Diese Arbeit wurde von der US Defense Advanced Research Projects Agency Vertrag N66001-12-C-4039 um YS, einen Zuschuss von der Alfred P. Sloan Foundation, RSL, und US-amerikanischen National Institutes of Health Zuschüsse R01 HG003224 und R21 CA130266 um FPRFPR unterstützt wurde auch durch ein Stipendium vom kanadischen Institut für Advanced Research und von der Canada Exzellenzinitiative Forschung Chairs-Programm unterstützt.

Ein. Erzeugung ProMonsters <ol><li> Bereiten Sie die universelle GFP Austauschkassette durch Verstärken eines tetO 2-GFP-Marker und den URA3-Marker aus dem Plasmid pYOGM012 (Ampicillin-Resistenz) unter Verwendung der Primer mit Sequenzen: GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG und GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (bolded Regionen bereitzustellen Homologie zu den flankierenden Regionen des kanMX4 Kassette ermöglicht gezielten Austausch). Die PCR-Reaktion sollte mit Phusion Polymerase, HF-Puffer und 3% Dimethylsulfoxid (New England BioLabs), beginnend mit der Matrizen-DNA-Konzentration von 0,5 ng / ul durchgeführt werden. Das PCR-Programm bei 98 ° C für 30 sec und 35 Zyklen von 98 ° C für 10 sec, 49 ° C für 30 sec, und 72 ° C für 1,5 min. Das Reaktionsvolumen sollte&gt; 50 ul sein, um genügend DNA für jede Transformation Experiment liefern. Wir reinigendas Produkt mit einem QIAquick PCR Purification Kit (Qiagen) mit ~ 50 ul der PCR-Reaktion pro Spalte verarbeitet, aber das Überspringen der Reinigungsschritt kann die Ausbeute von Transformanten. Alternativ freizugeben ein Fragment, das den tetO 2-GFP und URA3-Marker sowie zur homologen Regionen kanMX4 Targeting, das durch Verdauen des Plasmids pYOGM057 (Ampicillinresistenz) mit dem Restriktionsenzym EcoRI (New England BioLabs). Die DNA-Konzentration in dieser Reaktion sollte ~ 30 ng / ul sein. Das Reaktionsvolumen sollte&gt; 34 ul sein. Zum Integrieren des GFP-Kassette in einem anderen Bereich als kanMX4, passen die Homologieregion der PCR-Primer über den entsprechenden homologen Sequenzen. </li><li> Transformieren eines a-haploiden Stamm von der kanMX4 Hefe knockout Sammlung 12 mit dem Universal-GFP Deletionskassette. Nach dem Protokoll von Woods und Gietz 13 0,34 ul derDNA-Probe (gereinigtes PCR Produkt oder nicht-gereinigten Restriktionsverdau) sind für jede Transformation Experiment verwendet werden. Platte ein Fünftel des Transformationsansatzes auf einen CAA-Ura Platte (0,67% Hefe-Stickstoff-Base, 2% Glucose, 0,6% Casaminosäure, 0,0025% Adenin Hemisulfat, 0,005% Tryptophan und 2% Agar). </li><li> Streak aus den Transformanten auf einem frischen CAA-Ura Platte isolierte Kolonien zu erhalten. </li><li> Übertragen von Zellen aus einer Kolonie auf ein YPDA Platte, enthaltend 200 ug / ml G418, um das Fehlen von Wachstum zu bestätigen. Um eine erfolgreiche GFP Integration zu bestätigen, folgen Sie den Schritten (1,5) - (1,9) zum Kolonie-PCR durchzuführen. </li><li> Hinzufügen von Zellen aus einer Kolonie in 2 ul Lysepuffer (0,1 M Natriumphosphat, pH 7,4, 1 Einheit aus ZymoResearch Zymolyase) in einer 0,2-ml-PCR-Röhrchen oder eine Vertiefung einer 96-Well-Platte entnommen. Mischung durch Pipettieren der Lösung in und aus einer Pipettenspitze. </li><li> Overlay mit einem Tropfen (etwa 20 ul) von Mineralöl mit einem P200 Pipetman (Gilson). </li><li> Inkubieren der Mischung bei 37 °C für 20 min und dann bei 95 ° C für 10 min. </li><li> Verdünnen Sie das Lysat mit 50 ul Wasser. Mix durch Pipettieren die Lösung in und aus zehnmal. </li><li> Analysieren 1 ul des Lysats unter Verwendung von 10-ul PCR-Reaktionen mit (A) einem Vorwärtsprimer daß annealt an die stromaufwärts flankierenden Region mit einem Primer der Sequenz CCTGAGAAAGCAACCTGACC (285 bp vom Beginn der Kassette) gepaart, (B) einem Reverse Primer annealt, dass an dem stromabwärts gelegenen Bereich mit einem Primer der Sequenz GCATTGGGTCAACAGTATAG (375 bp aus dem Ende) gepaart ist, (C), die zu zwei Primer mit den Sequenzen kanMX4 CGTACTCCTGATGATGCATG und GACGAAATACGCGATCGCTG (181 bp) anlagern, und (D) zwei Primern, dass Ausheilen der Wildtyp-Sequenz des Zielgens (Abbildung 4). (D) ist wichtig, weil etwa 8% der Stämme in den Löschvorgang Sammlungen bekannt sind Aneuploidie 14 enthalten. Eine korrekte Transformante sollte positiv mit (A) und (B) und mit negativen (C) und (D). </li><li> Um die EinführungGMToolkit in die Transformante, fügen etwa 250.000 Zellen aus dem transformierten Stamm und 250.000 Zellen entweder RY0146 (enthaltend GMToolkit-a) oder RY0148 (enthaltend GMToolkit-α) in einem 1,6-ml-Eppendorf-Röhrchen. Vortex. Die Genotypen RY0146 und RY0148 sind MATa lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-a [CMVpr-rtTA kanMX4 STE2pr-Sp-his5] und MATa lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-α [CMVpr-rtTA NatMX4 STE3pr- LEU2] tragen. pr bezeichnet Promotor. Zellzahl sollte die optische Dichte der vorhergehenden Kultur geschätzt werden. </li><li> Zentrifugation bei 800 xg für 2 min. </li><li> Entfernen Sie den Überstand. </li><li> Um den Luftaustausch zu ermöglichen, ein Loch auf dem Deckel mit einem Druckbolzen mit 70% Ethanol behandelt werden. </li><li> Dann werden 50 ul YPDA Medium (1% Hefeextrakt, 2% Pepton, 2% Glucose und 0,003% Adenin hemisulfate). Vortex. </li><li> Zentrifugation bei 800 xg für 5 min. </li><li> Das Röhrchen wird in einem feuchten Box. Dies kann mit einem leeren Kasten Spitze, eine kleine Spitze Ständer und einem nassen Papiertuch erstellt werden. </li><li> Inkubieren Sie die Box über Nacht bei 30 ° C. </li><li> Wählen gepaart Diploide durch erste Streifen einige der Zellen auf einem CAA-Ura Platte. Inkubieren Sie die Platte bei 30 ° C für einen Tag. </li><li> Entnehmen von Zellen aus der Bulk-Bereich, streifenfreie sie aus, um isolierte Kolonien auf YPDA Platten (1% Hefeextrakt, 2% Pepton, 2% Glucose, 0,003% Adenin Hemisulfat, und 2% Agar) mit 200 ug / ml G418 zum Selektieren Diploide machen enthaltenden GMToolkit-a oder 100 pg / ml Nourseothricin (Nat) 15 zum Auswählen Diploide enthaltenden GMToolkit-α. </li><li> Inkubieren Sie die Platte bei 30 ° C für 3 Tage. </li><li> Ausgehend von einer isolierte Kolonie, übertragen die meisten Zellen zu 500 ul GNA Mediums ohne Agar (1% Hefeextrakt, 3% Difco Nährbrühe und 5% Glucose; Autoklaven Glucose und der Rest von ter Komponenten separat als 2 × Lösungen Karamelisierung vermeiden) in einem 5-ml-Kultur Rohr mit dem Deckel gelöst wird. </li><li> Drehen Sie den Schlauch horizontal fünf Stunden bei 30 ° C. Die Achse der Rotation benötigt, um parallel zur Längsachse des Rohres. </li><li> Bestätigen Sie, dass Kolonien in (1,21) sind Ura + durch Ausstreichen sie auf einem CAA-Ura Platte. </li><li> Zentrifugieren bei 800 xg für 2 min. Überstand verwerfen. </li><li> Add 500 ul minimalen Sporulationsmedium (1% Kaliumacetat, 0,005% Zinkacetat; Filter-sterilisiert). Vortex. </li><li> Zentrifugieren bei 800 xg für 2 min. Überstand verwerfen. </li><li> Repeat (1,25) - (1,26) zweimal. </li><li> 1 ml minimal Sporulationsmedium mit 7,5 ug / ml Lysin, 7,5 pg / ml Leucin, 5 pg / ml Histidin, 5 pg / ml Methionin und 1,25 pg / ml Uracil (die Sporulationsrate der auxotrophen Stämme erhöhen) ergänzt . Vortex. </li><li> Drehen des Rohrs bei Raumtemperatur für einen Tag. </li><li> Drehen des Rohres bei 30 ° C für 2 Tage. </li><li> Zentrifuge 125 ul dieser Mischung in einer 1,6-ml-Eppendorf-Röhrchen bei 800 xg für 2 min. Überstand verwerfen. </li><li> Fügen Sie 50 ul Zymolyase Lösung (100 mM Natrium-Phosphat-Puffer, pH 7,4, 1 M Sorbit und 2 Einheiten Zymolyase von ZymoResearch). Mischung durch Pipettieren der Lösung in und aus einer Pipettenspitze. </li><li> Inkubieren bei 30 ° C für 1 Stunde. </li><li> Fügen Sie 50 ul von 0,02% NP-40. Mischung durch Pipettieren der Lösung in und aus einer Pipettenspitze. </li><li> Verlassen die Röhrchen bei Raumtemperatur für fünf Minuten. </li><li> Add 500 ul Wasser. </li><li> Das Röhrchen auf Eis. </li><li> Beschallen Sie diese Mischung zweimal am Ausgang Einstellung von 1 (schwächsten Einstellung) für 15 sec mit einem 3,2-mm Mikrospitze mit Sonifier 450 (Branson). Zwischen den beiden Runden der Beschallung, legte die Tube auf Eis, um die Temperatur auf ~ 0 ° C zurück </li><li> Zentrifugieren bei 800 × g für 5 min. Überstand verwerfen. </li><li> Fügen Sie 200 ul SC-Ura-His(A) oder SC-Ura-Leu (α)-Medium, je nachdem, ob das Kreuz ist zum Einarbeiten GMToolkit-a oder GMToolkit-α. Um die Medien herzustellen, stellen SC-Ura-His-Leu-Medium (0,67% Yeast Nitrogen Base, 2% Glucose, 0,01% Arginin, 0.01% Asparaginsäure, 0,01% Glutaminsäure, 0,01% Isoleucin, 0,01% Lysin, 0,01% Methionin , 0,01% Phenylalanin, Serin 0,08%, 0,04% Threonin, Tyrosin 0,002%, 0,03% Valin, 0,0025% Adenin, 0,005% Tryptophan, Adenin 0,003% und 0,005% Tryptophan) und ergänzt es mit sterilem Histidin oder Leucin vor Gebrauch der Endkonzentration von 0,01%. </li><li> Machen Sie ein Loch auf dem Deckel mit einer Reißzwecke mit 70% Ethanol behandelt. </li><li> Drehen Sie den Schlauch horizontal bei 30 ° C für 2 Tage. Die Achse der Rotation benötigt, um parallel zur Längsachse des Rohres. </li><li> Streak aus den Zellen auf einem SC-Ura-His-oder SC-Ura-Leu-Agar-Platte (die gleichen Zutaten wie oben plus 2% Agar, Threonin und Asparaginsäure muss nach a hinzugefügt werdenutoclaving, fügen Histidin oder Leucin vor dem Gießen), um isolierte Kolonien für die ProMonster Stämme zu machen. </li></ol> 2. Sexuelle Radfahren <ol><li> Drehen Sie eine Kultur eines etablierten GFP Deletionsstamm in 100 ul SC-His (a) oder SC-Leu (α) in Abhängigkeit von Paarungstyp bei 30 ° C über Nacht mit einer 1,6-ml Eppendorf-Röhrchen. Für den Luftaustausch, machen Sie ein Loch mit einem Pin mit 70% Ethanol behandelt. Drehen Sie den Schlauch horizontal. Die Achse der Rotation benötigt, um parallel zur Längsachse des Rohres. Es ist möglich, mehrere Stämme über en masse zusammenpassenden überqueren. Wenn ein sortierten Probe wird direkt für diesen Zweck, die Zellen in Kultur 200 ul eingesetzt bei 30 ° C für 2 Tage. Um das Medium herzustellen, fügen Uracil (Endkonzentration: 0,0025%) und Histidin (0,01%) oder Leucin (0,01%) auf SC-Ura-His-Leu-Medium. </li><li> Mix 250.000 a-haploide Zellen und 250.000 α-haploiden Zellen GFP Deletionsstämme in einem 1,6-ml Eppendorf Röhre. Vortex. </li><li> Paaren diese Zellen durch folgende Schritte (1,11) - (1,17). </li><li> Übertragen 10 ul der Paarung Mischung 500 ul GNA-Medium mit 200 ug / ml G418 und 100 ug / ml Nat in einem 5-ml-Kultur Rohr mit einer gelockerten Deckel. Das Ausgangsmaterial OD 600 ist etwa 0,1. </li><li> Drehen Sie die Kultur bei 30 ° C für 24 Stunden. Dies ermöglicht die Auswahl von Diploide weil nur Diploide enthaltend sowohl kanMX4 in GMToolkit-a und NatMX4 in GMToolkit-α kann in Gegenwart von G418 und Nat (Abbildung 3) wachsen. </li><li> Übertragen 20 ul der eintägigen Kultur zu 500 ml frisches GNA mit G418 und Nat. Das Ausgangsmaterial OD 600 ist etwa 0,2. </li><li> Drehen des Rohres bei 30 ° C für 5 Stunden, um Zellen auf der log-Phase (OD 600 von ~ 1) zu bringen. </li><li> Folgen Sie den Schritten (1,24) - (1,38), die Diploiden sporulieren und isolieren Sporen. </li><li> Split die Aussetzung der sporenbildenden Zellen in zwei 300-ulTeile und setzen jeweils in einen separaten 1,5-ml Eppendorf-Röhrchen. </li><li> Zentrifugieren bei 800 × g für 5 min. Überstand verwerfen. </li><li> Um das Pellet aus einem Rohr, mit 100 ul der SC-Sein Medium, um ein-Haploiden wählen. Zum Pellet des anderen Rohres, werden 100 ul SC-Leu-Medium zu α-Haploiden auszuwählen. </li><li> Drehen Sie die Röhrchen bei 30 ° C über Nacht. Die endgültige OD 600 soll weniger als 0,5. Wenn OD 600 neigt dazu, zu hoch sein, versuchen Kultivieren bei Raumtemperatur. </li><li> Um GFP zu induzieren, mit 100 ml frisches SC-His (a) oder SC-Leu (α)-Medium mit 20 ug / ml Doxycyclin. Die Endkonzentration von Doxycyclin ist 10 ug / ml. Vortex. </li><li> Drehen Sie die Röhrchen bei 30 ° C für 2 Tage. </li></ol> 3. Durchflusszytometrie <ol><li> Zusatz von 900 ul vorgefilterten TE-Puffer (pH 7,5), enthaltend 10 ug / ml Doxycyclin zu einem 5-ml-Polypropylenröhrchen (Falcon # 352.063 BD) mit der Kappe mit einer Zelle vertauscht-Schmutzfänger Kappe aus einem 5-ml Polystyrol-Röhrchen (BD Falcon # 352235). Polypropylen Röhrchen sind geeignet für die Durchflusszytometrie. Das Sieb Kappe zum Entfernen von großen Partikeln gewünscht. </li><li> Sanft legen 75 ul TE-Puffer mit Doxycyclin auf die Zelle Schmutzfänger Kappe. </li><li> Zugeben von 25 ul der induzierten Zellen zu der Lösung auf der Kappe. </li><li> Halten Sie die Spitze des Pipetman gegen die Gitter, schießen alle der kombinierten Lösung durch das Sieb. </li><li> Drücken Sie das Sieb Kappe und das Röhrchen vortexen. </li><li> Bereiten Sammelröhrchen (1,6-ml-Eppendorf-Röhrchen) mit 200 ul SC-His-oder SC-Leu gefüllt. </li><li> Starten Sie den Zellsortierer und die Einstellungen nach Angaben des Herstellers Handbuch. </li><li> Vortex sowohl das Sammelgefäß (zum Beschichten der Wand mit dem Medium) und das Rohr mit mehreren Zellen vor dem Einlegen auf dem Zellsortierer. </li><li> Erwerben durchflusszytometrischen Daten der Probe. Ein Stamm nicht mit GFP kann eine negative Kontrolle. </li><li> Zeichnen Tore für Sortierung. (A)Um Zellaggregate, die hohe GFP Intensität aufweisen könnten, zu vermeiden, werfen Ausreißer mit unverhältnismäßig großen Impulsbreite für Vorwärtsstreuung (FSC) mit einem Grundstück von Pulsbreite und Höhe für MoFlo Sortierer oder unverhältnismäßig gering FSC Höhe mit einem Grundstück von FSC Höhe und FSC Bereich für FACSAria Sortierer (Abbildung 5, top-links). (B) Da große FSC (Fläche) ist für Zellaggregate erwartet, nur Zellen in der unteren 20% in FSC, bei gleichzeitiger Vermeidung Regionen mit dem niedrigsten FSC und side scatter (SSC)-Werte, wobei Zelltrümmer oft gefunden wird (Abbildung 5, Top-rechts). (C) SSC (Fläche) und GFP-Signal (Fläche) werden oft positiv korreliert. Weil man einfach die hellsten Zellen gegeben die Gates oberhalb würde auch für Zellen mit einem hohen Wert SSC anzureichern Ziehung einer Gate entlang der Peripherie der Bevölkerung über eine Parzelle von GFP Intensität und SSC einen ähnlichen Prozentsatz der hellsten Zellen aus jeder Punkt ergreifen der SSC-Achse (Abbildung 5, bottom-linkes Diagramm). Die Bevölkerung in (C) ausgewählt wird, sollte 0,1-1% der Bevölkerung in (B) ausgewählt werden. </li><li> Sortieren 200 Zellen in das Sammelröhrchen angesichts der Kriterien in (3,10). Für ein en masse Prozess oder für andere Projekte erfordern eine komplexere Bevölkerung, sortieren mehr Zellen nach Bedarf. </li><li> Vortex das Sammelröhrchen zur Deckung der sortierten Zellen mit Medium. </li><li> Platte eine Teilmenge von Zellen (beispielsweise 50-Zellen) auf einer Platte für YPDA Genotypisierung. </li><li> Inkubieren Sie die Platte bei 30 ° C für 2 Tage. </li><li> Machen Sie eine Lysat für ~ 12 Kolonien nach den Schritten (1,5) - (1,8). </li><li> Übertragen der verbleibenden Zellen auf der Spitze im verwendet (1,5) auf einen Fleck auf einem YPDA Platte mit G418 und Nat durch leichte Berührung der Platte mit der Spitze. Ausgewählte Haploiden sollte nicht auf dieser Platte zu wachsen. Diploide kann mehr GFP Kopien und können daher heller. Dieser Test kann zeigen die Effizienz von haploiden Auswahl. </li><li> Für die Genotypisierung, analysieren 1 ul des Lysats mit einem 10-ul PCR reaction mit einem Vorwärtsprimer, dass der stromaufwärts flankierenden Region jeder deletierte Gen mit einem Primer der Sequenz CCTGAGAAAGCAACCTGACC gepaarten annealt. Multiplex-PCR-Reaktionen, wenn möglich (Bedingungen kann anhand Lysaten von einzelnen Mutanten werden). Oder 384-Well-Format - PCR kann in einem 96 erfolgen. Das letztgenannte Format ist geeignet für die Reaktionsvolumen von so wenig wie 5 ul. Anordnen von PCR Mastermixen unterschiedlicher Primer und Zugabe von Zelllysaten zu diesen Mischungen durchgeführt werden kann unter Verwendung einer Mehrkanal-Pipette oder einer Flüssigkeit Handhabungsroboter. Tipp Änderungen sind optional, wenn Sie den gleichen Lysat auf unterschiedliche PCR-Mischungen. </li><li> PCR-Produkte analysiert. Das Gel XL Ultra V-2-Elektrophorese-System (Labnet) ist kompatibel mit Probenbeladung mit Mehrkanal-Pipetten. </li><li> Gestützt auf Informationen von (3,16) und (3,18), identifizieren wahrscheinlich Haploiden die Genotypen gewünscht haben. </li><li> Richten Sie diese Stämme auf eine frische Platte (YPDA, CAA-Ura oder SC-Ura-His/Leu). Auch frieren sie in25% Glycerin bei -80 ° C. Weitere Tests wie Bestätigung der Abwesenheit von Wildtyp-Sequenzen für gelöschte Gene und Puls-Feld-Gelelektrophorese werden empfohlen. </li><li> Wiederholen sexuelle Fahrrad von (2,1) mit nützlichen Stämmen. </li></ol>

