This work was supported by a Brain Research Foundation Seed Grant (BRFSG-2014-02) to Helen Bateup. Dirk Hockemeyer is a New Scholar in Aging of the Ellison Medical Foundation and is supported by the Glenn Foundation as well as the The Shurl and Kay Curci Foundation. DH is also supported by NIH grant 1R01CA196884-01.

The procedures described in this manuscript were reviewed and approved by the UC Berkeley Stem Cell Research Oversight Committee.
1. Prepare Stem Cells for Editing
<ol>
	<li>Grow and culture human pluripotent stem cells (hPSCs) on a 6-well plate containing 2.4 &#215; 106 cells/plate of mitomycin C-inactivated mouse embryonic fibroblast (MEF) feeders grown on gelatin 32. Maintain hPSCs in 3 ml of human embryonic stem cell media per well (hESC media) and grow in a 37 &#176;C incubator with 3% O2/5% CO2. 
	Note: For the success of this protocol, it is not necessary to maintain hPSCs in a low-oxygen incubator; however it is important to note that hPSCs proliferate faster in a high O2 environment, so times and cell numbers should be adjusted accordingly. It should also be noted that hPSCs maintained in low oxygen have lower rates of spontaneous differentiation 33.
	<ol>
		<li>To make 500 ml hESC media combine 380 ml DMEM/F12, 75 ml Fetal Bovine Serum (FBS), 25 ml KnockOut Serum Replacement (KSR). Add Glutamine (1 mM final concentration), 5 ml 100x Non-essential Amino Acids, 100 units/ml Penicillin-Streptomycin (P/S), basic Fibroblast Growth Factor (bFGF) (4 ng/ml final concentration), and 2-mercaptoethanol (5.5 &#181;M final concentration).</li>
	</ol>
	</li>
	<li>Change media by removing entire volume of media (3 ml) using a glass pipette and vacuum. Replace with 3 ml warm hESC media using a serological pipette. Repeat media change every day until hPSCs are approximately 50% confluent (Day -1).</li>
	<li>One day before targeting (Day -1), change hESC media, removing the old media and adding warm hESC media supplemented with 10 &#181;M Y-27632.</li>
	<li>Also on Day -1, prepare one to two 6-well or 10 cm plates of drug resistant MEF feeder cells from DR4 mice (2.4 &#215; 106 cells/plate) 34. 
	Note: In general, 6 well plates are advantageous over 10 cm plates, as they accommodate more media. 6 well plates also ensure that different clones from different wells are independent. However, a 10 cm plate will allow easier picking, depending on the microscope available for this process.</li>
</ol>
2. Editing Pluripotent Stem Cells
<ol>
	<li>Prepare transfection solutions by pipetting 5 &#181;g each of ZFN 1 and 2, TALEN 1 and 2, or 15 &#181;g of the CRISPR/Cas9 px330 encoding plasmid (Figure 1) into a 1.5 ml tube. Pipette 30 &#181;g of the repair plasmid into this tube as well. Finally, pipette 1x Phosphate Buffered Saline (PBS) into the tube to bring the volume up to 300 &#181;l. 
	Note: Prepare plasmids as a midiprep (any kit is suitable) with a minimum concentration of 300 ng/&#181;l in order to keep the total volume of the transfection solution under 300 &#181;l. It is not necessary to perform phenol/chloroform extraction, to linearize the plasmid, or to use an endotoxin free plasmid prep kit.</li>
	<li>Remove media from hPSCs using a glass pipette and vacuum. Pipette 2 ml warm 1x PBS into each well to wash the cells.</li>
	<li>Remove the PBS immediately using a glass pipette and vacuum. Add 0.5 ml 0.25% Trypsin-EDTA solution directly onto cells in each well. Place in the incubator (37 &#176;C/5% CO2/3% O2) for approximately 10 min. or until feeder layer starts to lift off the plate.</li>
	<li>Add 2 ml warm esWash media (470 ml DMEM/F12, 25 ml FBS, 100 units/ml P/S) to each well to stop the trypsin reaction.</li>
	<li>Ensure that feeder cells come off as a sheet. Pipette the contents of each well into a single 50 ml conical tube, combining all wells. Triturate cells using a 10 ml serological pipette. It is not necessary to break up the feeder layer; hPSCs will come off of the feeder layer by gentle trituration. There should be about 15 ml of the cell suspension.</li>
	<li>Add 25 ml of esWash media to the tube to bring the volume up to 40 ml total. Allow large feeder chunks to settle at the bottom of tube for 1-2 min. Remove the supernatant (~38 ml) from the tube using a serological pipette and deposit into a new 50 ml conical tube.</li>
	<li>Spin down for 5 min at 190 x g. Remove the supernatant from the tube using a glass pipette and vacuum. Be sure to not disturb the cell pellet. Resuspend the cells in 500 &#181;l 1x PBS. Combine with plasmid transfection solution prepared earlier. Count the cells at this step. Use 5-10 million cells per electroporation.</li>
	<li>Pipette the entire 800 &#181;l suspension into a 4 mm electroporation cuvette, place on ice for 3-5 min. Electroporate cells using the exponential program on the electroporation system with the following parameters: 250 V, 500 &#181;F, &#8734; resistance, and 4 mm cuvette size. After electroporation, place cuvette back on ice for 3 min. 
	Note: Observe the time constant of the electroporation on the electroporation system. The time constant varies with cell number and DNA purity. Successful transfections usually have a time constant between 10-14 msec when using the listed conditions and a gene pulser II. Lower electroporation efficiencies can occur when time constants varies from these values.</li>
	<li>Resuspend electroporated cells in 18 ml warm hESC Media supplemented with 10 &#181;M Y-27632. Plate 3 ml of this single cell suspension into each well of a 6 well plate with DR4 feeder cells. Return to incubator (37 &#176;C/5% CO2/3% O2).</li>
</ol>
3. Selection of Positive Colonies
<ol>
	<li>Day 2, remove all media using a glass pipette and vacuum. Replace with 3 ml of warm hESC media supplemented with 10 &#181;M Y-27632. Day 3, remove all media using a glass pipette and vacuum. Replace with 3 ml of warm hESC media without including Y-27632. Day 4, remove all media using a glass pipette and vacuum. Replace with 3 ml warm hESC media supplemented with antibiotics for selection. Return to incubator (37 &#176;C/5% CO2/3% O2). 
	Note: The type of antibiotic used will depend on the resistance cassette included in the repair template. When working with WIBR#3 hPSCs (NIH registry 0079), 0.5 &#181;g/ml puromycin, 70 &#181;g/ml G418 (geneticin), and 35 &#181;g/ml hygromycin have been used successfully. Concentrations for selection should be determined empirically by establishing the minimal concentration of antibiotic needed to kill wild-type cells within approximately one week.</li>
	<li>Days 5-12, change media daily, replacing old media each time with warm hESC media supplemented with antibiotics. 
	Note: Expect a large amount of cell death. Individual colonies will become apparent around day 8-10. Regular hESC media without antibiotics can be used after 12-14 days of continuous selection. If cell density is high or cell death is slow, acidification of the media should be avoided and it may be necessary to increase the media volume (up to 4-5 ml) during the first few days of selection.</li>
</ol>
4. Picking Selected Colonies (Day 12-14)
<ol>
	<li>Observe colonies on day 12-14. Observe the colonies that are ready to pick on a dissection microscope and ensure that they do not contain cells that are starting to differentiate. The approximate size should be 800-1,200 &#181;M. If colonies reach this size before day 12, it is recommended that they should be picked then. 
	Note: For each targeting experiment, pick as many colonies as necessary to ensure the desired genotype is isolated. As an example, AAVS1 editing with the AAV-CAGGS-EGFP repair template has shown consistently robust integration, and requires only 12-24 colonies to be picked to obtain approximately 5-10 heterozygously targeted clones. Other targeting experiments may require more colonies to be picked (Table 1). The frequency of correct targeting events depends on factors such as the efficiency of the SSN to introduce a DSB, the size of insert, and the selection strategy. In the case of the gene trap approach for the AAVS1 locus presented here, the selection marker is only expressed when correctly integrated at the target site, reducing the number of colonies required to obtain a properly targeted clone.</li>
	<li>One day before picking, prepare 12-well plates of MEFs (2.4 &#215; 106 cells/plate, one well will be used for each colony picked).</li>
	<li>On the day of picking, remove all media from the 12 well MEF plates using a glass pipette and vacuum and replace with 1 ml hESC media. Also on day of picking, change hESC media on the 6 well plates that are going to be picked.</li>
	<li>Pull glass pipettes for mechanical dissociation of individual colonies from the feeder layer. Lower the pipettes over an in-hood Bunsen burner and softened at the expansion point until glass is malleable. Quickly remove from flame and pull the pipette apart creating an angular point. Break the point approximately 2 cm from the bent axis, leaving a narrow channel. Polish the end of the channel by exposing to flame for 1-2 sec. 
	Note: Optionally pick colonies a p20 pipet tip, however, this may reduce the clonality of the culture, as the dull tip may dislodge greater amounts of cells from each colony into the media, potentially contaminating subsequent pickings.</li>
	<li>Assemble picking device by taking a p1000 filter pipette tip and attaching a suction bulb to the narrow end. Insert the pulled glass pipette in the wide end.</li>
	<li>Place a 6-well plate of hPSCs to be picked on the stage of a dissection microscope mounted in a tissue culture hood. Compress the bulb of the picking device and gently excise and cut an individual colony into 10-20 equally sized pieces, taking care not to release pieces into the media. Take excised hPSC pieces of the colony into the pipette by releasing the bulb. Try to take as little media as possible while transferring.</li>
	<li>Transfer the individual colony to a single well of a 12-well MEF plate, compressing the bulb again directly into the well, releasing the now broken colony. Label each well to allow unique identification of single-cell derived clones. Repeat for as many colonies as necessary, changing the glass pipette each time. 
	Note: Picking colonies may take some time to learn. It is recommended that the experimenter practice on some control cells before trying to isolate targeted colonies.</li>
	<li>Return 12 well plates to the incubator (37 &#176;C/3% O2/5% CO2), gently rocking the plate first to avoid accumulation of cells in the middle of each well.</li>
	<li>The next day and each subsequent day, remove full volume of media using a glass pipette and vacuum and replace with 1.5 ml of warm hESC media until cells are about 50% confluent (this usually takes 10-12 days).</li>
	<li>After 10-12 days, pick one to two colonies from each well and transfer to new 12-well MEF plates repeating steps 4.1-4.8 to generate a replica plate.</li>
	<li>Extract DNA (see below) from the remaining colonies in each well of the original MEF plates.
	<ol>
		<li>Remove media from all wells using a glass pipette and vacuum. Pipette 1 ml 1x PBS onto each well to wash cells. Remove PBS using glass pipette and vacuum. Pipette 250 &#181;l of cell lysis buffer (final concentrations in H2O: 10 mM Tris HCl, 5 mM EDTA, 0.2% SDS, 200 mM NaCl, 0.08 mg/ml Proteinase-K) onto each well. Place in incubator (37 &#176;C/3% O2/5% CO2) O/N.</li>
		<li>The next day, pipette contents of each well into individual 1.5 ml tubes. Pipette 250 &#181;l of isopropyl alcohol into each tube to precipitate the DNA. Shake tube vigorously. A white precipitate should be visible.</li>
		<li>Spin each tube down for 3 min at 13,000 rpm in a table top centrifuge. After spin down, discard supernatant by decanting into liquid waste. A small DNA pellet should remain stuck to the bottom of the tube. Pipette 250 &#181;l of 70% ethanol into each tube to wash the DNA pellet. Shake vigorously. Spin each tube down for 3 min at 13,000 rpm in a table top centrifuge.</li>
		<li>After spinning down, discard supernatant by decanting into liquid waste. A small DNA pellet should remain stuck to the bottom of the tube. Pipette out the remainder of the supernatant so there is no liquid left in the tube. Leave tube open to dry on benchtop for 5-10 min. After drying, resuspend DNA in 250 &#181;l TE buffer. Place at 37 &#176;C for 6 hr to allow DNA to dissolve.</li>
	</ol>
	</li>
	<li>Genotype each sample using a pre-optimized PCR or southern blot strategy. 
	Note: For AAVS1 targeting using the AAV-CAGGS-EGFP repair template, the southern blot strategy can be found in Hockemeyer et al., 2009 4. A comprehensive southern blotting protocol can be found in Southern, 2006 35. For multiplex PCR genotyping of the same experiment, primers and conditions can be found in Table 2 36.</li>
	<li>Discard wells that are not properly targeted and continue changing hESC media on properly targeted cells every day. Freeze down the cells when they are approximately 50% confluent, see below for freezing protocol.
	<ol>
		<li>One day before freezing, change hESC media, removing the old media and adding warm hESC media supplemented with 10 &#181;M Y-27632.</li>
		<li>On the day of freezing prepare 0.5 ml each of solution A and solution B per well of a 12-well plate that is being frozen down in two 15 ml conical tubes. Place solutions on ice. Solution A: 50% hESC media and 50% FBS; Solution B: 80% FBS and 20% Dimethyl Sulfoxide (DMSO).</li>
		<li>Dissociate hPSC colonies into single cells before freezing. Follow steps 2.2-2.8 to do this, scaling volumes accordingly. Fully resuspend cell pellet in 0.5 ml of solution A.</li>
		<li>Add 0.5 ml solution B to cell suspension, pipette up and down to make cell suspension homogenous. Take the total volume of the cell suspension (~1 ml) and deposit into a 2 ml cryotube. Screw cap on tightly.</li>
		<li>Place cryotube in a -80 &#176;C freezer O/N. The day after freezing, remove frozen cells from -80 &#176;C freezer and immediately place into liquid nitrogen tank for long-term storage.</li>
	</ol>
	</li>
</ol>

The authors declare no competing financial interests.

The method presented here for isolating homogenous populations of gene-edited human pluripotent stem cells is a powerful approach for generating isogenic hPSC lines that differ only at the targeted locus. These cells are an ideal system for probing the mechanisms of human cellular differentiation and development as well as for understanding the pathophysiology of monogenic diseases in a controlled genetic setting. As demonstrated here, it is possible to use three independent SSN design strategies (ZFNs, TALENs, and CRISPR/Cas9) to achieve targeted integration at the AAVS1 locus. Each of these methodologies has its own advantages and disadvantages. A potential advantage of ZFNs and, to some extent, TALENs is their design flexibility, which allows iterative engineering in order to improve the DNA binding domains of individual nucleases 42. This nuclease optimization could increase the specificity of ZFNs and TALENs beyond what is achievable with the CRISPR/Cas9 system. Such selectivity may be important for clinical applications requiring a high degree of target specificity. The primary advantage of the CRISPR/Cas9 system is its ease of use. Although TALEN and ZFN construction kits have been made available to the public (i.e., through Addgene 21), CRISPR/Cas9-based SSNs are significantly easier to construct, as the only necessary customization is a 20 base pair oligonucleotide (when using the px330 plasmid design 14). This simplicity proves to be advantageous for research labs looking to include genome editing in their studies.
There are alternative transfection techniques, including nucleofection 43, to create gene-edited hPSC lines; however electroporation has been shown to be consistent and cost effective 4,5,25. Nucleofection can be used to directly transfect Cas9-guide RNA ribonucleoprotein complexes into the nucleus, increasing the SSN efficiency and fidelity 44. Growing hPSCs on MEFs is a robust and inexpensive method to maintain hPSCs in a pluripotent state without excessive differentiation. In addition, it allows for the easy isolation of genetically identical colonies. Alternatively, it is possible to culture hPSCs without MEFs, however these culture conditions can be more expensive than feeder based cultures. Furthermore, the whole process is scalable, allowing for the isolation of very rare editing events or the generation of many distinct cell lines in parallel editing experiments.
The protocol described here is robust; however there are several key steps that affect the efficiency with which correctly edited clones can be obtained. The most critical component for this method is having high quality MEFs and drug resistant DR4 MEFs. The survival of single hPSCs is tenuous, and low-quality MEFs will impede the isolation of undifferentiated hPSC lines. Second, the use of Y-27632 is also key to allow single cell survival without generating a selective pressure for cells with an abnormal karyotype 45. Third, picking well-spaced colonies ensures genetic homogeneity of the derived cell lines. Finally, it is important to prepare glass pipettes so that the opening is small enough to break the colony into many smaller pieces, ensuring that multiple colonies will grow in the new well. This permits the picking of well-spaced subclones for a replica plate to have in culture, leaving the original plate of isolated colonies for genotyping. A challenging part in this protocol is the manual pulling of the glass pipettes; this should be practiced beforehand. It should be noted that there are multiple techniques of clone picking that do not require a glass pipette. Experimenters are encouraged to find the one that works best for them.
There are limitations to this protocol that can be overcome by simple modifications. An experiment intended to only disrupt the locus of interest without repair or one whose repair template does not contain a selection cassette, must use another method of enriching for cells that were edited. Note that the number of colonies that must be picked to find a positive clone increases greatly in the absence of selection. One strategy to improve the efficiency is to co-transfect a non-integrating plasmid that expresses a fluorescent protein. After allowing the cells to recover for two days, targeted cells can be sorted on positive fluorescence using fluorescence-activated cell sorting and replated 29. This process enriches for cells that have been transfected with the plasmids by electroporation and thereby increases the probability of a concurrent editing event in the cell.
The techniques described here can be extended to use multiple guide RNAs to simultaneously target several loci 14,46,47. Many protocols have been established to differentiate hPSCs into distinct cell types, allowing various genetic manipulations in cell types of interest 30. Overall, we have demonstrated the potential for efficient genome editing in hPSCs regardless of SSN choice. We propose that this technique can be adapted to create isogenic hPSC lines that have been gene-edited at any genomic locus.

Genome editing technologies are rapidly evolving into standard tools for molecular and cell biology 1. Genetic engineering of human pluripotent stem cells (hPSCs) is of particular interest as hPSCs represent a self-renewing source of genetically intact primary human cells. hPSCs can be differentiated into various cell types for disease modeling or as a source for transplantation therapies 2,3. Demonstrated here is a protocol that utilizes three different types of site-specific nucleases (SSNs) in conjunction with endogenous DNA repair mechanisms for targeted integration of a reporter construct at the AAVS1 locus. After transfection of SSNs into hPSCs, we demonstrate how to isolate isogenic cell populations harboring the reporter.
The ability to manipulate genomes, specifically pluripotent stem cell genomes, using SSNs is not a new phenomenon as the utility of zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) for gene editing was demonstrated several years ago 4-10. However, with the advent of S. pyogenes CRISPR/Cas9 technology 11-13, gene editing has become widely accessible 14. All SSNs introduce a double stranded DNA break (DSB) at the specified target site 1,4,5,11 that is repaired by endogenous cellular mechanisms using either non-homologous end-joining (NHEJ) or homology directed repair (HDR) 15. NHEJ is error-prone and can introduce frame shift mutations resulting in loss of gene function, while HDR allows for novel elements to be introduced through the co-transfection of a repair template with the SSN. While the underlying principles of DNA repair that facilitate gene editing are thought to be largely the same for each SSN, some differences between the platforms can be noted. De novo design of ZFNs allows flexibility and nuclease optimization 16, however the use of publicly available assembly libraries and screening tools to design individual ZFNs can be time consuming. Once the desired locus for ZFN-mediated targeting is determined, ZFN pairs can be designed with the online tool ZiFit 17. After design, ZFNs can be modularly assembled through several rounds of plasmid cloning 18. Alternatively, there are many commercially available, pre-validated ZFNs 19. TALE nucleases can also be designed using online tools and publically available components 17,20. For example, TALENs can be rapidly assembled from blocks of five TALE repeats, through FLASH assembly 21 or using PCR based hierarchical Golden Gate assembly 22. Ease of SSN design and speed of construction using CRISPR/Cas9 have made genome editing a widely accessible tool. The short guide RNA-mediated targeting of CRISPR/Cas9 also allows for multiplexing of guide RNAs to target several loci with a single construct 14. The design of Cas9 for gene editing requires only the identification of a protospacer adjacent motif (PAM; an NGG trinucleotide for S. pyrogenes Cas9) proximal to the target locus. By inserting an oligonucleotide corresponding to the 20 base pairs 5&#39; of the PAM into the px330 plasmid 14, the construct can be assembled in one cloning step. In addition to S. pyogenes Cas9, Cas9 from N. meningitidis (NmCas9) that recognizes a 5&#8242;-NNNNGATT-3&#8242; (PAM) has been shown to allow for efficient gene-editing in hPSCs 23.
In addition to the differences in ease of SSN design, each platform has specific properties. For example, ZFNs and TALENs utilize the FokI nuclease domain, which generates a four nucleotide 5&#39; overhang 24 while Cas9 is thought to generate mostly blunt ended DSBs. ZFNs, TALENs, and Cas9 differ in their protein stabilities, on-off rate on target DNA, and mode of DNA scanning, all of which could theoretically result in small differences in the editing outcome 1. While further studies will be required to fully understand the consequences of these differences, we describe here a protocol that is highly robust across all three platforms and can be used to readily generate genetically modified hPSCs.
Regardless of SSN choice, electroporation is a robust procedure to transfect SSNs and homology repair templates into hPSCs 25. The number of surviving colonies after selection for antibiotic resistance depends on locus-specific parameters and the editing strategy (e.g., size of transgenic insert and mode of selection). The protocol described here usually results in about 150-400 single-cell derived colonies.
Gene-editing at the AAVS1 locus using this protocol has previously been used to demonstrate the effectiveness of SSNs 4,5. The AAV-CAGGS-EGFP repair template uses a gene trap strategy to confer puromycin resistance in a locus specific manner. Briefly, the repair template contains a splice acceptor site upstream of the promoterless puromycin resistance cassette. Upon correct integration into the first intron of the PPP1R12C gene at the AAVS1 locus, the resistance cassette is expressed from the edited gene&#39;s promoter. The robustness of this specific AAVS1 assay allows us to compare the efficiency of each SSN platform.
Gene editing using SSNs is powerful given the ability to disrupt and/or alter theoretically any gene. Applying this strategy to hPSCs provides versatility as hPSCs can be subsequently differentiated into a multitude of human cell types such as neurons 26, hepatocytes 27, and cardiomyocytes 28. Additionally, the use of patient-derived induced pluripotent stem cells allows the repair or introduction of known disease-causing mutations in a patient-specific genetic background 29, providing a platform from which to investigate disease mechanisms and test therapeutics using a patient&#39;s own cells 30. In summary, gene editing in hPSCs is an efficient and versatile approach for investigating the basic biology of human development and disease 31.

<table><tbody><tr><td>DMEM/F12</td><td>Life Technologies</td><td>11320082</td><td></td></tr><tr><td>Fetal Bovine Serum (HI)</td><td>Life Technologies</td><td>10082-147</td><td></td></tr><tr><td>Knockout Serum</td><td>Life Technologies</td><td>10828-028</td><td></td></tr><tr><td>Fibroblast Growth Factor - basic</td><td>Life Technologies</td><td>PHG0261</td><td></td></tr><tr><td>Pen/Strep</td><td>Life Technologies</td><td>15140-122</td><td></td></tr><tr><td>Glutamine</td><td>Life Technologies</td><td>25030-081</td><td></td></tr><tr><td>MEM NEAA</td><td>Life Technologies</td><td>11140-050</td><td></td></tr><tr><td>2-mercaptoethanol</td><td>Life Technologies</td><td>21985-023</td><td></td></tr><tr><td>Y-27632</td><td>Calbiochem</td><td>688000</td><td></td></tr><tr><td>6-well plates</td><td>Corning</td><td>3506</td><td></td></tr><tr><td>12-well plates</td><td>Corning</td><td>3512</td><td></td></tr><tr><td>4 mm Electroporation cuvettes</td><td>Bio-rad</td><td>165-2081</td><td></td></tr><tr><td>X-cel gene pulser II</td><td>Bio-rad</td><td>165-2661</td><td></td></tr><tr><td>0.25% Trypsin-EDTA</td><td>Life Technologies</td><td>25200-056</td><td></td></tr><tr><td>10&amp;times; Phosphate buffered saline (PBS) pH7.4&amp;nbsp;</td><td>Life Technologies</td><td>70011-044</td><td></td></tr><tr><td>Puromycin</td><td>Life Technologies</td><td>A11138-02</td><td></td></tr><tr><td>Pasteur pipettes, plugged</td><td>VWR</td><td>14672-412</td><td></td></tr><tr><td>Tris-HCl</td><td>Sigma-Aldrich</td><td>S5941</td><td></td></tr><tr><td>NaCl</td><td>Sigma-Aldrich</td><td>S9888</td><td></td></tr><tr><td>SDS</td><td>Sigma-Aldrich</td><td>L3771</td><td></td></tr><tr><td>EDTA</td><td>Sigma-Aldrich</td><td>E5134</td><td></td></tr><tr><td>Proteinase-K</td><td>Life Technologies</td><td>AM2544</td><td></td></tr><tr><td>Ethanol</td><td>VWR</td><td>TX89125-172SFU</td><td></td></tr><tr><td>Isopropyl Alcohol</td><td>VWR</td><td>MK303216</td><td></td></tr><tr><td>TE Buffer</td><td>Life Technologies</td><td>12090-015</td><td></td></tr><tr><td>Dimethyl Sulfoxide (DMSO)</td><td>Sigma-Aldrich</td><td>D8418</td><td></td></tr><tr><td>1.8 ml Cryotubes</td><td>ThermoScientific</td><td>377267</td><td></td></tr></tbody></table>

establishment of genome-edited human pluripotent stem cell lines: from targeting to isolation

Genome-editing of human pluripotent stem cells (hPSCs) provides a genetically controlled and clinically relevant platform from which to understand human development and investigate the pathophysiology of disease. By employing site-specific nucleases (SSNs) for genome editing, the rapid derivation of new hPSC lines harboring specific genetic alterations in an otherwise isogenic setting becomes possible. Zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 are the most commonly used SSNs. All of these nucleases function by introducing a double stranded DNA break at a specified site, thereby promoting precise gene editing at a genomic locus. SSN-meditated genome editing exploits two of the cell&#39;s endogenous DNA repair mechanisms, non-homologous end joining (NHEJ) and homology directed repair (HDR), to either introduce insertion/deletion mutations or alter the genome using a homologous repair template at the site of the double stranded break. Electroporation of hPSCs is an efficient means of transfecting SSNs and repair templates that incorporate transgenes such as fluorescent reporters and antibiotic resistance cassettes. After electroporation, it is possible to isolate only those hPSCs that incorporated the repair construct by selecting for antibiotic resistance. Mechanically separating hPSC colonies and confirming proper integration at the target site through genotyping allows for the isolation of correctly targeted and genetically homogeneous cell lines. The validity of this protocol is demonstrated here by using all three SSN platforms to incorporate EGFP and a puromycin resistance construct into the AAVS1 safe harbor locus in human pluripotent&#160;stem cells.

Here we demonstrate a protocol compatible with three different SSN platforms to create genetically engineered hPSC lines. We targeted WIBR#3 human embryonic stem cells at the AAVS1 locus using previously published ZFNs 4, TALENs 5 and CRISPR/Cas9s 37 using a repair template that introduces an EGFP reporter and a puromycin resistance cassette 4.
We cultured our hPSCs on MEFs for a cell culture workflow permitting the maintenance and expansion of undifferentiated hPSCs (Figure 2), that is also cost effective and scalable. If cells are grown longer than necessary there is a risk of increased differentiation, reducing the number of pluripotent cells that are transfected and consequently the number of correctly targeted hPSC colonies obtained.
We electroporated 5.0 x 106 cells per SSN platform and plated the cells from each targeting onto a single 6 well plate of DR4 MEFs. After selection, each platform resulted in EGFP-positive colonies (Figure 3) and a combination of untargeted, homozygously targeted and heterozygously targeted clones (Figure&#160;4A,B; Table 3). Under the conditions presented here, we find that the AAVS1 TALENs resulted in the most EGFP-positive clones. The repair template used for this experiment consists of a splice acceptor site upstream of the EGFP reporter and puromycin resistance cassette. Using this &#34;gene-trap&#34; strategy (Figure 1), the construct should insert into the first intron of the AAVS1 locus, using the endogenous promoter to drive expression of the puromycin-resistance cassette. The lack of a promoter driving the expression of the puromycin resistance gene within the repair template should prevent expression in the event of random integration.
Therefore, we expect that all puromycin-resistant clones would be targeted at the AAVS1 site. It should be noted that a subset of clones carry aberrant integrations in the AAVS1 locus that are detectable by Southern blot using an internal probe, but not by most PCR strategies (Figure 1; Figure 4C) 4. These integration events are most likely the result of heterologous targeting events leading to multiple integrations of the donor plasmid 4. We picked 24 colonies from each SSN experiment and found that all platforms had very high targeting efficiencies and showed only minimal differences. As interrogated by PCR, CRISPR/Cas9 yielded the most correctly targeted clones while the TALEN platform had the most homozygously targeted clones (Table 3).
<img alt="Figure 1" src="/files/ftp_upload/53583/53583fig1highres.jpg" width="700" /> 
Figure 1. Schematic of gene edited AAVS1 locus using the AAV-CAGGS-EGFP repair template. Modified from Hockemeyer et al., 2009. <a href="https://www.jove.com/files/ftp_upload/53583/53583fig1highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/53583/53583fig2highres.jpg" width="700" /> 
Figure 2. Colonies of WIBR#3 cells. Representative bright field images of colonies of WIBR#3 human embryonic stem cells prior to targeting. Note the lack of differentiation and the clear separation from the feeder layer in an ideal colony (left) as opposed to a non-ideal one (right). <a href="https://www.jove.com/files/ftp_upload/53583/53583fig2highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/53583/53583fig3highres.jpg" width="700" /> 
Figure 3. EGFP-positive WIBR#3 cells. Representative images of WIBR#3 cells targeted with an EGFP-expressing repair template at the AAVS1 locus. Images of representative colonies edited with ZFNs, TALENs and CRISPR/Cas9 are shown. <a href="https://www.jove.com/files/ftp_upload/53583/53583fig3highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/53583/53583fig4highres.jpg" width="700" /> 
Figure 4. Genotyping strategies to confirm correct targeting.&#160;(A) Representative PCR genotyping results showing untargeted, heterozygous and homozygous targeted clones across the three SSN platforms. WT CTL=wild-type control. (B) Representative Southern blot results showing a heterozygous targeted clone and a homozygous targeted clone detected with a 3&#39; external probe. Fragment sizes: WT-6.5 kb, Edited-6.9 kb. (C) Representative Southern blot results showing a properly edited clone and a heterozygous clone with a non-random double-integration. Fragment sizes: Properly edited-6.9 kb, aberrant additional integration-5 kb. <a href="https://www.jove.com/files/ftp_upload/53583/53583fig4highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Study</td>
			<td>Gene Targeted</td>
			<td>Platform</td>
			<td>Repair template type</td>
			<td># of clones picked</td>
			<td>Targeting efficiency</td>
		</tr>
		<tr>
			<td>Sexton et al., 2014</td>
			<td>TPP1</td>
			<td>ZFN</td>
			<td>GFP-Puro</td>
			<td>unreported</td>
			<td>unreported</td>
		</tr>
		<tr>
			<td>Sexton et al., 2014</td>
			<td>TERT</td>
			<td>ZFN</td>
			<td>Hygromycin</td>
			<td>unreported</td>
			<td>unreported</td>
		</tr>
		<tr>
			<td>Hockemeyer et al., 2009</td>
			<td>POU5F1</td>
			<td>ZFN</td>
			<td>GFP-Puro</td>
			<td>31</td>
			<td>39.0%</td>
		</tr>
		<tr>
			<td>Hockemeyer et al., 2009</td>
			<td>PITX3</td>
			<td>ZFN</td>
			<td>GFP-Puro</td>
			<td>74</td>
			<td>14.9%</td>
		</tr>
		<tr>
			<td>Hockemeyer et al., 2011</td>
			<td>POU5F1</td>
			<td>TALEN</td>
			<td>GFP-Puro</td>
			<td>68</td>
			<td>91.0%</td>
		</tr>
		<tr>
			<td>Hockemeyer et al., 2011</td>
			<td>PITX3</td>
			<td>TALEN</td>
			<td>GFP-Puro</td>
			<td>96</td>
			<td>13.0%</td>
		</tr>
		<tr>
			<td>Merkle et al., 2015</td>
			<td>VASA</td>
			<td>Cas9</td>
			<td>Reporter-Geneticin</td>
			<td>139</td>
			<td>94.0%</td>
		</tr>
		<tr>
			<td>Merkle et al., 2015</td>
			<td>CRH</td>
			<td>Cas9</td>
			<td>Reporter-Geneticin</td>
			<td>30</td>
			<td>93.0%</td>
		</tr>
		<tr>
			<td>Merkle et al., 2015</td>
			<td>HCRT</td>
			<td>Cas9</td>
			<td>Reporter-Geneticin</td>
			<td>154</td>
			<td>92.0%</td>
		</tr>
		<tr>
			<td>Merkle et al., 2015</td>
			<td>HMX2</td>
			<td>Cas9</td>
			<td>Reporter-Geneticin</td>
			<td>11</td>
			<td>45.0%</td>
		</tr>
		<tr>
			<td>Forster et al., 2014</td>
			<td>LRG5-Nterm</td>
			<td>ZFN</td>
			<td>GFP-Puro</td>
			<td>unreported</td>
			<td>30.0%</td>
		</tr>
		<tr>
			<td>Forster et al., 2014</td>
			<td>LRG5-Cterm</td>
			<td>ZFN</td>
			<td>GFP-Puro</td>
			<td>unreported</td>
			<td>14.0%</td>
		</tr>
		<tr>
			<td>Soldner et al., 2011</td>
			<td>SNCA</td>
			<td>ZFN</td>
			<td>Puro</td>
			<td>96</td>
			<td>1.0%</td>
		</tr>
	</tbody>
</table>

