A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
תאי גזע סרטני (CSCS) הם מעורבים בהישנות גידול עקב chemoresistance. יש לנו אופטימיזציה פרוטוקול לבחירה והרחבת CSCS משורות תאי סרטן השחלות. על ידי טיפול בתאים עם ציספלטין כימותרפיות וculturing בתאי גזע קידום תקשורת אנו מעשירים לתרבויות CSC לא חסידות.
תאי גזע סרטני (CSCS) מוגדרים כקבוצת משנה של רכיבה על אופניים איטיים ותאים שלא עברו התמיינות אשר מחלקים סימטרי ליצירת שגשוג מאוד, חודרני, ותאי גידול chemoresistant. לכן, CSCS הוא אוכלוסייה אטרקטיבית של תאים למקד טיפולי. CSCS הם חזו לתרום למספר סוגי סרטן כמו כולל אלו שבדם, המוח, ריאות, מערכת עיכול, ערמונית, והשחלה. בידוד והעשרת אוכלוסיית תאים סרטניים לCSCS תאפשר לחוקרים ללמוד את המאפיינים, גנטיקה, ותגובה הטיפולית של CSCS. אנחנו שנוצרנו פרוטוקול שמעשיר reproducibly לCSCS סרטן השחלות משורות תאי סרטן השחלות (SKOV3 וOVCA429). מטופלים שורות תאים עם 20 ציספלטין מיקרומטר במשך 3 ימים. תאים ששרדו מבודדים ותרבותיים בתקשורת של תאי גזע ללא סרום המכילה ציטוקינים וגורמי גדילה. אנו מדגימים העשרת CSCS המטוהר אלה על ידי ניתוח התאים המבודדים לknown תאי גזע סמני Oct4, Nanog, וProm1 (CD133) וביטוי בתא שטח של CD177 וCD133. תערוכת CSCS מוגברת chemoresistance. שיטה זו לבידודה של CSCS היא כלי שימושי לחקר תפקידה של CSCS בהישנות chemoresistance וגידול.
Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4.
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.
.1 תא תרבות ותיוג פלורסנט של שורות תאי סרטן השחלות
.2 העשרה של תאי גזע סרטניים
.3 אפיון CSC באמצעות ניתוח ביטוי גנים לסמני תאי גזע
אוקטובר -4-FAM | פריימר 1: 5'-CCCAAGGAATAGTCTGTAGAAGTG-3 " |
פריימר 2: 5'-TGCATGAGTCAGTGAACAGG-3 " | |
בדיקה FAM: 5'-CTTCCAAGC / ZEN / TGCCCACCTAACTTCT / 3IABkFQ -3 " | |
Nanog-HEX | פריימר 1: 5'-CCTTCTGCGTCACACCATT-3 " |
פריימר 2: 5'-AACTCTCCAACATCCTGAACC-3 " | |
הבדיקה HEX: 5'-CTGCCACCT / ZEN.CTTAGATTTCATTCTCTGGT / 3IABkFQ-3 " | |
GAPDH-Cy5 | פריימר 1: 5'-TGTAGTTGAGGTCAATGAAGGG-3 " |
פריימר 2: 5'-ACATCGCTCAGACACCATG-3 " | |
הבדיקה Cy5: 5'-AAGGTCGGAGTCAACGGATTTGGTC / 3IABRQSP-3 " | |
Nestin-FAM | פריימר 1: 5'-AGGACCTGAGCGATCTGG-3 " |
פריימר 2: 5'-CGTTGGAACAGAGGTTGGAG-3 " | |
בדיקה FAM: 5'-AACTTTTCA / ZEN / GTAGCCCGCAGCC / 3IABkFQ -3 " | |
CD133-HEX | פריימר 1: 5'-ACTCTCTCCAACAATCCATTCC-3 " |
פריימר 2: 5'-AAACAATTCACCAGCAACGAG-3 " | |
הבדיקה HEX: 5'-ACAATCACT / ZEN / GAGCACTCTATACCAAAGCG / 3IABkFQ-3 |
Primers הטבלה 1 המשמש לאפיון CSC ידי qRT-PCR.
e_title "> 4. CSCS ניתוח לתא שטח סמני CD117 וCD133.5 ניתוח CSCS לתגובה טיפולית
על מנת להוכיח כי אנו מבודדים CSCS משורות תאי סרטן השחלות אפיתל באמצעות טיפול ציספלטין, שרכשנו ראשון את תמונות של שורות התאים לפני טיפול ואחרי הבחירה. אנחנו השתמשנו במיקרוסקופ אור כדי ללכוד תמונות של חסיד (ללא טיפול) SKOV3 וOVCA429 תאים וSKOV3 וOVCA429 CSCS (איור 1). CSCS להופיע ?...
CSCS כי הם עמידים לטיפול עשוי להיות אחראי להישנות לאחר הטיפול של גידול ראשוני. אפיון של CSCS עלול להוביל לטיפולים משופרים לסרטן השחלות. הפרמטרים הקריטיים בהקמת CSCS chemoresistant באמצעות הפרוטוקול לעיל תזמון משך טיפול עם כימותרפיה והריכוז של כימותרפיה. בעת שימוש בפרוטוקול בא...
The authors declare they have no competing financial interest.
Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.
Name | Company | Catalog Number | Comments |
McCoy | Life Technologies | 16600-108 | Warm to 37 °C prior to use |
DMEM / F12 serum free | Life Technologies | 11320-033 | Warm to 37 °C prior to use |
Minimal Essential Media | Life Technologies | 42360032 | Warm to 37 °C prior to use |
Sodium pyruvate | Life Technologies | 11360070 | |
Polybrene | Millipore | TR-1003-G | |
Blasticidin | Life Technologies | R21001 | |
Fetal Bovine Serum | Atlas Biologicals | F-0500-A | |
Penicillin-streptomycin | Life Technologies | 15070-063 | |
Cisplatin | Sigma-Aldrich | T7402-5MG | Caution: Toxic. Use precautions |
pLenti-suCMV-Rsv | Gentarget | LVP023 | BSL2 approval needed |
Insulin | Sigma-Aldrich | I-1882 | |
Human Recombinant EGF | Cell Signaling Technology | 8916LC | |
bFGF | BD biosciences | 354060 | |
LIF | Santa Cruz | sc-4988A | |
Bovine Serum Albumin | Roche | 03 116 956 001 | |
TRIzol | Life Technologies | 15596-018 | |
High Capacity cDNA Reverse Transcription Kit | Applied Biosystems | 4368813 | |
IQ Multiplex Powermix | BioRad | 1725849 | |
Accumax | Millipore | ||
Primers | Integrated DNA Technology | individually designed and ordered (see protocol for sequnces) | |
Anti-CD133 PE | Milenyl | 130-098-826 | Primer/probe sets are light sensitive |
CD117-Biotin | Miltenly | 130-098-570 | |
AntiBiotin-FITC | Miltenly | 130-098-796 | |
Paraformaldehyde | Sigma-Aldrich | P6148-1KG | Caution: Toxic. Always prepare in hood and make fresh. |
Trypsin | Life Technologies | 25300062 | |
MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) | Sigma-Aldrich | 25200-072 | |
EVOS Fl Epifluorescence and Transmitted Light Microscope | Advanced Microscopy Group | ||
Biorad CFX96 C1000 System | Biorad | ||
Beckman Coulter FC500 Flow Cytometer | Beckman Coulter | ||
Spectramax 340PC384 | Molecular Devices |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved