Zum Anzeigen dieser Inhalte ist ein JoVE-Abonnement erforderlich. Melden Sie sich an oder starten Sie Ihre kostenlose Testversion.
Method Article
Krebsstammzellen (CSCs) in Tumorrückfall durch Chemoresistenz beteiligt ist. Wir haben ein Protokoll für die Auswahl und den Ausbau von CSCs von Eierstock-Krebszelllinien optimiert. Durch die Behandlung mit dem Chemo Zellen Cisplatin und Kultivierung in einer Stammzelle Förderung der Medien bereichern wir für nicht haft CSC Kulturen.
Krebsstammzellen (CSCs) als Teilmenge von langsamen Radfahren und undifferenzierte Zellen, die asymmetrisch zu teilen, um hoch proliferativen, invasive erzeugen und chemoresistenten Tumorzellen definiert. Daher sind KSZ eine attraktive Population von Zellen therapeutisch zu zielen. KSZ wird vorhergesagt, zu einer Anzahl von Arten von Malignitäten einschließlich derjenigen im Blut, Gehirn, Lunge, Magen, Darm, Prostata und des Eierstocks bei. Isolierung und Anreicherung einer Tumorzellpopulation für CSCs ermöglichen es den Forschern, die Eigenschaften, Genetik und therapeutische Reaktion von CSCs studieren. Wir erzielten ein Protokoll, das reproduzierbar bereichert für Eierstockkrebs Eierstockkrebs von CSCs Zelllinien (SKOV3 und OVCA429). Zelllinien werden mit 20 uM Cisplatin für 3 Tage behandelt. Überlebende Zellen werden isoliert und kultiviert in serumfreiem Medium, das Stammzell Zytokinen und Wachstumsfaktoren. Wir zeigen eine Anreicherung dieser gereinigten CSCs durch die Analyse der isolierten Zellen für known Stammzellmarker Oct4, Nanog und PROM1 (CD133) und Zelloberflächenexpression von CD177 und CD133. Die CSCs eine erhöhte Chemoresistenz. Diese Methode zur Isolierung von CSCs ist ein nützliches Werkzeug für die Untersuchung der Rolle von CSCs in Chemoresistenz und Tumorrückfall.
Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4.
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.
1. Zellkultur und Fluoreszenzmarkierung von Eierstockkrebszelllinien
2. Anreicherung von Krebsstammzellen
3. CSC Charakterisierung über Genexpressionsanalyse für Stammzellmarker
Oct-4-FAM | Primer 1: 5'-CCCAAGGAATAGTCTGTAGAAGTG-3 ' |
Primer 2: 5'-TGCATGAGTCAGTGAACAGG-3 ' | |
FAM-Sonde: 5'-CTTCCAAGC / ZEN / TGCCCACCTAACTTCT / 3IABkFQ -3 ' | |
Nanog-HEX | Primer 1: 5'-CCTTCTGCGTCACACCATT-3 ' |
Primer 2: 5'-AACTCTCCAACATCCTGAACC-3 ' | |
HEX-Sonde: 5'-CTGCCACCT / ZEN.CTTAGATTTCATTCTCTGGT / 3IABkFQ-3 ' | |
GAPDH-CY5 | Primer 1: 5'-TGTAGTTGAGGTCAATGAAGGG-3 ' |
Primer 2: 5'-ACATCGCTCAGACACCATG-3 ' | |
CY5 Sonde: 5'-AAGGTCGGAGTCAACGGATTTGGTC / 3IABRQSP-3 ' | |
NESTIN-FAM | Primer 1: 5'-AGGACCTGAGCGATCTGG-3 ' |
Primer 2: 5'-CGTTGGAACAGAGGTTGGAG-3 ' | |
FAM-Sonde: 5'-AACTTTTCA / ZEN / GTAGCCCGCAGCC / 3IABkFQ -3 ' | |
CD133-HEX | Primer 1: 5'-ACTCTCTCCAACAATCCATTCC-3 ' |
Primer 2: 5'-AAACAATTCACCAGCAACGAG-3 ' | |
HEX-Sonde: 5'-ACAATCACT / ZEN / GAGCACTCTATACCAAAGCG / 3IABkFQ-3 |
Tabelle 1. Primer für CSC Charakterisierung von QRT-PCR verwendet.
e_title "> 4. Analyse CSCs für Zelloberflächenmarker CD117 und CD1335. Analyse CSCs für therapeutische Reaktion
Um zu zeigen, dass wir isoliert KSZ von epithelialen Eierstockkrebszelllinien unter Verwendung von Cisplatin-Behandlung wir zunächst aufgenommenen Bildern der Zelllinien vor der Behandlung und nach der Selektion. Wir haben die Lichtmikroskopie, um Bilder von adhärenten (unbehandelt) und SKOV3 OVCA429 Zellen und SKOV3 und OVCA429 CSCs (Abbildung 1) zu erfassen. CSCs rund und nicht erscheinen, um die Gewebekulturplatten befestigt (Abbildungen 1 und 2). Wir zeigen weiter...
CSCs, die therapieresistent sind, können nach der Behandlung des Primärtumors verantwortlich für den Rückfall sein. Charakterisierung von CSCs zu verbesserten Therapien für Eierstockkrebs führen. Die kritischen Parameter in der Einrichtung chemoresistentem KSZ Verwendung des obigen Protokolls sind Zeit die Länge der Behandlung mit Chemotherapie und die Konzentration der Chemotherapie. Wenn unter Verwendung des Protokolls in Ma et al. es wurde festgestellt, daß nach 7 Tagen der Behandlung mit Cisplatin u...
The authors declare they have no competing financial interest.
Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.
Name | Company | Catalog Number | Comments |
McCoy | Life Technologies | 16600-108 | Warm to 37 °C prior to use |
DMEM / F12 serum free | Life Technologies | 11320-033 | Warm to 37 °C prior to use |
Minimal Essential Media | Life Technologies | 42360032 | Warm to 37 °C prior to use |
Sodium pyruvate | Life Technologies | 11360070 | |
Polybrene | Millipore | TR-1003-G | |
Blasticidin | Life Technologies | R21001 | |
Fetal Bovine Serum | Atlas Biologicals | F-0500-A | |
Penicillin-streptomycin | Life Technologies | 15070-063 | |
Cisplatin | Sigma-Aldrich | T7402-5MG | Caution: Toxic. Use precautions |
pLenti-suCMV-Rsv | Gentarget | LVP023 | BSL2 approval needed |
Insulin | Sigma-Aldrich | I-1882 | |
Human Recombinant EGF | Cell Signaling Technology | 8916LC | |
bFGF | BD biosciences | 354060 | |
LIF | Santa Cruz | sc-4988A | |
Bovine Serum Albumin | Roche | 03 116 956 001 | |
TRIzol | Life Technologies | 15596-018 | |
High Capacity cDNA Reverse Transcription Kit | Applied Biosystems | 4368813 | |
IQ Multiplex Powermix | BioRad | 1725849 | |
Accumax | Millipore | ||
Primers | Integrated DNA Technology | individually designed and ordered (see protocol for sequnces) | |
Anti-CD133 PE | Milenyl | 130-098-826 | Primer/probe sets are light sensitive |
CD117-Biotin | Miltenly | 130-098-570 | |
AntiBiotin-FITC | Miltenly | 130-098-796 | |
Paraformaldehyde | Sigma-Aldrich | P6148-1KG | Caution: Toxic. Always prepare in hood and make fresh. |
Trypsin | Life Technologies | 25300062 | |
MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) | Sigma-Aldrich | 25200-072 | |
EVOS Fl Epifluorescence and Transmitted Light Microscope | Advanced Microscopy Group | ||
Biorad CFX96 C1000 System | Biorad | ||
Beckman Coulter FC500 Flow Cytometer | Beckman Coulter | ||
Spectramax 340PC384 | Molecular Devices |
Genehmigung beantragen, um den Text oder die Abbildungen dieses JoVE-Artikels zu verwenden
Genehmigung beantragenThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. Alle Rechte vorbehalten