<ol>
	<li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science's STKE. 294, 2364-23 (2001).</li><li>Hillenmeyer, M. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Beh, C. T., Cool, L., Phillips, J., Rine, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+functions+of+the+yeast+oxysterol-binding+protein+homologues.">Overlapping functions of the yeast oxysterol-binding protein homologues.</a> Genetics. 157, 1117 (2001).</li><li>Wieczorke, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concurrent+knock-out+of+at+least+20+transporter+genes+is+required+to+block+uptake+of+hexoses+in+Saccharomyces+cerevisiae.">Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae.</a> FEBS letters. 464, 123-128 (1999).</li><li>Alani, E., Cao, L., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gene+disruption+that+allows+repeated+use+of+URA3+selection+in+the+construction+of+multiply+disrupted+yeast+strains.">A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.</a> Genetics. 116, 541-545 (1987).</li><li>Akada, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+seamless+gene+deletion+and+marker+recycling+in+Saccharomyces+cerevisiae.">PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae.</a> Yeast. 23, 399-405 (2006).</li><li>Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+efficient+gene+disruption+cassette+for+repeated+use+in+budding+yeast.">A new efficient gene disruption cassette for repeated use in budding yeast.</a> Nucleic acids research. 24, 2519 (1996).</li><li>Delneri, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+redundancy+in+the+yeast+genome:+an+improved+strategy+for+use+of+the+cre-loxP+system.">Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system.</a> Gene. 252, 127-135 (2000).</li><li>Storici, F., Lewis, L. K., Resnick, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+site-directed+mutagenesis+using+oligonucleotides.">In vivo site-directed mutagenesis using oligonucleotides.</a> Nat. Biotech. 19, 773-776 (2001).</li><li>Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tandem+repeat+coupled+with+endonuclease+cleavage+(TREC):+a+seamless+modification+tool+for+genome+engineering+in+yeast.">Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast.</a> Nucl. Acids Res. 38, 2570-2576 (2010).</li><li>Suzuki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knocking+out+multigene+redundancies+via+cycles+of+sexual+assortment+and+fluorescence+selection.">Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection.</a> Nat. Methods. 8, 159-164 (2011).</li><li>Winzeler, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+Characterization+of+the+S.+Genome+by+Gene+Deletion+and+Parallel+Analysis.">Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis.</a> Science. 285, 901-906 (1999).</li><li>Woods, R. A., Gietz, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+plasmid+DNA+into+yeast.">High-efficiency transformation of plasmid DNA into yeast.</a> Methods Mol. Biol. 177, 85-97 (2001).</li><li>Hughes, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+aneuploidy+revealed+by+DNA+microarray+expression+profiling.">Widespread aneuploidy revealed by DNA microarray expression profiling.</a> Nature. 25, 333-337 (2000).</li><li>Goldstein, A. L., McCusker, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three+new+dominant+drug+resistance+cassettes+for+gene+disruption+in+Saccharomyces+cerevisiae.">Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae.</a> Yeast. 15, 1541-1553 (1999).</li><li>Newman, J. R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+proteomic+analysis+of+S.+cerevisiae+reveals+the+architecture+of+biological+noise.">Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise.</a> Nature. 441, 840-846 (2006).</li><li>Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+regulation+at+the+single-cell+level.">Gene regulation at the single-cell level.</a> Science. 307, 1962 (2005).</li></ol>

Keine Interessenskonflikte erklärt.

Als wir das Green Monster Ansatz entwickelt, wurden wir mit der Möglichkeit der Rekombination zwischen verschiedenen GFP Ersatzkassetten betroffenen, was zu Genom-Umlagerung. Milderung gegen diese Möglichkeit ist unsere Auswahl für Zellen, die erfolgreich mehrere Runden der Paarung und Meiose durchlaufen haben. Zellen, die umgeordnet Genome sind voraussichtlich weniger fit nach der Paarung zu Zellen ohne eine identische Umlagerung. In der Tat haben wir nicht beobachten Genominstabilität aus Rekombination zwischen GF...

<table border="1"><tbody><tr><td> Name des Reagens oder des Instruments </td><td> Firma </td><td> Katalog-Nummer </td><td> Kommentare (optional) </td></tr><tr><td> G418 </td><td> Sigma-Aldrich </td><td> A1720 </td><td> In Wasser auflösen und Filter-sterilisiert (0,2-um-Filter). Lager-Konzentration: 200 mg / ml. Lagerung bei 4 ° C. </td></tr><tr><td> ClonNAT (Nourseothricin) </td><td> WERNER BioAgents </td><td> 5001000 </td><td> In Wasser auflösen und Filter-sterilisiert (0,2-um-Filter). Lager-Konzentration: 100 mg / ml. Lagerung bei 4 ° C. </td></tr><tr><td> Doxycycline </td><td> Sigma-Aldrich </td><td> D9891 </td><td> Lösen Sie in 50% Ethanol und filtern sterilisieren (0,2-um-Filter). Lager Konzentration: 10 mg / ml. Stellen Sie frische alle vier Wochen. Abschirmung von Licht mit Aluminiumfolie und bei 4 ° C. </td></tr><tr><td> Zymolyase </td><td> ZymoResearch </td><td> E1005 </td><td></td></tr><tr><td> Difco Yeast Nitrogen Base w / o Aminosäuren </td><td> BD </td><td> 291940 </td><td></td></tr><tr><td> Revolver (Rotator für Rohre) </td><td> Labnet </td><td> H5600 </td><td></td></tr><tr><td> Enduro Gel XL Elektrophorese-Einheit </td><td> Labnet </td><td> E0160 </td><td></td></tr><tr><td> Sonifier 450 </td><td> Branson </td><td> 101-063-198 </td><td></td></tr><tr><td> Mikrospitze für Sonifier 450 </td><td> Branson </td><td> 101-148-062 </td><td></td></tr><tr><td> FACSAria Zellsortierer </td><td> BD </td><td></td><td></td></tr><tr><td> MoFlo Zellsortierer </td><td> Beckman-Coulter </td><td></td><td></td></tr><tr><td> Biomek FX oder gleichwertig Roboter </td><td> Beckman Coulter </td><td></td><td> Optional. Für den Aufbau Genotypisierung PCRs. </td></tr></tbody> &lt;/ Table&gt;

