È necessario avere un abbonamento a JoVE per visualizzare questo. Accedi o inizia la tua prova gratuita.
Method Article
Le cellule staminali tumorali (CSC) sono implicati nel tumore recidiva a causa di chemioresistenza. Abbiamo ottimizzato un protocollo per la selezione ed espansione di cellule staminali tumorali da linee cellulari di carcinoma ovarico. Trattando le cellule con il cisplatino chemioterapico e coltura in una cellula staminale promuovere media che arricchiscono per le culture CSC non aderenti.
Le cellule staminali tumorali (CSC) sono definiti come un sottoinsieme di ciclismo lento e cellule indifferenziate che si dividono asimmetricamente per generare altamente proliferative, invasive, e le cellule tumorali chemioresistenti. Pertanto, CSC sono una popolazione interessante di cellule a bersaglio terapeutico. CSC si prevede di contribuire a un certo numero di tipi di tumori maligni, compresi quelli nel sangue, cervello, polmoni, tratto gastrointestinale, della prostata e ovaie. Isolare e arricchire una popolazione di cellule tumorali per CSC permetterà ai ricercatori di studiare le proprietà, la genetica, e la risposta terapeutica di CSC. Abbiamo generato un protocollo che arricchisce riproducibile per CSC tumore ovarico da linee cellulari di cancro ovarico (SKOV3 e OVCA429). Linee cellulari sono trattate con 20 mM cisplatino per 3 giorni. Cellule sopravvissute sono isolate e coltivate in un supporto di cellule staminali senza siero contenente citochine e fattori di crescita. Dimostriamo un arricchimento di questi CSC purificati analizzando le cellule isolate per known marcatori di cellule staminali di staminalità Oct 4, Nanog, e Prom1 (CD133) e superficie cellulare espressione di CD177 e CD133. La mostra CSC aumentato chemioresistenza. Questo metodo per l'isolamento di CSC è uno strumento utile per studiare il ruolo di CSC in chemioresistenza e di recidiva del tumore.
Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4.
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.
1 Cella cultura e fluorescente Etichettatura di cancro ovarico linee cellulari
2. arricchimento di cellule tumorali staminali
3. CSC Caratterizzazione mediante analisi di espressione genica di cellule staminali Marcatori
Oct-4-FAM | Primer 1: 5'-CCCAAGGAATAGTCTGTAGAAGTG-3 ' |
Primer 2: 5'-TGCATGAGTCAGTGAACAGG-3 ' | |
Sonda FAM: 5'-CTTCCAAGC / ZEN / TGCCCACCTAACTTCT / 3IABkFQ -3 ' | |
Nanog-HEX | Primer 1: 5'-CCTTCTGCGTCACACCATT-3 ' |
Primer 2: 5'-AACTCTCCAACATCCTGAACC-3 ' | |
Sonda HEX: 5'-CTGCCACCT / ZEN.CTTAGATTTCATTCTCTGGT / 3IABkFQ-3 ' | |
GAPDH-CY5 | Primer 1: 5'-TGTAGTTGAGGTCAATGAAGGG-3 ' |
Primer 2: 5'-ACATCGCTCAGACACCATG-3 ' | |
Sonda CY5: 5'-AAGGTCGGAGTCAACGGATTTGGTC / 3IABRQSP-3 ' | |
Nestina-FAM | Primer 1: 5'-AGGACCTGAGCGATCTGG-3 ' |
Primer 2: 5'-CGTTGGAACAGAGGTTGGAG-3 ' | |
Sonda FAM: 5'-AACTTTTCA / ZEN / GTAGCCCGCAGCC / 3IABkFQ -3 ' | |
CD133-HEX | Primer 1: 5'-ACTCTCTCCAACAATCCATTCC-3 ' |
Primer 2: 5'-AAACAATTCACCAGCAACGAG-3 ' | |
Sonda HEX: 5'-ACAATCACT / ZEN / GAGCACTCTATACCAAAGCG / 3IABkFQ-3 |
Tabella 1. primer utilizzati per la CSC caratterizzazione mediante QRT-PCR.
e_title "> 4. CSC Analisi per cellulari di superficie marcatori CD117 e CD1335. Analizzando CSC per la risposta terapeutica
Per dimostrare che abbiamo isolato cellule staminali tumorali da linee di cellule di cancro ovarico epiteliale mediante trattamento con cisplatino, in primo luogo abbiamo acquisito le immagini delle linee cellulari prima del trattamento e dopo la selezione. Abbiamo usato la microscopia ottica per catturare immagini di aderenti (non trattato) SKOV3 e OVCA429 cellule e SKOV3 e OVCA429 CSC (Figura 1). CSC appaiono rotondo e non attaccato alle piastre di coltura tissutale (figure 1 e
CSC che sono resistenti alla terapia possono essere responsabili di recidiva dopo il trattamento del tumore primario. Caratterizzazione della CSC può portare a migliori terapie per il cancro ovarico. I parametri critici nella creazione di CSC chemioresistenti utilizzando il protocollo di cui sopra sono cronometrando l'durata del trattamento con la chemioterapia e la concentrazione della chemioterapia. Quando si utilizza il protocollo in Ma et al. si è constatato che dopo 7 giorni di trattamento con cispla...
The authors declare they have no competing financial interest.
Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.
Name | Company | Catalog Number | Comments |
McCoy | Life Technologies | 16600-108 | Warm to 37 °C prior to use |
DMEM / F12 serum free | Life Technologies | 11320-033 | Warm to 37 °C prior to use |
Minimal Essential Media | Life Technologies | 42360032 | Warm to 37 °C prior to use |
Sodium pyruvate | Life Technologies | 11360070 | |
Polybrene | Millipore | TR-1003-G | |
Blasticidin | Life Technologies | R21001 | |
Fetal Bovine Serum | Atlas Biologicals | F-0500-A | |
Penicillin-streptomycin | Life Technologies | 15070-063 | |
Cisplatin | Sigma-Aldrich | T7402-5MG | Caution: Toxic. Use precautions |
pLenti-suCMV-Rsv | Gentarget | LVP023 | BSL2 approval needed |
Insulin | Sigma-Aldrich | I-1882 | |
Human Recombinant EGF | Cell Signaling Technology | 8916LC | |
bFGF | BD biosciences | 354060 | |
LIF | Santa Cruz | sc-4988A | |
Bovine Serum Albumin | Roche | 03 116 956 001 | |
TRIzol | Life Technologies | 15596-018 | |
High Capacity cDNA Reverse Transcription Kit | Applied Biosystems | 4368813 | |
IQ Multiplex Powermix | BioRad | 1725849 | |
Accumax | Millipore | ||
Primers | Integrated DNA Technology | individually designed and ordered (see protocol for sequnces) | |
Anti-CD133 PE | Milenyl | 130-098-826 | Primer/probe sets are light sensitive |
CD117-Biotin | Miltenly | 130-098-570 | |
AntiBiotin-FITC | Miltenly | 130-098-796 | |
Paraformaldehyde | Sigma-Aldrich | P6148-1KG | Caution: Toxic. Always prepare in hood and make fresh. |
Trypsin | Life Technologies | 25300062 | |
MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) | Sigma-Aldrich | 25200-072 | |
EVOS Fl Epifluorescence and Transmitted Light Microscope | Advanced Microscopy Group | ||
Biorad CFX96 C1000 System | Biorad | ||
Beckman Coulter FC500 Flow Cytometer | Beckman Coulter | ||
Spectramax 340PC384 | Molecular Devices |
Richiedi autorizzazione per utilizzare il testo o le figure di questo articolo JoVE
Richiedi AutorizzazioneThis article has been published
Video Coming Soon