JoVE 비디오를 활용하시려면 도서관을 통한 기관 구독이 필요합니다. 전체 비디오를 보시려면 로그인하거나 무료 트라이얼을 시작하세요.
Method Article
암 줄기 세포 (암줄 기세포는) 때문에 chemoresistance에 종양 재발에 관여하고 있습니다. 우리는 선택 및 난소 암 세포주에서의 확장 된 CSC 프로토콜을 최적화했다. 화학 요법 시스플라틴 세포를 치료하고 우리는 비 부착 CSC 문화에 대한 풍부 미디어를 홍보 줄기 세포에서 배양.
암 줄기 세포 (CSC 추가)는 느린 사이클 및 높은 증식 침습적 생성하는 비대칭 분할 미분화 세포 및 chemoresistant 종양 세포의 서브 세트로서 정의된다. 따라서 암줄 기세포는 치료 대상으로 세포의 매력적인 인구입니다. CSC 추가는 혈액, 뇌, 폐, 위장관, 전립선, 난소 및 사람들을 포함한 종양의 종류의 수에 기여할 것으로 예측된다. 격리하고 암줄 기세포에 대한 종양 세포의 인구는 암줄 기세포의 특성, 유전학 및 치료 반응을 연구하는 연구원을 가능하게 할 것이다 풍부. 우리는 재현성 난소 암 세포주 (SKOV3 및 OVCA429)에서 난소 암 된 CSC위한 풍요롭게 프로토콜을 생성. 셀 라인은 삼일에 20 μM 시스플라틴으로 처리됩니다. 살아남은 세포는 사이토 카인 및 성장 인자를 포함하는 무 혈청 줄기 세포 배지에서 배양하고 절연한다. 우리는 K 용 절연 세포를 분석하여 이들의 정제 된 CSC의 농축을 보여nown 세포 마커 인 Oct4, Nanog를하고 Prom1 (CD133) 및 CD177 및 CD133의 세포 표면 발현을 줄기. 암줄 기세포 전시 chemoresistance 증가했다. 암줄 기세포의 분리를위한이 방법은 chemoresistance 종양 재발에 암줄 기세포의 역할을 연구하는데 유용한 도구입니다.
Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4.
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.
1 셀 난소 암 세포주의 문화와 형광 표지
암 줄기 세포의 2 심화
줄기 세포 마커에 대한 유전자 발현 분석을 통해 3 CSC의 특성
월 4-FAM | 프라이머 1 : 5'-CCCAAGGAATAGTCTGTAGAAGTG-3 ' |
프라이머 2 : 5'-TGCATGAGTCAGTGAACAGG-3 ' | |
FAM 프로브 : 5'-CTTCCAAGC / ZEN / TGCCCACCTAACTTCT / 3IABkFQ -3 ' | |
NANOG-HEX | 프라이머 1 : 5'-CCTTCTGCGTCACACCATT-3 ' |
프라이머 2 : 5'-AACTCTCCAACATCCTGAACC-3 ' | |
HEX 프로브 : 5'-CTGCCACCT / ZEN.CTTAGATTTCATTCTCTGGT / 3IABkFQ-3 ' | |
GAPDH-CY5 | 프라이머 1 : 5'-TGTAGTTGAGGTCAATGAAGGG-3 ' |
프라이머 2 : 5'-ACATCGCTCAGACACCATG-3 ' | |
CY5 프로브 : 5'-AAGGTCGGAGTCAACGGATTTGGTC / 3IABRQSP-3 ' | |
네 스틴-FAM | 프라이머 1 : 5'-AGGACCTGAGCGATCTGG-3 ' |
프라이머 2 : 5'-CGTTGGAACAGAGGTTGGAG-3 ' | |
FAM 프로브 : 5'-AACTTTTCA / ZEN / GTAGCCCGCAGCC / 3IABkFQ -3 ' | |
CD133-HEX | 프라이머 1 : 5'-ACTCTCTCCAACAATCCATTCC-3 ' |
프라이머 2 : 5'-AAACAATTCACCAGCAACGAG-3 ' | |
HEX 프로브 : 5'-ACAATCACT / ZEN / GAGCACTCTATACCAAAGCG / 3IABkFQ-3 |
QRT-PCR에 의한 CSC 특성에 사용되는 표 1 프라이머.