Table 1. Description of other genes targeted using this method, with corresponding targeting efficiencies taken from previously published studies. 4,5,38-41
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Locus</td>
			<td>Sequence</td>
			<td>Notes</td>
		</tr>
		<tr>
			<td>AAVS1-F primer</td>
			<td>CTCTAACGCTGCCGTCTCTC</td>
			<td>PCR conditions: Tm = 57 &#176;C, 35 cycles</td>
		</tr>
		<tr>
			<td>AAVS1-WT-R primer</td>
			<td>GCTTCTCCTCTTGGGAAGTG</td>
			<td>WT band: 1273 bp</td>
		</tr>
		<tr>
			<td>AAVS1-Targeted-R primer</td>
			<td>CGTCACCGCATGTTAGAAGA</td>
			<td>Targeted band: 992 bp</td>
		</tr>
		<tr>
			<td>T2-Cas9-guide</td>
			<td>GGGCCACTAGGGACAGGAT</td>
			<td>From Mali et al., 2013</td>
		</tr>
		<tr>
			<td>AAVS1-ZFN-Right</td>
			<td>TAGGGACAGGAT</td>
			<td>From Hockemeyer et al., 2009</td>
		</tr>
		<tr>
			<td>AAVS1-ZFN-Left</td>
			<td>TGGGGTGTCACC</td>
			<td>From Hockemeyer et al., 2009</td>
		</tr>
		<tr>
			<td>AAVS1-TALEN-Right</td>
			<td>TCCTAACCACTGTCTTT</td>
			<td>From Hockemeyer et al., 2011</td>
		</tr>
		<tr>
			<td>AAVS1-TALEN-Left</td>
			<td>CCCCTCCACCCCACAGT</td>
			<td>From Hockemeyer et al., 2011</td>
		</tr>
	</tbody>
</table>
Table 2. List of primers and SSN targeting sequences. 
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Targeting Construct</td>
			<td>Number of EGFP+ Colonies</td>
			<td>Targeted picked clones (PCR verified)</td>
			<td>Previous Reported Correct Targeting Efficiency (by Southern blot)</td>
		</tr>
		<tr>
			<td>ZFN</td>
			<td>150</td>
			<td>86.9% (73.9% het/ 13.0 % homo)</td>
			<td>56% (50% het/6% homo)</td>
		</tr>
		<tr>
			<td>TALEN</td>
			<td>412</td>
			<td>91.3% (47.8% het/39.1% homo)</td>
			<td>47% (37.5% het/9.3% homo)</td>
		</tr>
		<tr>
			<td>CRISPR-Cas9</td>
			<td>235</td>
			<td>95.7 % (69.5% het/26.3% homo)</td>
			<td>unreported</td>
		</tr>
	</tbody>
</table>
Table 3. Comparative numbers of EGFP-positive and targeted TALEN, ZFN and CRISPR/Cas9 human stem cell colonies. PCR verified integrations at the AAVS1 locus for this experiment are compared to Southern blot verified proper single integrations in previous experiments 4,5.

Watch this Scientific Journal Video about Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation at JoVE.com

Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation

Genome editing of human pluripotent stem cells (hPSCs) can be done quickly and efficiently. Presented here is a robust experimental procedure to genetically engineer hPSCs as exemplified by editing the AAVS1 safe harbor locus to express EGFP and introduce antibiotic resistance.

Genome-editing of human pluripotent stem cells (hPSCs) provides a genetically controlled and clinically relevant platform from which to understand human ...

establishment-genome-edited-human-pluripotent-stem-cell-lines-from

Research

JoVE Journal

Developmental Biology

13.5K Views.  University of California, Berkeley. Genome editing of human pluripotent stem cells (hPSCs) can be done quickly and efficiently. Presented here is a robust experimental procedure to genetically engineer hPSCs as exemplified by editing the AAVS1 safe harbor locus to express EGFP and introduce antibiotic resistance. 

Video: Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation

Transfection, Selection, and Colony-picking of Human Induced Pluripotent Stem Cells TALEN-targeted with a GFP Gene into the AAVS1 Safe Harbor

Targeted transgene addition can provide persistent gene expression while circumventing the gene silencing and insertional mutagenesis caused by viral vector mediated random integration. This protocol describes a universal and efficient transgene targeted addition platform in human iPSCs based on utilization of validated open-source TALENs and a gene-trap-like donor to deliver transgenes into a safe harbor locus. Importantly, effective gene editing is rate-limited by the delivery efficiency of gene editing vectors. Therefore, this protocol first focuses on preparation of iPSCs for transfection to achieve high nuclear delivery efficiency. When iPSCs are dissociated into single cells using a gentle-cell dissociation reagent and transfected using an optimized program, >50% cells can be induced to take up the large gene editing vectors. Because the AAVS1 locus is located in the intron of an active gene (PPP1R12C), a splicing acceptor (SA)-linked puromycin resistant gene (PAC) was used to select targeted iPSCs while excluding random integration-only and untransfected cells. This strategy greatly increases the chance of obtaining targeted clones, and can be used in other active gene targeting experiments as well. Two weeks after puromycin selection at the dose adjusted for the specific iPSC line, clones are ready to be picked by manual dissection of large, isolated colonies into smaller pieces that are transferred to fresh medium in a smaller well for further expansion and genetic and functional screening. One can follow this protocol to readily obtain multiple GFP reporter iPSC lines that are useful for in vivo and in vitro imaging and cell isolation.

TALEN-mediated gene editing at the safe harbor AAVS1 locus enables high-efficiency transgene addition in human iPSCs. This protocol describes the procedures for preparing iPSCs for TALEN and donor vector delivery, transfecting iPSCs, and selecting and isolating iPSC clones to achieve targeted integration of a GFP gene to generate reporter lines.

Targeted transgene addition can provide persistent gene expression while circumventing the gene silencing and insertional mutagenesis caused by viral ...

Genome Editing and Directed Differentiation of hPSCs for Interrogating Lineage Determinants in Human Pancreatic Development

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding human development and dissecting disease mechanisms in a dish. To capitalize on this potential application requires efficient genome-editing tools to generate hPSC mutants in disease-associated genes, as well as in vitro hPSC differentiation protocols to produce disease-relevant cell types that closely recapitulate their in vivo counterparts. An efficient genome-editing platform for hPSCs named iCRISPR has been developed through the TALEN-mediated targeting of a Cas9 expression cassette in the AAVS1 locus. Here, the protocols for the generation of inducible Cas9 hPSC lines using cells cultured in a chemically defined medium and a feeder-free condition are described. Detailed procedures for using the iCRISPR system for gene knockout or precise genetic alterations in hPSCs, either through non-homologous end joining (NHEJ) or via precise nucleotide alterations using a homology-directed repair (HDR) template, respectively, are included. These technical procedures include descriptions of the design, production, and transfection of CRISPR guide RNAs (gRNAs); the measurement of the CRISPR mutation rate by T7E1 or RFLP assays; and the establishment and validation of clonal mutant lines. Finally, we chronicle procedures for hPSC differentiation into glucose-responsive pancreatic &#946;-like cells by mimicking in vivo pancreatic embryonic development. Combining iCRISPR technology with directed hPSC differentiation enables the systematic examination of gene function to further our understanding of pancreatic development and diabetes disease mechanisms.

Protocols to generate hPSC mutant lines using the iCRISPR platform and to differentiate hPSCs into glucose-responsive &#946;-like cells are described. Combining genome editing technology with hPSC-directed differentiation provides a powerful platform for the systematic analysis of the role of lineage determinants in human development and disease progression.

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding ...

Genetics

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise heterozygous genetic modifications is challenging due to CRISPR-CAS9 mediated indel formation in the second allele. Here, we demonstrate a protocol to help overcome this difficulty by using two repair templates in which only one expresses the desired sequence change, while both templates contain silent mutations to prevent re-cutting and indel formation. This methodology is most advantageous for gene editing coding regions of DNA to generate isogenic control and mutant human stem cell lines for studying human disease and biology. In addition, optimization of transfection and screening methodologies have been performed to reduce labor and cost of a gene editing experiment. Overall, this protocol is widely applicable to many genome editing projects utilizing the human pluripotent stem cell model.

This protocol provides a method to facilitate the generation of defined heterozygous or homozygous nucleotide changes using CRISPR-CAS9 in human pluripotent stem cells.

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

Introducing Point Mutations into Human Pluripotent Stem Cells Using Seamless Genome Editing

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing in mammalian cells. Here we describe detailed procedures to seamlessly genome edit the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus as an example in human pluripotent stem cells. Combining a piggyBac-based donor plasmid and the CRISPR-Cas9 nickase mutant in a two-step genetic selection, we demonstrate correct and efficient targeting of the HNF4&#945; locus.

Here, we describe a detailed method for seamless gene editing in human pluripotent stem cells using a piggyBac-based donor plasmid and the Cas9 nickase mutant. Two point mutations were introduced into exon 8 of the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus in human embryonic stem cells (hESCs).

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing ...

Transfecting and Nucleofecting Human Induced Pluripotent Stem Cells

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human embryonic stem cells (HESCs)1. While improvements in several gene delivery methods have been described2-9, transfection remains a capricious process for HESCs, and has not yet been reported in human induced pluripotent stem cells (iPSCs). In this video, we demonstrate how our lab routinely transfects and nucleofects human iPSCs using plasmid with an enhanced green fluorescence protein (eGFP) reporter. Human iPSCs are adapted and maintained as feeder-free cultures to eliminate the possibility of feeder cell transfection and to allow efficient selection of stable transgenic iPSC clones following transfection. For nucleofection, human iPSCs are pre-treated with ROCK inhibitor11, trypsinized into small clumps of cells, nucleofected and replated on feeders in feeder cell-conditioned medium to enhance cell recovery. Transgene-expressing human iPSCs can be obtained after 6 hours. Antibiotic selection is applied after 24 hours and stable transgenic lines appear within 1 week. Our protocol is robust and reproducible for human iPSC lines without altering pluripotency of these cells.

Despite recent advancements in genetic modification, transfection of human embryonic stem cells (HESCs) remains a capricious process. To our knowledge, systematic and efficient methods to transfect human induced pluripotent stem cells (iPSCs) have not been reported. Here, we describe robust protocols to efficiently transfect and nucleofect human iPSCs.

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human ...

Biology

Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus

Even with the revolution of gene-targeting technologies led by CRISPR-Cas9, genetic modification of human pluripotent stem cells&#160;(hPSCs)&#160;is still time consuming. Comparative studies that use recombinant lines with transgenes integrated into safe harbor loci could benefit from approaches that use site-specific targeted recombinases, like Cre or FLPe, which are more rapid and less prone to off-target effects. Such methods have been described, although they do not significantly outperform gene targeting in most aspects. Using Zinc-finger nucleases, we previously created a master cell line in the AAVS1 locus of hPSCs&#160;that contains a GFP-Hygromycin-tk expressing cassette, flanked by heterotypic FRT sequences. Here, we describe the procedures to perform FLPe recombinase-mediated cassette exchange (RMCE) using this line. The master cell line is transfected with a RMCE donor vector, which contains a promoterless Puromycin resistance, and with FLPe recombinase. Application of both a positive (Puromycin) and negative (FIAU) selection program leads to the selection of RMCE without random integrations. RMCE generates fully characterized pluripotent polyclonal transgenic lines in 15 d&#160;with 100% efficiency. Despite the recently described limitations of the AAVS1 locus, the ease of the system paves the way for hPSC transgenesis in isogenic settings, is necessary for comparative studies, and enables semi-high-throughput genetic screens for gain/loss of function analysis that would otherwise be highly time consuming.

Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus

Here we report a rapid and efficient gene editing method based on RMCE in the AAVS1 locus of human Pluripotent Stem Cells (hPSCs) that improves upon previously described systems. Using this technique, isogenic lines can be rapidly and reliably generated for proper comparative studies, facilitating transgenesis-mediated research with hPSCs.

Even with the revolution of gene-targeting technologies led by CRISPR-Cas9, genetic modification of human pluripotent stem cells&#160;(hPSCs)&#160;is ...

Medicine

Selecting and Isolating Colonies of Human Induced Pluripotent Stem Cells Reprogrammed from Adult Fibroblasts

Herein we present a protocol of reprogramming human adult fibroblasts into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding Oct3/4, Sox2, Klf4 and c-myc (OSKM) in the presence of sodium butyrate 1-3. We used this method to reprogram late passage (&gt;p10) human adult fibroblasts derived from Friedreich's ataxia patient (GM03665, Coriell Repository). The reprogramming approach includes highly efficient transduction protocol using repetitive centrifugation of fibroblasts in the presence of virus-containing media. The reprogrammed hiPSC colonies were identified using live immunostaining for Tra-1-81, a surface marker of pluripotent cells, separated from non-reprogrammed fibroblasts and manually passaged 4,5. These hiPSC were then transferred to Matrigel plates and grown in feeder-free conditions, directly from the reprogramming plate. Starting from the first passage, hiPSC colonies demonstrate characteristic hES-like morphology. Using this protocol more than 70% of selected colonies can be successfully expanded and established into cell lines. The established hiPSC lines displayed characteristic pluripotency markers including surface markers TRA-1-60 and SSEA-4, as well as nuclear markers Oct3/4, Sox2 and Nanog. 
The protocol presented here has been established and tested using adult fibroblasts obtained from Friedreich's ataxia patients and control individuals 6, human newborn fibroblasts, as well as human keratinocytes.

