Dieses Projekt wurde von NIH New Innovator Award DP2 116520 und ORAU Ralph Powe Junior Faculty Enhancement Award.

1. Zell-Wartung <ol><li> H1 hESC (WiCell) wurden an menschlichen embryonalen Stammzellen qualifizierte Matrigel beschichteten Wells mit mTeSR1 Medien gepflegt, mit Medien täglich ändern. F12: Die Vertiefungen wurden mit verdünnter Matrigel Lösung, durch Zugabe von 300 ul hESC Matrigel in 25 ml DMEM beschichtet. 1 ml dieser Lösung wurde Matrigel in jede Vertiefung einer Platte mit sechs Vertiefungen gegeben, oder 400 ul in jede Vertiefung einer 12-Well-Platte und man ließ die Beschichtung 1 Stunde bei Raumtemperatur. Die Zellen wurden mechanisch mit einer Split-Verhältnis von 1:4 durch Abkratzen Kolonien, wenn sie zwischen 1 und 1,5 mm im Durchmesser erreicht passagiert. </li><li> RHMVEC (VEC-Technologien) wurde im MCDB-131 Medien mit Medien verändern jeden zweiten Tag gepflegt. Die Zellen wurden durch Trypsinisierung aufgeteilt einmal 80% Konfluenz in einem Teilungsverhältnis von 1:3 erreicht wurde. Endothelzellen zwischen den Kanälen 3 und 7 wurden für diese Studie verwendet. </li></ol> 2. Herstellung von Stammlösungen <ol><li> Activin A wurde bei 50 pg / ml in sterilem P rekonstituiertBS, enthaltend 0,1% Rinderserumalbumin. Die Lösung wurde aliquotiert und bei -20 ° C gelagert </li><li> EGF wurde bei 500 pg / ml in sterilem 10 mM Essigsäure rekonstituiert. Die Lösung wurde aliquotiert und bei -20 ° C gelagert </li><li> Insulin wurde mit 10 mg / ml mit indem angesäuert H 2 O (pH-Wert ≤ 2), durch Zugabe von 0,1 ml Eisessig zu 10 ml Wasser hergestellt rekonstituiert. </li><li> DAPT wurde in DMSO bei 18 mg / ml rekonstituiert. Es wurde weiter auf 300 pM Konzentration in DMEM verdünnt: F12, aliquotiert und bei -20 ° C </li><li> KAAD-Cyclopamin wurde in DMSO bei 5mg/ml rekonstituiert. Es wurde weiter auf 2 pM Konzentration in DMEM verdünnt: F12, aliquotiert und bei -20 ° C </li><li> All-trans-Retinsäure wurde mit 2,7 mg / ml in 95% Ethanol rekonstituiert. Ferner wurde auf 2 mM Konzentration in DMEM verdünnt: F12, aliquotiert und bei -80 ° C </li></ol> 3. Definitive Endoderm (DE) und Pankreas-Vorläuferzellen (PP) Induction <ol><li> Einmal hESC Kolonien erreicht zwischen 1 und 1,5 mm im Durchmesser, wurde DE Induktion mit indem DMEM durchgeführt: F12 mit B27, 0,2% BSA, 100 ng / ml Activin A und 1 nM Wortmannin für 4 Tage (Tag 0-Tag 4) mit Medien ergänzt täglich ändern. </li><li> Nach DE Induktion beendet war, wurde Pankreas-Vorläuferzellen Induktion durch Veränderung der Medien zu DMEM induziert: F12 mit B27, 0,2% BSA und KAAD-Cyclopamin bei 0,2 pM Konzentration für 24 Stunden (Tag 4-Tage-5) ergänzt. </li><li> Nach 24 Stunden wurde auf Medien DMEM geändert: F12 ergänzt mit B27, 0,2% BSA, KAAD-Cyclopamin bei 0,2 pM Konzentration und all-trans-Retinsäure auf 2 pM Konzentration für 3 Tage mit den Medien jeden Tag ändern (Tag 5-Tages-8) . </li></ol> 4. Pankreas-Reifung <ol><li> Nach PP Induktion wurden alle Gruppen zur Reifung Medien aus DMEM geändert: F12 mit B27, 0,2% BSA, 10 mM Nicotinamid, 25 ug / ml Insulin, 30 nM Na 2 SeO 3 und 50 pg / ml Transferrin für 2 d ergänztays mit Medien jeden Tag ändern (Tag 8-Tag 10). </li><li> Nach 2 Tagen in Medien Reifung wird die endgültige Reifung Schritt aus parallel unter Verwendung von verschiedenen Bedingungen zum Vergleich durchgeführt. (I) der Kerbe Inhibitor DAPT (ii) unter Verwendung von Co-Kulturmedium nur ohne endothelialen Zellen als Kontrolle und (iii) mit Kontakt Co-Kultur mit RHMVEC Zellen: Die Differenzierung wurde unter den folgenden Bedingungen induziert. Die Zellen wurden in DAPT oder Co-Kultur-Medien für eine Woche aufrecht erhalten (Tag 10-Tage-17) mit den Medien täglich ändern. <ol><li> DAPT Medien wurde durch eine Ergänzung der Reifung Medien mit 30 uM DAPT vorbereitet. Die Zellen in dieser Gruppe wurden zunächst ausgesetzt MCDB131 für 24 Stunden abzuschließen und dann zu DAPT Medien ausgesetzt für 6 Tage (Tag 11-Tage-17). </li><li> Co-Kulturmedium wurde durch Hinzufügung MCDB-131 hergestellt Medien mit B27, 0,2% BSA, 10 mM Nicotinamid, 10 ng / ml EGF, 1 pg / ml Hydrocortison, 10 mg EndoGro, 90 ug / ml Heparin. Für die media control Zustand differenzierenden Zellen ausgesetzt waren,um MCDB-131 vollständig Weg für 24 Stunden (Tag 10-Tage-11), nach der die Medien, um die Zusammenarbeit Kulturmedien für 6 Tage (Tag 11-Tag 17) (keine Endothelzellen) geändert wurde. </li><li> Für den Kontakt Co-Kultur Bedingungen wurde eine Million RHMVEC den differenzierenden Zellen in völliger MCDB-131 Medien (VEC Technologien) für 24 Stunden (Tag 10-Tage-11) zugegeben, um die Befestigung zu ermöglichen. Nach 24 Stunden wurde auf Medien Co-Kultur-Medien für 6 Tage (Tag 11-Tage-17) mit den Medien verändert sich täglich ändern. </li></ol></li></ol> 5. qRT-PCR-Analyse <ol><li> Am Ende jeder Phase der Differenzierung (Endoderm, Pankreas-Vorläuferzellen, reife Insel) wurden lysiert und RNA wurde unter Verwendung NucleoSpin RNA II-Extraktions-Kits nach den Anweisungen des Herstellers. </li><li> RNA-Qualität wurde durch Prüfen RNA Absorption bei 260 nm und 280 nm, gefolgt von RNA-Quantifizierung unter Verwendung eines SmartSpec Zzgl. Spektrophotometer analysiert. </li><li> Die reverse Transkription wurde unter Verwendung ImProm II reverse Transkription kes nach den Anweisungen des Herstellers. Alle Reaktionen wurden mit 100 ng RNA durchgeführt. </li><li> qRT-PCR erfolgte unter Verwendung des Mx3005P QPCR System (Agilent) und Brilliant II SYBR Green qPCR Master Mix nach Anweisungen des Herstellers. Die verwendeten Primer sind in Tabelle 1 aufgelistet. Die Initialisierung Schritt wurde bei 50 ° C für 2 Minuten bei 95 ° C für 10 Minuten. 50 Amplifikationszyklen wurden wie folgt durchgeführt: 95 ° C für 30 Sekunden, 54 ° C für 30 Sekunden und 72 ° C für 1 Minute. </li><li> Fache Änderung der Ziel-mRNA-Expression in undifferenzierten Zellen wurde aus CT-Werte nach folgenden Formeln berechnet: ΔCT (Markierung i) = CT (Markierung I) - CT (GAPDH) Δ ΔCT (Markierung i) = ΔCT (Markierung i) (Sample) - ΔCT (Markierung i) (undifferenzierte Zellen) Relativen Expression (Markierung i) = 2-ΔΔCT(Marker-i) </li></ol> 6. Immunzytochemie <ol><li> Am Ende jeder Phase der Differenzierung (Endoderm, Pankreas-Vorläuferzellen, reife Insel-Zellen) wurden in 4% Formaldehyd für 15 Minuten bei Raumtemperatur fixiert. </li><li> Die fixierten Zellen wurden permeabilisiert mit 0,25% Triton X-100 (TX) für 15 Minuten. </li><li> Nicht-spezifische Färbung wurde durch Inkubation in 10% Eselserum in 0,05% für 30 Minuten blockiert TX. </li><li> Der primäre Antikörper Inkubation wurde über Nacht bei 4 ° C in Blocking-Puffer in der empfohlenen Antikörper-Verdünnung (siehe Tabelle 1). </li><li> Die Zellen wurden mit 0,05% TX dreimal für 5 Minuten gewaschen. </li><li> Sekundäre Antikörper-Inkubation wurde für eine Stunde bei Raumtemperatur im Dunkeln mit geeigneten Antikörpern in Blocking-Puffer verdünnt durchgeführt. </li><li> Die Zellen wurden mit 0,05% TX dreimal für 5 Minuten gewaschen. </li><li> Kernfärbung wurde durch Inkubation mit Hoechst durchgeführt Tinte in einer Verdünnung von 1:1000 in PBSfür 5 Minuten mit 3 Waschschritten mit PBS. </li><li> Fixierten und gefärbten Zellen wurden aufgenommen mit Olympus IX81 inversen Mikroskop und Metamorph Imaging-Software. </li></ol> 7. Repräsentative Ergebnisse Die Zugabe von Activin A und Wortmannin undifferenzierte HES für 4 Tage induziert endgültigen Endoderm durch qRT-PCR-Analyse für DE Marker Sox17, CXCR4, und Foxa2 bestätigt und Immunfärbung auf Sox17 wie in 2 dargestellt. Abgrenzung zu Pankreas-Vorläuferzellen nach Zugabe von Cyclopamin und Retinsäure wurde durch qRT-PCR von Pankreas-Vorläuferzellen Marker und Immunfärbung für Pdx1 wie in 3 dargestellt bestätigt. In der letzten Stufe der Differenzierung, wenden Sie sich Co-Kultur mit RHMVEC Zellen stark induziert Hochregulierung der Insulin-Expression in den humanen embryonalen Stammzellen abgeleiteten Pankreas-Vorläuferzellen. Die Effizienz der Co-Kultur vermittelten Differenzierung wurde durch die gleichzeitige Analysemparing mit Kontrollbedingung mit DAPT. DAPT wurde als positive Kontrolle verwendet, da es derzeit eine der am häufigsten verwendeten Verfahren zur Reifung Pankreas zu erreichen. Da die Co-Kultur in einem modifizierten Medienstroms durch Faktoren unterstützt Endothelzellen ergänzt durchgeführt wurde, wurde zusätzliches Steuerelement mit den Medien in Abwesenheit von Endothelzellen, um die Wirkung von Medien auf die Differenzierung zu verifizieren. Details zu dieser Analyse sind in Abbildung 4 dargestellt. <img alt="Abbildung 1." src="/files/ftp_upload/3759/3759fig1.jpg" /> Abbildung 1. Mehrstufige Protokoll für die Differenzierung von hES in Insulin exprimierenden Zellen. <img alt="Abbildung 2." src="/files/ftp_upload/3759/3759fig2.jpg" /> 2. Definitive Endoderm Induktion von humanen embryonalen Stammzellen. A) qRT-PCR-Analyse der repräsentativen DE Marker in HES Zellen, die A und Wortmannin für 4 Tage Activin. Ergebnisse ar<html> e, bezogen auf undifferenzierte HES normalisiert. B) Sox17 Färbung (grün) und DAPI (blau) zeigen nukleare Expression von Sox17. Maßstab: 50 um. <img alt="Abbildung 3." src="/files/ftp_upload/3759/3759fig3.jpg" /> Abbildung 3. Pankreas-Vorläuferzellen Induktion des embryonalen Stammzellen abgeleitet Entodermzellen. A) qRT-PCR-Analyse der frühen Pankreas-Marker im HES abgeleitet Entodermzellen ausgesetzt Cyclopamin und Retinsäure für 4 Tage nach der DE Induktion. Die in Bezug auf undifferenzierte HES normalisiert. B) Pdx1 Färbung (violett) und DAPI (blau) zeigen nukleare Expression von Pdx1. Maßstab: 50 um. &quot;&gt; <img alt="Abbildung 4." src="/files/ftp_upload/3759/3759fig4.jpg" /> Abbildung 4. Pancreatic Reifung Stufe A) qRT-PCR-Analyse von Pankreas-Hormone im menschlichen embryonalen Stammzellen nach Pankreas-Reifung mit DAPT, wenden Sie sich Co-Kultur-oder Co-Kultur-Medien (Kontrolle). Die in Bezug auf undifferenzierte HES normalisiert. p erhaltenen Werte von Student t-Tests. B) Co-Kultur mit Dil-Ac-LDL beschriftet RHMVEC (Rot) zeigen Regionen, in denen ECs auf den Teller legen, wenn es leere Räume (oben) sind, können andere RHMVEC in direkten Kontakt mit der differenzierenden ESC (unten) zu finden. C) C-Peptid (grün) Färbung für Zellen differenziert mit Co-Kultur-Methode. Maßstab: 12,5 um (oben) und 50 um (unten) D) Immunfärbung von RHMVEC zeigt kein Insulin Ausdruck in der RHMVEC. <table border="1"><tbody><tr><td> Marker </td><td> Primer1 (5 &#39;nach 3&#39;) &lt;/ Td&gt; <td> Primer2 (5 &#39;nach 3&#39;) </td><td> Ref </td></tr><tr><td> Sox17 </td><td> CTCTGCCTCCTCCACGAA </td><td> CAGAATCCAGACCTGCACAA </td><td> 12 </td></tr><tr><td> CXCR4 </td><td> CACCGCATCTGGAGAACCA </td><td> GCCCATTTCCTCGGTGTAGTT </td><td> 4 </td></tr><tr><td> Foxa2 </td><td> GGAGCGGTGAAGATGGAA </td><td> TACGTGTTCATGCCGTTCAT </td><td> 12 </td></tr><tr><td> PDX1 </td><td> AAGTCTACCAAAGCTCACGCG </td><td> GTAGGCGCCGCCTGC </td><td> 4 </td></tr><tr><td> PTF1 </td><td> CATAGAGAACGAAACCACCCTTTGAG </td><td> GCACGGAGTTTCCTGGACAGAGTTC </td><td> 12 </td></tr><tr><td> HLXB9 </td><td> CACCGCGGGCATGATC </td><td> ACTTCCCCAGGAGGTTCGA </td><td> 4 </td></tr><tr><td> HNF6 </td><td> TGTGGAAGTGGCTGCAGGA </td><td> TGTGAAGACCAACCTGGGCT </td><td> 5 </td></tr><tr><td> PAX6 </td><td> CGAATTCTGCAGGTGTCCAA </td><td> ACAGACCCCCTCGGACAGTAAT </td><td> 5 </td></tr><tr><td> NKX6.1 </td><td> AGACCCACTTTTTCCGGACA </td><td> CCAACGAATAGGCCAAACGA </td><td> 5 </td></tr><tr><td> Isl1 </td><td> GATCTATGTCACCTCGCAAGG </td><td> TACAACCACCATTTCACTG </td><td> 12 </td></tr><tr><td> GLUCAGON </td><td> AGGCAGACCCACTCAGTGA </td><td> AACAATGGCGACCTCTTCTG </td><td> 4 </td></tr><tr><td> INSULIN </td><td> AAGAGGCCATCAAGCAGATCA </td><td> CAGGAGGCGCATCCACA </td><td> 12 </td></tr></tbody></table> Tabelle 1. Primer für die qPCR-Reaktionen verwendet.

<ol>
	<li>De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Les+cellules+souches+embryonnaires+humaines+:+de+la+transgression+de+l'embryon+humain+&#225;+la+m&#233;decine+r&#233;g&#233;n&#233;ratrice+de+demain.">Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain &#225; la m&#233;decine r&#233;g&#233;n&#233;ratrice de demain.</a> Gyn&#233;cologie Obst&#233;trique &#38; Fertilit&#233;. 37, 620-626 (2009).</li><li>Murtaugh, L. C., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes,+Signals,+and+Lineages+in+Pancreas+Development.">Genes, Signals, and Lineages in Pancreas Development.</a> Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).</li><li>Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+definitive+endoderm+from+embryonic+stem+cells+in+culture.">Development of definitive endoderm from embryonic stem cells in culture.</a> Development. 131, 1651-1662 (2004).</li><li>D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat. Biotech. 24, 1392-1401 (2006).</li><li>Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+differentiation+of+human+ES+cells+and+iPS+cells+into+mature+pancreatic+insulin-producing+cells.">Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells.</a> Cell Res. 19, 429-438 (2009).</li><li>Basma, H., Soto-Guti&#233;rrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+and+Transplantation+of+Human+Embryonic+Stem+Cell-Derived+Hepatocytes.">Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes.</a> Gastroenterology. 136, 990-999 (2009).</li><li>Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -. P., Chipperfield, H., Tan, E. -. K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+Differentiation+of+Human+Embryonic+Stem+Cells+into+the+Pancreatic+Endocrine+Lineage.">Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage.</a> Stem Cells and Development. 16, 561-578 (2007).</li><li>Kim, S. K., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pancreas+development+is+promoted+by+cyclopamine,+a+Hedgehog+signaling+inhibitor.">Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor.</a> Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).</li><li>Docherty, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+and+development+of+the+islets+of+Langerhans:+implications+for+the+treatment+of+diabetes+mellitus.">Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus.</a> Current Opinion in Pharmacology. 1, 641-649 (2001).</li><li>Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., F&#228;ssler, R., Gu, G., Gerber, H. -. P., Ferrara, N., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Vascular+Basement+Membrane:+A+Niche+for+Insulin+Gene+Expression+and+[beta]&gt;+Cell+Proliferation.">The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]&gt; Cell Proliferation.</a> Developmental Cell. 10, 397-405 (2006).</li><li>Yoshitomi, H., Zaret, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+cell+interactions+initiate+dorsal+pancreas+development+by+selectively+inducing+the+transcription+factor+Ptf1a.">Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a.</a> Development. 131, 807-817 (2004).</li><li>Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marked+differences+in+differentiation+propensity+among+human+embryonic+stem+cell+lines.">Marked differences in differentiation propensity among human embryonic stem cell lines.</a> Nat. Biotech. 26, 313-315 (2008).</li><li>Banerjee, I., Sharma, N., Yarmush, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+co-culture+on+pancreatic+differentiation+of+embryonic+stem+cells.">Impact of co-culture on pancreatic differentiation of embryonic stem cells.</a> J. Tissue Eng. Regen. Med. 5, 313-323 (2010).</li></ol>

Wir haben nichts zu offenbaren.

Während Bauchspeicheldrüsenentwicklung sind Differenzieren Pankreaszellen in unmittelbarer Nähe mit Endothelzellen aus der Aorta, ferner sind Pankreasinseln dicht vaskularisiert raschen Austausch von Blutglukose und Inselhormone zu präsentieren. Angesichts dieser Tatsachen ist es nicht verwunderlich, dass Endothelzellen eine wichtige Rolle im Prozess der Organogenese Pankreas spielen. Während die Bedeutung von Endothelzellen während der Pankreas-Entwicklung wird zunehmend geschätzt wird seine Rolle bei der in...

<table border="1"><tbody><tr><td> Name des Reagenzes </td><td> Firma </td><td> Katalog-Nummer </td><td> Die Konzentrationen </td></tr><tr><td> mTeSR1 (mit Zuschlag) </td><td> Stammzellentechnologien </td><td> 5850 </td><td></td></tr><tr><td> hESC qualifizierte Matrigel </td><td> BD Biosciences </td><td> 354277 </td><td></td></tr><tr><td> DMEM: F12 </td><td> Invitrogen </td><td> 11330-032 </td><td></td></tr><tr><td> MCDB-131 </td><td> Invitrogen </td><td> 10372019 </td><td></td></tr><tr><td> MCDB-131 (Complete) </td><td> VEC Technologies </td><td> MCDB-131 </td><td></td></tr><tr><td> B27 Supplement </td><td> Invitrogen </td><td> 17504044 </td><td></td></tr><tr><td> Activin A </td><td> F &amp; E </td><td> <a href="http://www.rndsystems.com/pdf/338-ac.pdf">338-AC</a> </td><td> 100ng/ml </td></tr><tr><td> Wortmannin </td><td> Invitrogen </td><td> W3144 </td><td> 1 &amp;mgr; M </td></tr><tr><td> KAAD-Cyclopamie </td><td> Sigma-Aldrich </td><td> C4116 </td><td> 0,2 um </td></tr><tr><td> All-trans-Retinsäure </td><td> Sigma-Aldrich </td><td> R2625 </td><td> 2 &amp;mgr; m </td></tr><tr><td> DAPT </td><td> Sigma-Aldrich </td><td> D5942 </td><td> 30 um </td></tr><tr><td> Nicotinamid </td><td> Sigma-Aldrich </td><td> N0636 </td><td> 10 mM </td></tr><tr><td> Natriumselenit </td><td> Sigma-Aldrich </td><td> S5261 </td><td> 30 nM </td></tr><tr><td> Insulin </td><td> Sigma-Aldrich </td><td> I1882 </td><td> 25 ug / ml </td></tr><tr><td> Transferrin </td><td> Sigma-Aldrich </td><td> T8158 </td><td> 50 ug / ml </td></tr><tr><td> EGF </td><td> F &amp; E </td><td> <a href="http://www.rndsystems.com/pdf/236-eg.pdf">236-EG</a> </td><td> 10ng/ml </td></tr><tr><td> EndoGro </td><td> VEC Technologies </td><td> ENDOGRO </td><td> 10mg </td></tr><tr><td> Heparin </td><td> Sigma-Aldrich </td><td> H3149 </td><td> 90μg/ml </td></tr><tr><td> Hydrocortison </td><td> Sigma-Aldrich </td><td> H0888 </td><td> 1μg/ml </td></tr><tr><td> NucleoSpin RNA II </td><td> Macherey Nagel </td><td> 740955 </td><td></td></tr><tr><td> ImProm II Reverse Transkription-System </td><td> Promega </td><td> A3800 </td><td></td></tr><tr><td> Brilliant II SYBR Green qPCR Master Mix </td><td> Straragene </td><td> 600548 </td><td></td></tr><tr><td> Sox17 polyklonaler Ziege-IgG </td><td> Santa Cruz </td><td> sc-17355 </td><td> 1/500 </td></tr><tr><td> PDX1 polyklonaler Ziege-IgG </td><td> Santa Cruz </td><td> sc-14662 </td><td> 1/500 </td></tr><tr><td> C-Peptid Kaninchen polyklonale </td><td> Cell Signaling </td><td> 4593 </td><td> 1/500 </td></tr><tr><td> Alexa Fluor 488 Esel Anti-Kaninchen IgG </td><td> Invitrogen </td><td> A-21206 </td><td> 1/1000 </td></tr><tr><td> Alexa Fluor 647 Esel-anti-Ziege-IgG </td><td> Invitrogen </td><td> A-21447 </td><td> 1/1000 </td></tr></tbody></table> Tabelle 2. Reagenzien und Kits.

endothelial cell co-culture mediates maturation of human embryonic stem cell to pancreatic insulin producing cells in a directed differentiation approach

Embryonale Stammzellen (ESC) haben zwei wesentliche Eigenschaften: Sie können unbegrenzt in vitro vermehrt in einem undifferenzierten Zustand und sie sind pluripotent, somit die Möglichkeit besteht, sich in verschiedene Linien zu differenzieren. Solche Eigenschaften machen WSR äußerst attraktiv für die Zell-basierte Therapie und regenerative Behandlung Anwendungen ein. Jedoch für das volle Potenzial realisiert werden die Zellen zu reifen und funktionellen Phänotypen, die eine schwierige Aufgabe ist unterschieden werden. Ein vielversprechender Ansatz bei der Induktion der zellulären Differenzierung ist es, genau imitieren den Pfad der Organogenese in der In-vitro-Einstellung. Pankreas-Entwicklung ist bekannt, dass in bestimmten Stufen 2 auftreten, beginnend mit Entoderm, die in mehrere Organe, einschließlich Leber und Bauchspeicheldrüse entwickeln können. Endoderm Induktion durch Modulation des Knotenkörpers Weg durch Zugabe von Activin A 3 in Kombination mit mehreren Wachstumsfaktoren 4-7 erreicht werden </sup&gt;. Definitive Entodermzellen dann einer Pankreas-Einsatz durch Hemmung der Sonic-Hedgehog-Hemmung, die in vitro durch Zugabe von Cyclopamin 8 erreicht werden. Pankreas-Reifung wird durch mehrere parallele Ereignisse einschließlich der Hemmung der Notch-vermittelt; Aggregation von Pankreas-Vorläuferzellen in 3-dimensionale Cluster; Induktion der Vaskularisierung; um einige zu nennen. Mit Abstand das erfolgreichste in-vitro-Reifung der ESC abgeleiteten Pankreas-Vorläuferzellen wurden durch Hemmung der Notch-Signalweg durch DAPT Supplementierung 9 erreicht worden. Obwohl erfolgreich, führt dies zu geringen Ausbeute des reifen Phänotyp mit eingeschränkter Funktionalität. Ein weniger erforschtes Gebiet ist die Wirkung von Endothelzellen Signalgebung in der Bauchspeicheldrüse Reifung, die zunehmend als wichtiger Faktor in In-vivo-Inselzellen der Bauchspeicheldrüse Reifung 10,11 geschätzt. Die aktuelle Studie untersucht, wie Wirkung von Endothelial Zellsignalen in Reifung menschlicher ESC abgeleiteten Pankreas-Vorläuferzellen in Insulin produzierenden Inselzellen-Zellen. Wir berichten über einen mehrstufigen gerichtete Differenzierung Protokoll, bei dem die menschlichen WSR zuerst in Richtung Endoderm von Activin A zusammen mit der Hemmung der PI3K induziert. Pancreatic Spezifikation von Entoderm-Zellen wird durch Hemmung der Sonic-Hedgehog-Signalgebung durch Cyclopamin zusammen mit Retinoid-Induktion durch Zugabe von Retinsäure erzielt. Die letzte Stufe der Reifung wird durch Endothelzellen Signalisierung durch eine Co-Kultur-Konfiguration erreicht induziert. Während mehrere Endothelzellen in der Co-Kultur getestet worden, hier präsentieren wir unsere Daten mit Ratten-Herzen mikrovaskulären Endothelzellen (RHMVEC), vor allem für die Analyse erleichtern.

Watch this Scientific Journal Video about Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach at J

Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

Die aktuelle Studie beschreibt eine gerichtete Differenzierung Ansatz bei der Induktion von Pankreas-Differenzierung von humanen embryonalen Stammzellen. Von großer Bedeutung ist der Befund, dass Endothelzellen Co-Kultur vermittelt Reifung von humanen embryonalen Stammzellen abgeleiteten Pankreas-Vorläuferzellen in Insulin exprimierenden Zellen.

Endothelial Cell Co-Kultur Vermittelt Reifung von humanen embryonalen Stammzellen zu Pankreas-Insulin-produzierenden Zellen in einer gerichteten Differenzierung Ansatz

Embryonic stem cells (ESC) have two main characteristics: they can be indefinitely propagated in vitro in an undifferentiated state and they are ...

endothelial-cell-co-culture-mediates-maturation-human-embryonic-stem

Research

JoVE Journal

Biology

16.2K Aufrufe.  University of Pittsburgh. Die aktuelle Studie beschreibt eine gerichtete Differenzierung Ansatz bei der Induktion von Pankreas-Differenzierung von humanen embryonalen Stammzellen. Von großer Bedeutung ist der Befund, dass Endothelzellen Co-Kultur vermittelt Reifung von humanen embryonalen Stammzellen abgeleiteten Pankreas-Vorläuferzellen in Insulin exprimierenden Zellen.

Serie: Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

Derivation of Hematopoietic Stem Cells from Murine Embryonic Stem Cells

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are derived from the blastocyst of the early embryo and are pluripotent in differentiative ability.  Their vast differentiative potential has made them the focus of much research centered on deducing how to coax them to generate clinically useful cell types.  The successful derivation of hematopoietic stem cells (HSC) from mouse ESC has recently been accomplished and can be visualized in this video protocol.  HSC, arguably the most clinically exploited cell population, are used to treat a myriad of hematopoietic malignancies and disorders.  However, many patients that might benefit from HSC therapy lack access to suitable donors.  ESC could provide an alternative source of HSC for these patients.  The following protocol establishes a baseline from which ESC-HSC can be studied and inform efforts to isolate HSC from human ESC.  In this protocol, ESC are differentiated as embryoid bodies (EBs) for 6 days in commercially available serum pre-screened for optimal hematopoietic differentiation.  EBs are then dissociated and infected with retroviral HoxB4.  Infected EB-derived cells are plated on OP9 stroma, a bone marrow stromal cell line derived from the calvaria of  M-CSF-/- mice, and co-cultured in the presence of hematopoiesis promoting cytokines for ten days.  During this co-culture, the infected cells expand greatly, resulting in the generation a heterogeneous pool of 100s of millions of cells.  These cells can then be used to rescue and reconstitute lethally irradiated mice.

This protocol details the derivation of transplantable hematopoietic stem cells from mouse embryonic stem cells (ESC) and their subsequent injection into lethally irradiated recipient mice. Briefly, ESC are differentiated as embryoid bodies, which are then infected with retroviral HoxB4 and co-cultured with OP9 stromal cells and hematopoietic cytokines.

Ableitung von hämatopoetischen Stammzellen aus embryonalen Stammzellen der Maus

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are ...

Forschung

Biologie

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Gewinnung menschlicher embryonaler Stammzellen durch Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Embryonic Stem Cell-Derived Endothelial Cells for Treatment of Hindlimb Ischemia

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This pathology causes symptoms such as intermittent claudication (pain with walking), painful ischemic ulcerations, or even limb-threatening gangrene. It is generally believed that the vascular endothelium, a monolayer of endothelial cells that invests the luminal surface of all blood and lymphatic vessels, plays a dominant role in vascular homeostasis and vascular regeneration. As a result, stem cell-based regeneration of the endothelium may be a promising approach for treating PAD.In this video, we demonstrate the transplantation of embryonic stem cell (ESC)-derived endothelial cells for treatment of unilateral hindimb ischemia as a model of PAD, followed by non-invasive tracking of cell homing and survival by bioluminescence imaging. The specific materials and procedures for cell delivery and imaging will be described. This protocol follows another publication in describing the induction of hindlimb ischemia by Niiyama et al.1

The surgical procedure for delivery of embryonic stem cell-derived endothelial cells to the ischemic hindlimb is demonstrated, with non-invasive tracking by bioluminescence imaging.

Embryonale Stammzellen gewonnenen Endothelzellen zur Behandlung von Ischämie Hinterlauf

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This ...

Isolation and Large Scale Expansion of Adult Human Endothelial Colony Forming Progenitor Cells

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult human peripheral blood within a mean of 12 days. After large scale expansion &gt;1x108 ECFCs can be obtained for further tests. Advantageously by using pHPL the contact of human cells with bovine serum antigens can be excluded. By flow cytometry and immunohistochemistry the isolated cells can be characterized as ECFC and their in vitro functionality to form vascular like structures can be tested in a matrigel assay. Further these cells can be subcutaneously injected in a mouse model to form functional, perfused vessels in vivo. After long term expansion and cryopreservation proliferation, function and genomic stability appear to be preserved. 3,4
This animal-protein free isolation and expansion method is easily applicable to generate a large quantity of ECFCs.

Endothelial colony forming progenitor cells (ECFCs) are a promising tool to study vascular homeostasis and repair.1,2 This paper introduces a novel animal-serum free method for isolation and expansion of ECFC from heparinised adult human peripheral blood with pooled human platelet lysate (pHPL) diminishing the risk of anti-bovine immunisation.

Isolation und großräumige Ausdehnung der erwachsenen Menschen Endothelial Colony Forming Progenitorzellen

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult ...

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells (MSCs) and Endothelial Colony Forming Progenitor Cells (ECFCs)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal stem cells, MSCs) and endothelial colony forming progenitor cells (ECFCs). Both cell types are key players in maintaining the integrity of tissue and are probably also involved in regenerative processes and tumor formation.
To study their biology and function in a comparative manner it is important to have both cells types available from the same donor. It may also be beneficial for regenerative purposes to derive MSCs and ECFCs from the same tissue.
Because cellular therapeutics should eventually find their way from bench to bedside we established a new method to isolate and further expand progenitor cells without the use of animal protein. Pooled human platelet lysate (pHPL) replaced fetal bovine serum in all steps of our protocol to completely avoid contact of the cells to xenogeneic proteins.
This video demonstrates a methodology for the isolation and expansion of progenitor cells from one umbilical cord.
All materials and procedures will be described.

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells MSCs and Endothelial Colony Forming Progenitor Cells ECFCs

This protocol describes the isolation and subsequent expansion of mesenchymal stromal cells and endothelial colony forming cells without the use of animal serum to generate autologous pairs for experimental transplantation purposes.

Isolation und tierisches Serum Freie Expansion der menschlichen Nabelschnur Derived mesenchymale Stromazellen (MSCs) und Endothelial Colony Forming Progenitorzellen (ECFCs)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal ...

Video Bioinformatics Analysis of Human Embryonic Stem Cell Colony Growth

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer software.  Video bioinformatics is a powerful quantitative approach for extracting spatio-temporal data from video images using computer software to perform dating mining and analysis. In this article, we introduce a video bioinformatics method for quantifying the growth of human embryonic stem cells (hESC) by analyzing time-lapse videos collected in a Nikon BioStation CT incubator equipped with a camera for video imaging. In our experiments, hESC colonies that were attached to Matrigel were filmed for 48 hours in the BioStation CT.  To determine the rate of growth of these colonies, recipes were developed using CL-Quant software which enables users to extract various types of data from video images.  To accurately evaluate colony growth, three recipes were created. The first segmented the image into the colony and background, the second enhanced the image to define colonies throughout the video sequence accurately, and the third measured the number of pixels in the colony over time.  The three recipes were run in sequence on video data collected in a BioStation CT to analyze the rate of growth of individual hESC colonies over 48 hours. To verify the truthfulness of the CL-Quant recipes, the same data were analyzed manually using Adobe Photoshop software. When the data obtained using the CL-Quant recipes and Photoshop were compared, results were virtually identical, indicating the CL-Quant recipes were truthful. The method described here could be applied to any video data to measure growth rates of hESC or other cells that grow in colonies. In addition, other video bioinformatics recipes can be developed in the future for other cell processes such as migration, apoptosis, and cell adhesion.  

Video bioinformatics is the automated processing, analysis, understanding, and data mining of biological spatio-temporal data extracted from microscopic videos. The purpose of this article is to demonstrate a method for measuring human embryonic stem cell colony growth using a video bioinformatics method.

Video bioinformatischen Analyse von humanen embryonalen Stammzellen Colony Growth

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

Differenzierung von embryonalen Stammzellen in Oligodendrozyten Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Fate Mapping von humanen embryonalen Stammzellen durch Teratom Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three ...

Efficient Derivation of Human Cardiac Precursors and Cardiomyocytes from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based transplantation or by cardiac tissue engineering1-3. Cardiomyocytes become terminally-differentiated soon after birth and lose their ability to proliferate. There is no evidence that stem/progenitor cells derived from other sources, such as the bone marrow or the cord blood, are able to give rise to the contractile heart muscle cells following transplantation into the heart1-3. The need to regenerate or repair the damaged heart muscle has not been met by adult stem cell therapy, either endogenous or via cell delivery1-3. The genetically stable human embryonic stem cells (hESCs) have unlimited expansion ability and unrestricted plasticity, proffering a pluripotent reservoir for in vitro derivation of large supplies of human somatic cells that are restricted to the lineage in need of repair and regeneration4,5. Due to the prevalence of cardiovascular disease worldwide and acute shortage of donor organs, there is intense interest in developing hESC-based therapies as an alternative approach. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity6-8 (see a schematic in Fig. 1A). In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic9-11. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules12 (see a schematic in Fig. 1B). After screening a variety of small molecules and growth factors, we found that such defined conditions rendered nicotinamide (NAM) sufficient to induce the specification of cardiomesoderm direct from pluripotent hESCs that further progressed to cardioblasts that generated human beating cardiomyocytes with high efficiency (Fig. 2). We defined conditions for induction of cardioblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human cardiac cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of cardioblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human cardiac progenitors and functional cardiomyocytes for cardiovascular repair.

Effiziente Ableitung von Human Cardiac Vorstufen und Kardiomyozyten aus pluripotenten humanen embryonalen Stammzellen mit Small Molecule Induction

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based ...

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells (iPSCs) Using Retroviral Vector with GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has been previously shown that human somatic cells can be reprogrammed to pluripotency by ectopic expression of four transcription factors (Oct4, Sox2, Klf4 and Myc) and become induced pluripotent stem cells (iPSCs)2-4 . Like hESCs, human iPSCs are pluripotent and a potential source for autologous cells. Here we describe the protocol to reprogram human fibroblast cells with the four reprogramming factors cloned into GFP-containing retroviral backbone4. Using the following protocol, we generate human iPSCs in 3-4 weeks under human ESC culture condition. Human iPSC colonies closely resemble hESCs in morphology and display the loss of GFP fluorescence as a result of retroviral transgene silencing. iPSC colonies isolated mechanically under a fluorescence microscope behave in a similar fashion as hESCs. In these cells, we detect the expression of multiple pluripotency genes and surface markers.

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells iPSCs Using Retroviral Vector with GFP

A method to generate human induced pluripotent stem cells (iPSCs) via retrovirus-mediated ectopic expression of OCT4, SOX2, KLF4 and MYC is described. A practical way to identify human iPSC colonies based on GFP expression is also discussed.

Reprogrammierung menschlichen Körperzellen in induzierte pluripotente Stammzellen (IPSCs) mit retroviralen Vektoren mit GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has ...