e_title "> 4. 세포 표면 마커 CD117 및 CD133에 대한 분석 암줄 기세포(5) 치료 반응에 대한 암줄 기세포 분석
우리는 시스플라틴 치료를 이용한 난소 암 세포주에서 고립 된 CSC를 입증하기 위해, 우리는 먼저 사전 처리 및 선택 후 세포 라인의 이미지를 획득. 우리는 부착 (치료) 293 및 OVCA429 세포와 293 및 OVCA429 암줄 기세포 (그림 1)의 이미지를 캡처하기 위해 광학 현미경을 사용했다. CSC 추가는 조직 배양 접시에 부착하지 둥근 표시 (도 1 및도 2). 우리는 더 RFP 형질 293 세포는 세포 ...
치료에 저항하는 암줄 기세포 차 종양의 치료 후 재발에 대한 책임을 질 수 있습니다. 암줄 기세포의 특성은 난소 암에 대한 개선 된 치료법으로 이어질 수 있습니다. 상기 프로토콜을 사용 chemoresistant 된 CSC의 확립에 중요한 파라미터는 화학 요법 치료의 길이 및 화학 요법 농도 타이밍된다. 엄마 외의 프로토콜을 사용하는 경우. 그것은 시스플라틴과 파클리탁셀 치료의 칠일 후에 더 가능?...
The authors declare they have no competing financial interest.
Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.
Name | Company | Catalog Number | Comments |
McCoy | Life Technologies | 16600-108 | Warm to 37 °C prior to use |
DMEM / F12 serum free | Life Technologies | 11320-033 | Warm to 37 °C prior to use |
Minimal Essential Media | Life Technologies | 42360032 | Warm to 37 °C prior to use |
Sodium pyruvate | Life Technologies | 11360070 | |
Polybrene | Millipore | TR-1003-G | |
Blasticidin | Life Technologies | R21001 | |
Fetal Bovine Serum | Atlas Biologicals | F-0500-A | |
Penicillin-streptomycin | Life Technologies | 15070-063 | |
Cisplatin | Sigma-Aldrich | T7402-5MG | Caution: Toxic. Use precautions |
pLenti-suCMV-Rsv | Gentarget | LVP023 | BSL2 approval needed |
Insulin | Sigma-Aldrich | I-1882 | |
Human Recombinant EGF | Cell Signaling Technology | 8916LC | |
bFGF | BD biosciences | 354060 | |
LIF | Santa Cruz | sc-4988A | |
Bovine Serum Albumin | Roche | 03 116 956 001 | |
TRIzol | Life Technologies | 15596-018 | |
High Capacity cDNA Reverse Transcription Kit | Applied Biosystems | 4368813 | |
IQ Multiplex Powermix | BioRad | 1725849 | |
Accumax | Millipore | ||
Primers | Integrated DNA Technology | individually designed and ordered (see protocol for sequnces) | |
Anti-CD133 PE | Milenyl | 130-098-826 | Primer/probe sets are light sensitive |
CD117-Biotin | Miltenly | 130-098-570 | |
AntiBiotin-FITC | Miltenly | 130-098-796 | |
Paraformaldehyde | Sigma-Aldrich | P6148-1KG | Caution: Toxic. Always prepare in hood and make fresh. |
Trypsin | Life Technologies | 25300062 | |
MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) | Sigma-Aldrich | 25200-072 | |
EVOS Fl Epifluorescence and Transmitted Light Microscope | Advanced Microscopy Group | ||
Biorad CFX96 C1000 System | Biorad | ||
Beckman Coulter FC500 Flow Cytometer | Beckman Coulter | ||
Spectramax 340PC384 | Molecular Devices |
JoVE'article의 텍스트 или 그림을 다시 사용하시려면 허가 살펴보기
허가 살펴보기This article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. 판권 소유