We present a protocol for efficient reprogramming of human somatic cells into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding Oct3/4, Sox2, Klf4 and c-myc (OSKM) and identification of correctly reprogrammed hiPSC by live staining with Tra-1-81 antibody.

Herein we present a protocol of reprogramming human adult fibroblasts into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding ...

Efficient iPS Cell Generation from Blood Using Episomes and HDAC Inhibitors

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using episomal plasmids and histone deacetylase (HDAC) inhibitors. The advantages of this approach include: (1) the use of a minimal amount of peripheral blood as a source material; (2) nonintegrating reprogramming vectors; (3) a cost effective method for generating vector free iPSCs; (4) a single transfection; and (5) the use of small molecules to facilitate epigenetic reprogramming. Briefly, peripheral blood mononuclear cells (PBMCs) are isolated from routine phlebotomy samples and then cultured in defined growth factors to yield a highly proliferative erythrocyte progenitor cell population that is remarkably amenable to reprogramming. Nonintegrating, nontransmissible episomal plasmids expressing OCT4, SOX2, KLF4, MYCL, LIN28A, and a p53 short hairpin (sh)RNA are introduced into the derived erythroblasts via a single nucleofection. Cotransfection of an episome that expresses enhanced green fluorescent protein (eGFP) allows for easy identification of transfected cells. A separate replication-deficient plasmid expressing Epstein-Barr nuclear antigen 1 (EBNA1) is also added to the reaction mixture for increased expression of episomal proteins. Transfected cells are then plated onto a layer of irradiated mouse embryonic fibroblasts (iMEFs) for continued reprogramming. As soon as iPSC-like colonies appear at about twelve days after nucleofection, HDAC inhibitors are added to the medium to facilitate epigenetic remodeling. We have found that the inclusion of HDAC inhibitors routinely increases the generation of fully reprogrammed iPSC colonies by 2 fold. Once iPSC colonies exhibit typical human embryonic stem cell (hESC) morphology, they are gently transferred to individual iMEF-coated tissue culture plates for continued growth and expansion.

Here we describe a protocol for generating human induced pluripotent stem cells from peripheral blood using an episome based reprogramming strategy and histone deacetylase inhibitors.

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using ...

Derivation and Characterization of a Transgene-free Human Induced Pluripotent Stem Cell Line and Conversion into Defined Clinical-grade Conditions

Human induced pluripotent stem cells (hiPSCs) can be generated with lentiviral-based reprogramming methodologies. However, traces of potentially oncogenic genes remaining in actively transcribed regions of the genome, limit their potential for use in human therapeutic applications1. Additionally, non-human antigens derived from stem cell reprogramming or differentiation into therapeutically relevant derivatives preclude these hiPSCs from being used in a human clinical context2. In this video, we present a procedure for reprogramming and analyzing factor-free hiPSCs free of exogenous transgenes. These hiPSCs then can be analyzed for gene expression abnormalities in the specific intron containing the lentivirus. This analysis may be conducted using sensitive quantitative polymerase chain reaction (PCR), which has an advantage over less sensitive techniques previously used to detect gene expression differences3. Full conversion into clinical-grade good manufacturing practice (GMP) conditions, allows human clinical relevance. Our protocol offers another methodology&#8212;provided that current safe-harbor criteria will expand and include factor-free characterized hiPSC-based derivatives for human therapeutic applications&#8212;for deriving GMP-grade hiPSCs, which should eliminate any immunogenicity risk due to non-human antigens. This protocol is broadly applicable to lentiviral reprogrammed cells of any type and provides a reproducible method for converting reprogrammed cells into GMP-grade conditions.

We describe a protocol for deriving lentiviral-based reprogrammed and characterized factor-free human induced pluripotent stem cells and conversion into putative clinical-grade conditions.

Human induced pluripotent stem cells (hiPSCs) can be generated with lentiviral-based reprogramming methodologies. However, traces of potentially oncogenic ...

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical application of this technique, particularly in pluripotent stem cells, presents certain challenges, such as being time- and labor-intensive and having low editing efficiency. Here, we describe the generation of a CRISPR-mediated gene knockout in a human embryonic stem cell (hESC) line stably expressing sgRNAs for the L2HGDH gene, using a highly efficient and stable lentiviral-mediated gene delivery system. The sgRNAs targeting exon 1 of the L2HGDH gene were chemically synthesized and cloned into the lentiCRISPR v2-puro vector, which combines the constitutive expression of sgRNAs with Cas9 in a highly efficient single-vector system to achieve higher lentiviral titers for hESC infection and stable selection using puromycin. Puromycin-selected cells were further expanded, and single-cell clones were obtained using the limited dilution method. The single clones were expanded, and several homozygous knockout clones for the L2HGDH gene were obtained, as confirmed by a 100% reduction in L2HGDH expression using Western blot analysis. Furthermore, using MSBSP-PCR, the CRISPR mutation site was mapped upstream of the PAM recognition sequence of Cas9 in the selected homozygous clones. Sanger sequencing was performed to analyze the exact insertions/deletions, and functional characterization of the clones was conducted. This method produced a significantly higher percentage of homozygous deletions compared to previously reported non-viral gene delivery methods. Although this report focuses on the L2HGDH gene, this robust and cost-effective approach can be used to create homozygous knockouts for other genes in pluripotent stem cells for gene function studies.

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical ...

Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation

Summary

Explore More Videos

Chapters in this video

Transfection, Selection, and Colony-picking of Human Induced Pluripotent Stem Cells TALEN-targeted with a GFP Gene into the AAVS1 Safe Harbor

Genome Editing and Directed Differentiation of hPSCs for Interrogating Lineage Determinants in Human Pancreatic Development

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Introducing Point Mutations into Human Pluripotent Stem Cells Using Seamless Genome Editing

Transfecting and Nucleofecting Human Induced Pluripotent Stem Cells

Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus

Selecting and Isolating Colonies of Human Induced Pluripotent Stem Cells Reprogrammed from Adult Fibroblasts

Efficient iPS Cell Generation from Blood Using Episomes and HDAC Inhibitors

Derivation and Characterization of a Transgene-free Human Induced Pluripotent Stem Cell Line and Conversion into Defined Clinical-grade Conditions

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions