A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
وتورط خلايا الجذعية السرطانية (الخلايا الجذعية السرطانية) في ورم الانتكاس بسبب مقاومة كيميائية. لقد الأمثل بروتوكول للاختيار والتوسع في الخلايا الجذعية السرطانية من خطوط الخلايا السرطانية في المبيض. عن طريق علاج الخلايا مع سيسبلاتين العلاج الكيميائي وزرع الخلايا الجذعية في تعزيز وسائل الإعلام أننا إثراء للثقافات CSC غير ملتصقة.
وتعرف الخلايا الجذعية السرطانية (الخلايا الجذعية السرطانية)، ومجموعة فرعية من الدراجات بطيئة والخلايا غير المتمايزة التي تقسم غير متماثلة لتوليد التكاثري للغاية، الغازية، والخلايا السرطانية chemoresistant. ولذلك، الخلايا الجذعية السرطانية هي الخلايا السكان جذابة لاستهداف علاجيا. ومن المتوقع الخلايا الجذعية السرطانية إلى المساهمة في عدد من أنواع الأورام الخبيثة بما في ذلك تلك الموجودة في الدم والدماغ والرئة والجهاز الهضمي والبروستاتا والمبيض. عزل وإثراء ويبلغ عدد سكانها الخلايا السرطانية عن الخلايا الجذعية السرطانية تمكين الباحثين من دراسة خصائص وعلم الوراثة، والاستجابة العلاجية الخلايا الجذعية السرطانية. ولدت لدينا البروتوكول الذي يثري بتكاثر الخلايا الجذعية السرطانية لسرطان المبيض المبيض من خطوط الخلايا السرطانية (SKOV3 وOVCA429). يتم التعامل مع خطوط الخلايا مع 20 ميكرومتر سيسبلاتين لمدة 3 أيام. الخلايا على قيد الحياة هي معزولة ومثقف في وسائل الاعلام الخلايا الجذعية خالية من مصل يحتوي على السيتوكينات وعوامل النمو. علينا أن نبرهن على إثراء هذه الخلايا الجذعية السرطانية أكثر نظافة من خلال تحليل خلايا منعزلة لكnown وقف علامات خلية Oct4، NANOG، وProm1 (CD133) والتعبير سطح الخلية من CD177 وCD133. زاد المعرض الخلايا الجذعية السرطانية مقاومة كيميائية. هذه الطريقة لعزل الخلايا الجذعية السرطانية هي أداة مفيدة لدراسة دور الخلايا الجذعية السرطانية في الورم مقاومة كيميائية والانتكاس.
Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4.
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.
1. خلية الثقافة والفلورسنت وصفها من سرطان المبيض خطوط الخلايا
2. إثراء الخلايا الجذعية للسرطان
3. CSC توصيف عبر تحليل التعبير الجيني للعلامات الخلايا الجذعية
أكتوبر 4-FAM | التمهيدي 1: 5'-CCCAAGGAATAGTCTGTAGAAGTG-3 " |
التمهيدي 2: 5'-TGCATGAGTCAGTGAACAGG-3 " | |
FAM التحقيق: 5'-CTTCCAAGC / ZEN / TGCCCACCTAACTTCT / 3IABkFQ -3 " | |
NANOG-HEX | التمهيدي 1: 5'-CCTTCTGCGTCACACCATT-3 " |
التمهيدي 2: 5'-AACTCTCCAACATCCTGAACC-3 " | |
HEX التحقيق: 5'-CTGCCACCT / ZEN.CTTAGATTTCATTCTCTGGT / 3IABkFQ-3 " | |
GAPDH-CY5 | التمهيدي 1: 5'-TGTAGTTGAGGTCAATGAAGGG-3 " |
التمهيدي 2: 5'-ACATCGCTCAGACACCATG-3 " | |
CY5 التحقيق: 5'-AAGGTCGGAGTCAACGGATTTGGTC / 3IABRQSP-3 " | |
NESTIN-FAM | التمهيدي 1: 5'-AGGACCTGAGCGATCTGG-3 " |
التمهيدي 2: 5'-CGTTGGAACAGAGGTTGGAG-3 " | |
FAM التحقيق: 5'-AACTTTTCA / ZEN / GTAGCCCGCAGCC / 3IABkFQ -3 " | |
CD133-HEX | التمهيدي 1: 5'-ACTCTCTCCAACAATCCATTCC-3 " |
التمهيدي 2: 5'-AAACAATTCACCAGCAACGAG-3 " | |
HEX التحقيق: 5'-ACAATCACT / ZEN / GAGCACTCTATACCAAAGCG / 3IABkFQ-3 |
الجدول 1. الاشعال تستخدم لتوصيف CSC بواسطة QRT-PCR.
e_title "> 4. تحليل الخلايا الجذعية السرطانية لخلية السطح علامات وCD117 CD1335. تحليل الخلايا الجذعية السرطانية للاستجابة العلاجية
لإثبات أننا عزل الخلايا الجذعية السرطانية من المبيض خطوط الخلايا السرطانية الظهارية باستخدام العلاج سيسبلاتين، حصلنا على أول صور للخطوط الخلايا قبل العلاج وبعد الاختيار. استخدمنا المجهر الضوئي لالتقاط الصور من ملتصقة (غير المعالجة) SKOV3 وOVCA429 الخلايا وSKOV3 وOVCA429 الخل?...
الخلايا الجذعية السرطانية التي تقاوم العلاج قد يكون مسؤولا عن الانتكاس بعد العلاج من الورم الرئيسي. توصيف الخلايا الجذعية السرطانية قد يؤدي إلى تحسن العلاجات لسرطان المبيض. المعلمات الحرجة في تأسيس الخلايا الجذعية السرطانية chemoresistant باستخدام بروتوكول أعلاه وتوقيت ...
The authors declare they have no competing financial interest.
Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.
Name | Company | Catalog Number | Comments |
McCoy | Life Technologies | 16600-108 | Warm to 37 °C prior to use |
DMEM / F12 serum free | Life Technologies | 11320-033 | Warm to 37 °C prior to use |
Minimal Essential Media | Life Technologies | 42360032 | Warm to 37 °C prior to use |
Sodium pyruvate | Life Technologies | 11360070 | |
Polybrene | Millipore | TR-1003-G | |
Blasticidin | Life Technologies | R21001 | |
Fetal Bovine Serum | Atlas Biologicals | F-0500-A | |
Penicillin-streptomycin | Life Technologies | 15070-063 | |
Cisplatin | Sigma-Aldrich | T7402-5MG | Caution: Toxic. Use precautions |
pLenti-suCMV-Rsv | Gentarget | LVP023 | BSL2 approval needed |
Insulin | Sigma-Aldrich | I-1882 | |
Human Recombinant EGF | Cell Signaling Technology | 8916LC | |
bFGF | BD biosciences | 354060 | |
LIF | Santa Cruz | sc-4988A | |
Bovine Serum Albumin | Roche | 03 116 956 001 | |
TRIzol | Life Technologies | 15596-018 | |
High Capacity cDNA Reverse Transcription Kit | Applied Biosystems | 4368813 | |
IQ Multiplex Powermix | BioRad | 1725849 | |
Accumax | Millipore | ||
Primers | Integrated DNA Technology | individually designed and ordered (see protocol for sequnces) | |
Anti-CD133 PE | Milenyl | 130-098-826 | Primer/probe sets are light sensitive |
CD117-Biotin | Miltenly | 130-098-570 | |
AntiBiotin-FITC | Miltenly | 130-098-796 | |
Paraformaldehyde | Sigma-Aldrich | P6148-1KG | Caution: Toxic. Always prepare in hood and make fresh. |
Trypsin | Life Technologies | 25300062 | |
MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) | Sigma-Aldrich | 25200-072 | |
EVOS Fl Epifluorescence and Transmitted Light Microscope | Advanced Microscopy Group | ||
Biorad CFX96 C1000 System | Biorad | ||
Beckman Coulter FC500 Flow Cytometer | Beckman Coulter | ||
Spectramax 340PC384 | Molecular Devices |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved