Se requiere una suscripción a JoVE para ver este contenido. Inicie sesión o comience su prueba gratuita.
Method Article
Las células madre del cáncer (CSC) están implicados en la recidiva del tumor debido a la quimio-resistencia. Hemos optimizado un protocolo para la selección y expansión de células madre cancerosas de líneas celulares de cáncer de ovario. Mediante el tratamiento de las células con el cisplatino quimioterapia y cultivar en una célula madre promoción de los medios de comunicación que enriquecen las culturas CSC no adherentes.
Células madre del cáncer (CSC) se definen como un subconjunto de ciclismo lento y células indiferenciadas que dividen asimétricamente para generar altamente proliferativa, invasiva, y las células tumorales quimiorresistentes. Por lo tanto, los CAC son una población de células atractivo para apuntar terapéuticamente. CSC se predice para contribuir a un número de tipos de tumores malignos, incluyendo las de la sangre, cerebro, pulmón, tracto gastrointestinal, próstata y ovario. Aislar y enriquecer una población de células tumorales de células madre cancerosas permitirá a los investigadores estudiar las propiedades, la genética, y la respuesta terapéutica de células madre cancerosas. Hemos generado un protocolo que enriquece de forma reproducible para los CSC de cáncer de ovario a partir de líneas celulares de cáncer de ovario (SKOV3 y OVCA429). Las líneas celulares se tratan con 20 M de cisplatino durante 3 días. Las células supervivientes son aislados y cultivados en un medio de células madre libre de suero que contiene citoquinas y factores de crecimiento. Se demuestra un enriquecimiento de estas células madre cancerosas purificadas mediante el análisis de las células aisladas para known marcadores de células madre Oct4, Nanog, y PROM1 (CD133) y la superficie celular expresión de CD177 y CD133. La exposición CSC incrementó chemoresistance. Este método para el aislamiento de células madre cancerosas es una herramienta útil para estudiar el papel de las células madre cancerosas en la quimiorresistencia y recidiva tumoral.
Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4.
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.
1. Cultivo Celular y Marcaje fluorescente de líneas celulares de cáncer de ovario
2. enriquecimiento de las células madre del cáncer
3. CSC Caracterización mediante análisis de expresión génica de marcadores de células madre
Oct-4-FAM | Cebador 1: 5'-CCCAAGGAATAGTCTGTAGAAGTG-3 ' |
Primer 2: 5'-TGCATGAGTCAGTGAACAGG-3 ' | |
FAM: 5'-CTTCCAAGC / ZEN / TGCCCACCTAACTTCT / 3IABkFQ -3 ' | |
Nanog-HEX | Cebador 1: 5'-CCTTCTGCGTCACACCATT-3 ' |
Primer 2: 5'-AACTCTCCAACATCCTGAACC-3 ' | |
Sonda HEX: 5'-CTGCCACCT / ZEN.CTTAGATTTCATTCTCTGGT / 3IABkFQ-3 ' | |
GAPDH con Cy5 | Cebador 1: 5'-TGTAGTTGAGGTCAATGAAGGG-3 ' |
Primer 2: 5'-ACATCGCTCAGACACCATG-3 ' | |
Sonda CY5: 5'-AAGGTCGGAGTCAACGGATTTGGTC / 3IABRQSP-3 ' | |
Nestin-FAM | Cebador 1: 5'-AGGACCTGAGCGATCTGG-3 ' |
Primer 2: 5'-CGTTGGAACAGAGGTTGGAG-3 ' | |
FAM: 5'-AACTTTTCA / ZEN / GTAGCCCGCAGCC / 3IABkFQ -3 ' | |
CD133-HEX | Cebador 1: 5'-ACTCTCTCCAACAATCCATTCC-3 ' |
Primer 2: 5'-AAACAATTCACCAGCAACGAG-3 ' | |
Sonda HEX: 5'-ACAATCACT / ZEN / GAGCACTCTATACCAAAGCG / 3IABkFQ-3 |
Cuadro 1 Primers utilizados para la caracterización CSC por QRT-PCR.
e_title "> 4. CSC Análisis de Superficie Celular marcadores CD117 y CD1335. Analizando CSC para la respuesta terapéutica
Para demostrar que se aislaron células madre cancerosas a partir de líneas celulares de cáncer de ovario epitelial utilizando el tratamiento con cisplatino, primero adquirimos imágenes de las líneas de células antes del tratamiento y después de la selección. Se utilizó microscopía de luz para capturar imágenes de adherente (no tratada) SKOV3 y OVCA429 células y SKOV3 y OVCA429 CSC (Figura 1). CSC aparecen redonda y no unido a las placas de cultivo de tejido (Figuras 1 y
CSC que son resistentes a la terapia pueden ser responsables de la recaída después del tratamiento del tumor primario. Caracterización de las CSC puede conducir a mejores tratamientos para el cáncer de ovario. Los parámetros críticos en el establecimiento de las CSC quimiorresistentes utilizando el protocolo anterior son los plazos de la duración del tratamiento con quimioterapia y la concentración de la quimioterapia. Cuando se utiliza el protocolo de Ma et al. se encontró que después de 7 días de t...
The authors declare they have no competing financial interest.
Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.
Name | Company | Catalog Number | Comments |
McCoy | Life Technologies | 16600-108 | Warm to 37 °C prior to use |
DMEM / F12 serum free | Life Technologies | 11320-033 | Warm to 37 °C prior to use |
Minimal Essential Media | Life Technologies | 42360032 | Warm to 37 °C prior to use |
Sodium pyruvate | Life Technologies | 11360070 | |
Polybrene | Millipore | TR-1003-G | |
Blasticidin | Life Technologies | R21001 | |
Fetal Bovine Serum | Atlas Biologicals | F-0500-A | |
Penicillin-streptomycin | Life Technologies | 15070-063 | |
Cisplatin | Sigma-Aldrich | T7402-5MG | Caution: Toxic. Use precautions |
pLenti-suCMV-Rsv | Gentarget | LVP023 | BSL2 approval needed |
Insulin | Sigma-Aldrich | I-1882 | |
Human Recombinant EGF | Cell Signaling Technology | 8916LC | |
bFGF | BD biosciences | 354060 | |
LIF | Santa Cruz | sc-4988A | |
Bovine Serum Albumin | Roche | 03 116 956 001 | |
TRIzol | Life Technologies | 15596-018 | |
High Capacity cDNA Reverse Transcription Kit | Applied Biosystems | 4368813 | |
IQ Multiplex Powermix | BioRad | 1725849 | |
Accumax | Millipore | ||
Primers | Integrated DNA Technology | individually designed and ordered (see protocol for sequnces) | |
Anti-CD133 PE | Milenyl | 130-098-826 | Primer/probe sets are light sensitive |
CD117-Biotin | Miltenly | 130-098-570 | |
AntiBiotin-FITC | Miltenly | 130-098-796 | |
Paraformaldehyde | Sigma-Aldrich | P6148-1KG | Caution: Toxic. Always prepare in hood and make fresh. |
Trypsin | Life Technologies | 25300062 | |
MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) | Sigma-Aldrich | 25200-072 | |
EVOS Fl Epifluorescence and Transmitted Light Microscope | Advanced Microscopy Group | ||
Biorad CFX96 C1000 System | Biorad | ||
Beckman Coulter FC500 Flow Cytometer | Beckman Coulter | ||
Spectramax 340PC384 | Molecular Devices |
Solicitar permiso para reutilizar el texto o las figuras de este JoVE artículos
Solicitar permisoThis article has been published
Video Coming Soon
ACERCA DE JoVE
Copyright © 2025 MyJoVE Corporation. Todos los derechos reservados