique that measures the molar heat capacity of samples as a function of temperature. In the ...

Detection and Visualization of DNA Damage-induced Protein Complexes in Suspension Cell Cultures Using the Proximity Ligation Assay

The DNA damage response orchestrates the repair of DNA lesions that occur spontaneously, are caused by genotoxic stress, or appear in the context of programmed DNA breaks in lymphocytes. The Ataxia-Telangiectasia Mutated kinase (ATM), ATM- and Rad3-Related kinase (ATR) and the catalytic subunit of DNA-dependent Protein Kinase (DNA-PKcs) are among the first that are activated upon induction of DNA damage, and are central regulators of a network that controls DNA repair, apoptosis and cell survival. As part of a tumor-suppressive pathway, ATM and ATR activate p53 through phosphorylation, thereby regulating the transcriptional activity of p53. DNA damage also results in the formation of so-called ionizing radiation-induced foci (IRIF) that represent complexes of DNA damage sensor and repair proteins that accumulate at the sites of DNA damage, which are visualized by fluorescence microscopy. Co-localization of proteins in IRIFs, however, does not necessarily imply direct protein-protein interactions, as the resolution of fluorescence microscopy is limited. 
In situ Proximity Ligation Assay (PLA) is a novel technique that allows the direct visualization of protein-protein interactions in cells and tissues with unprecedented specificity and sensitivity. This technique is based on the spatial proximity of specific antibodies binding to the proteins of interest. When the interrogated proteins are within ~40 nm an amplification reaction is triggered by oligonucleotides that are conjugated to the antibodies, and the amplification product is visualized by fluorescent labeling, yielding a signal that corresponds to the subcellular location of the interacting proteins. Using the established functional interaction between ATM and p53 as an example, it is demonstrated here how PLA can be used in suspension cell cultures to study the direct interactions between proteins that are integral parts of the DNA damage response.

Here, it is demonstrated how the in situ Proximity Ligation Assay (PLA) can be used to detect and visualize the direct protein-protein interactions between ATM and p53 in suspension cell cultures exposed to genotoxic stress.

The DNA damage response orchestrates the repair of DNA lesions that occur spontaneously, are caused by genotoxic stress, or appear in the context of ...

DNA Polymerase Activity Assay Using Near-infrared Fluorescent Labeled DNA Visualized by Acrylamide Gel Electrophoresis

For any enzyme, robust, quantitative methods are required for characterization of both native and engineered enzymes. For DNA polymerases, DNA synthesis can be characterized using an in vitro DNA synthesis assay followed by polyacrylamide gel electrophoresis. The goal of this assay is to quantify synthesis of both natural DNA and modified DNA (M-DNA). These approaches are particularly useful for resolving oligonucleotides with single nucleotide resolution, enabling observation of individual steps during enzymatic oligonucleotide synthesis. These methods have been applied to the evaluation of an array of biochemical and biophysical properties such as the measurement of steady-state rate constants of individual steps of DNA synthesis, the error rate of DNA synthesis, and DNA binding affinity. By using modified components including, but not limited to, modified nucleoside triphosphates (NTP), M-DNA, and/or mutant DNA polymerases, the relative utility of substrate-DNA polymerase pairs can be effectively evaluated. Here, we detail the assay itself, including the changes that must be made to accommodate nontraditional primer DNA labeling strategies such as near-infrared fluorescently labeled DNA. Additionally, we have detailed crucial technical steps for acrylamide gel pouring and running, which can often be technically challenging.

This protocol describes the characterization of DNA polymerase synthesis of modified DNA through observation of changes to near-infrared fluorescently labeled DNA using gel electrophoresis and gel imaging. Acrylamide gels are used for high resolution imaging of the separation of short nucleic acids, which migrate at different rates depending on size.

For any enzyme, robust, quantitative methods are required for characterization of both native and engineered enzymes. For DNA polymerases, DNA synthesis ...

Rab10 Phosphorylation Detection by LRRK2 Activity Using SDS-PAGE with a Phosphate-binding Tag

Mutations in leucine-rich repeat kinase 2 (LRRK2) have been shown to be linked with familial Parkinson&#39;s disease (FPD). Since abnormal activation of the kinase activity of LRRK2 has been implicated in the pathogenesis of PD, it is essential to establish a method to evaluate the physiological levels of the kinase activity of LRRK2. Recent studies revealed that LRRK2 phosphorylates members of the Rab GTPase family, including Rab10, under physiological conditions. Although the phosphorylation of endogenous Rab10 by LRRK2 in cultured cells could be detected by mass spectrometry, it has been difficult to detect it by immunoblotting due to the poor sensitivity of currently available phosphorylation-specific antibodies for Rab10. Here, we describe a simple method of detecting the endogenous levels of Rab10 phosphorylation by LRRK2 based on immunoblotting utilizing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) combined with a phosphate-binding tag (P-tag), which is N-(5-(2-aminoethylcarbamoyl)pyridin-2-ylmetyl)-N,N&#39;,N&#39;-tris(pyridin-2-yl-methyl)-1,3-diaminopropan-2-ol. The present protocol not only provides an example of the methodology utilizing the P-tag but also enables the assessment of how mutations as well as inhibitor treatment/administration or any other factors alter the downstream signaling of LRRK2 in cells and tissues.

The present study describes a simple method of detecting endogenous levels of Rab10 phosphorylation by leucine-rich repeat kinase 2.

Mutations in leucine-rich repeat kinase 2 (LRRK2) have been shown to be linked with familial Parkinson&#39;s disease (FPD). Since abnormal activation of ...

Multiplexed Isothermal Amplification Based Diagnostic Platform to Detect Zika, Chikungunya, and Dengue 1

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different downstream patient-to-patient transmission potentials, and require very different patient treatments. Thus, recent Zika outbreaks make it urgent to develop tools that rapidly discriminate these viruses in patients and trapped mosquitoes, to select the correct patient treatment, and to understand and manage their epidemiology in real time.
Unfortunately, current diagnostic tests, including those receiving 2016 emergency use authorizations and fast-track status, detect viral RNA by reverse transcription polymerase chain reaction (RT-PCR), which requires instrumentation, trained users, and considerable sample preparation. Thus, they must be sent to &#34;approved&#34; reference laboratories, requiring time. Indeed, in August 2016, the Center for Disease Control (CDC) was asking pregnant women who had been bitten by a mosquito and developed a Zika-indicating rash to wait an unacceptable 2 to 4 weeks before learning whether they were infected. We very much need tests that can be done on site, with few resources, and by trained but not necessarily licensed personnel.
This video demonstrates an assay that meets these specifications, working with urine or serum (for patients) or crushed mosquito carcasses (for environmental surveillance), all without much sample preparation. Mosquito carcasses are captured on paper carrying quaternary ammonium groups (Q-paper) followed by ammonia treatment to manage biohazards. These are then directly, without RNA isolation, put into assay tubes containing freeze-dried reagents that need no chain of refrigeration. A modified form of reverse transcription loop-mediated isothermal amplification with target-specific fluorescently tagged displaceable probes produces readout, in 30 min, as a three-color fluorescence signal. This is visualized with a handheld, battery-powered device with an orange filter. Forward contamination is prevented with sealed tubes, and the use of thermolabile uracil DNA glycosylase (UDG) in the presence of dUTP in the amplification mixture.

Current multiplexed diagnostics to detect Zika, chikungunya, and dengue viruses require complex sample preparation and expensive instrumentation, and are difficult to use in low resource environments. We show a diagnostic that uses isothermal amplification with target-specific strand displaceable probes to detect and differentiate these viruses with high sensitivity and specificity.

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different ...

Determining if DNA Stained with a Cyanine Dye Can Be Digested with Restriction Enzymes

Visualization of DNA for fluorescence microscopy utilizes a variety of dyes such as cyanine dyes. These dyes are utilized due to their high affinity and sensitivity for DNA. In order to determine if the DNA molecules are full length after the completion of the experiment, a method is required to determine if the stained molecules are full length by digesting DNA with restriction enzymes. However, stained DNA may inhibit the enzymes, so a method is needed to determine what enzymes one could use for fluorochrome stained DNA. In this method, DNA is stained with a cyanine dye overnight to allow the dye and DNA to equilibrate. Next, stained DNA is digested with a restriction enzyme, loaded into a gel and electrophoresed. The experimental DNA digest bands are compared to an in silico digest to determine the restriction enzyme activity. If there is the same number of bands as expected, then the reaction is complete. More bands than expected indicate partial digestion and less bands indicate incomplete digestion. The advantage of this method is its simplicity and it uses equipment that a scientist would need for a restriction enzyme assay and gel electrophoresis. A limitation of this method is that the enzymes available to most scientists are commercially available enzymes; however, any restriction enzymes could be used.

Staining DNA molecules for fluorescence microscopy allows a scientist to view them during an experiment. In the method presented here, DNA molecules are pre-stained with fluorescent dyes and digested with methylation and non-methylation sensitive restriction enzymes.

Visualization of DNA for fluorescence microscopy utilizes a variety of dyes such as cyanine dyes. These dyes are utilized due to their high affinity and ...

Titration ELISA as a Method to Determine the Dissociation Constant of Receptor Ligand Interaction

The dissociation constant describes the interaction between two partners in the binding equilibrium and is a measure of their affinity. It is a crucial parameter to compare different ligands, e.g., competitive inhibitors, protein isoforms and mutants, for their binding strength to a binding partner. Dissociation constants are determined by plotting concentrations of bound versus free ligand as binding curves. In contrast, titration curves, in which a signal that is proportional to the concentration of bound ligand is plotted against the total concentration of added ligand, are much easier to record. The signal can be detected spectroscopically and by enzyme-linked immunosorbent assay (ELISA). This is exemplified in a protocol for a titration ELISA that measures the binding of the snake venom-derived rhodocetin to its immobilized target domain of &#945;2&#946;1 integrin. Titration ELISAs are versatile and widely used. Any pair of interacting proteins can be used as immobilized receptor and soluble ligand, provided that both proteins are pure, and their concentrations are known. The difficulty so far has been to determine the dissociation constant from a titration curve. In this study, a mathematical function underlying titration curves is introduced. Without any error-prone graphical estimation of a saturation yield, this algorithm allows processing of the raw data (signal intensities at different concentrations of added ligand) directly by mathematical evaluation via non-linear regression. Thus, several titration curves can be recorded simultaneously and transformed into a set of characteristic parameters, among them the dissociation constant and the concentration of binding-active receptor, and they can be evaluated statistically. When combined with this algorithm, titration ELISAs gain the advantage of directly presenting the dissociation constant. Therefore, they may be used more efficiently in the future.

A detailed protocol to perform a titration ELISA is described. Moreover, a novel algorithm is presented to evaluate titration ELISAs and to obtain a dissociation constant of binding of a soluble ligand to a microtiter plate-immobilized receptor.

The dissociation constant describes the interaction between two partners in the binding equilibrium and is a measure of their affinity. It is a crucial ...

Proofreading and DNA Repair Assay Using Single Nucleotide Extension and MALDI-TOF Mass Spectrometry Analysis

The maintenance of the genome and its faithful replication is paramount for conserving genetic information. To assess high fidelity replication, we have developed a simple non-labeled and non-radio-isotopic method using a matrix-assisted laser desorption ionization with time-of-flight (MALDI-TOF) mass spectrometry (MS) analysis for a proofreading study. Here, a DNA polymerase [e.g., the Klenow fragment (KF) of Escherichia coli DNA polymerase I (pol I) in this study] in the presence of all four dideoxyribonucleotide triphosphates is used to process a mismatched primer-template duplex. The mismatched primer is then proofread/extended and subjected to MALDI-TOF MS. The products are distinguished by the mass change of the primer down to single nucleotide variations. Importantly, a proofreading can also be determined for internal single mismatches, albeit at different efficiencies. Mismatches located at 2-4-nucleotides (nt) from the 3' end were efficiently proofread by pol I, and a mismatch at 5 nt from the primer terminus showed only a partial correction. No proofreading occurred for internal mismatches located at 6 - 9 nt from the primer 3' end. This method can also be applied to DNA repair assays (e.g., assessing a base-lesion repair of substrates for the endo V repair pathway). Primers containing 3' penultimate deoxyinosine (dI) lesions could be corrected by pol I. Indeed, penultimate T-I, G-I, and A-I substrates had their last 2 dI-containing nucleotides excised by pol I before adding a correct ddN 5'-monophosphate (ddNMP) while penultimate C-I mismatches were tolerated by pol I, allowing the primer to be extended without repair, demonstrating the sensitivity and resolution of the MS assay to measure DNA repair.

A non-labeled, non-radio-isotopic method for DNA polymerase proofreading and a DNA repair assay was developed by using high-resolution MALDI-TOF mass spectrometry and a single nucleotide extension strategy. The assay proved to be very specific, simple, rapid, and easy to perform for proofreading and repair patches shorter than 9-nucleotides.

The maintenance of the genome and its faithful replication is paramount for conserving genetic information. To assess high fidelity replication, we have ...

Anaerobic Protein Purification and Kinetic Analysis via Oxygen Electrode for Studying DesB Dioxygenase Activity and Inhibition

Oxygen-sensitive proteins, including those enzymes which utilize oxygen as a substrate, can have reduced stability when purified using traditional aerobic purification methods. This manuscript illustrates the technical details involved in the anaerobic purification process, including the preparation of buffers and reagents, the methods for column chromatography in a glove box, and the desalting of the protein prior to kinetics. Also described are the methods for preparing and using an oxygen electrode to perform kinetic characterization of an oxygen-utilizing enzyme. These methods are illustrated using the dioxygenase enzyme DesB, a gallate dioxygenase from the bacterium Sphingobium sp. strain SYK-6.

Here we present a protocol for anaerobic protein purification, anaerobic protein concentration, and subsequent kinetic characterization using an oxygen electrode system. The method is illustrated using the enzyme DesB, a dioxygenase enzyme which is more stable and active when purified and stored in an anaerobic environment.

Oxygen-sensitive proteins, including those enzymes which utilize oxygen as a substrate, can have reduced stability when purified using traditional aerobic ...