the green monster process for the generation of yeast strains carrying multiple gene deletions

Phänotypen für eine Gendeletion angesehen offenbart nur, wenn die Mutation in einem bestimmten genetischen Hintergrund oder Umgebungsbedingung 1,2 getestet wird. Es gibt Beispiele, wo viele Gene müssen gelöscht zu entlarven versteckte Genfunktionen 3,4 werden. Trotz des Potenzials für wichtige Entdeckungen werden genetische Interaktionen mit drei oder mehr Gene weitgehend unerforscht. Ausgiebige Recherchen Multi-Mutante Interaktionen wäre unpraktisch aufgrund der schieren Anzahl der möglichen Kombinationen von Deletionen. Jedoch würde Untersuchungen ausgewählter Sätze von Genen wie Sätze von Paraloge mit einer größeren Wahrscheinlichkeit von vornherein mit einer gemeinsamen Funktion, informativ sein. In der Hefe Saccharomyces cerevisiae, wird Gen-Knockout durch Ersetzen eines Gens mit einem selektierbaren Marker über homologe Rekombination erfolgt. Da die Anzahl der Markierungen begrenzt ist, wurden Verfahren zum Entfernen und Wiederverwenden des sam entwickelt<html> e Marker 5,6,7,8,9,10. Jedoch ist sequentiell Engineering multiple Mutationen unter Verwendung dieser Verfahren zeitaufwendig, da die Zeit linear mit der Anzahl der Löschungen zu erzeugenden erforderlich. Hier beschreiben wir die Green Monster Verfahren für die routinemäßige Engineering multiple Deletionen in Hefe 11. In diesem Verfahren wird ein grün fluoreszierendes Protein (GFP) Reporters in Deletionen integriert quantitativ Etikett Stämme gemäß der Anzahl von Deletionen in jedem Stamm enthielten (Abb. 1) verwendet. Wiederholte Runden des Sortiments von GFP-markierten Deletionen über Hefe Paarung und Meiose mit durchflusszytometrische Anreicherung von Stämmen mit mehreren dieser Deletionen führen zu einer Anhäufung von Deletionen in Stämmen (Abbildung 2) gekoppelt ist. Durchführen mehrerer Prozesse parallel mit jedem Prozess, die eine oder mehrere Deletionen pro Runde, verringert die für die Stamm Konstruktion erforderlich. Inhalt &quot;&gt; Der erste Schritt zur Vorbereitung haploid Single-Mutanten genannt ist &#39;ProMonsters,&#39; von denen jeder trägt einen GFP-Reporter in einem gelöschten Locus und einer der&quot; Toolkit &quot;loci, entweder Green Monster GMToolkit-a oder GMToolkit-α an der . can1Δ Locus (Abbildung 3) Verwenden von Stämmen aus der Hefe Deletion Sammlung 12 kann GFP-markierten Deletionen zweckmäßigerweise durch Ersetzen des existierenden gemeinsamen kanMX4 Kassette in diesen Stämmen mit einem Universal-GFP generiert - URA3 Fragment Jeder GMToolkit enthält:. entweder der a - oder α-Mating-typspezifischen haploiden Selektionsmarker 1 und genau eine der beiden Marker, dass, wenn beide GMToolkits vorhanden sind, kollektiv für die Auswahl der Diploide ermöglichen. Der zweite Schritt besteht in der Durchführung der sexuellen Rad durch die Deletion Loci innerhalb einer einzelnen Zelle durch den zufälligen Auswahl und / oder meiotischen Recomb kombinierbarination, die jeden Zyklus der Paarung und Sporulation begleitet.

Wenn eine a-haploide Stamm, der vier GFP-markierten Deletionen (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) wurde mit einem α-haploide Stamm, der vier Deletionen gekreuzt (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), mit zwei Deletionen (ycl033cΔ yer042wΔ) von zwei Stämmen, ein Vertreter geteilt Ergebnis wurde erzielt. Die Paarung Mischung wurde in YPDA Medium mit G418 und Nat Diploiden wählen kultiviert. Die resultierenden Diploide wurden in Sporulationsmedium kultiviert. Die ...

Watch this Scientific Journal Video about The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions at JoVE.com

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Das Green Monster Verfahren ermöglicht die schnelle Montage mehrerer Deletionen mit einem Reporter-Gen kodiert grün fluoreszierendes Protein markiert. Dieses Verfahren basiert auf der Fahrt Hefestämme durch wiederholte Zyklen von sexueller Sortiment von Deletionen und Fluoreszenz-basierter Anreicherung von Zellen, die mehrere Deletionen basiert.

The Green Monster Verfahren zur Erzeugung von Hefestämmen Buchwert Multiple Deletionen

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

the-green-monster-process-for-generation-yeast-strains-carrying

Research

JoVE Journal

Biology

14.2K Aufrufe.  J. Craig Venter Institute. Das Green Monster Verfahren ermöglicht die schnelle Montage mehrerer Deletionen mit einem Reporter-Gen kodiert grün fluoreszierendes Protein markiert. Dieses Verfahren basiert auf der Fahrt Hefestämme durch wiederholte Zyklen von sexueller Sortiment von Deletionen und Fluoreszenz-basierter Anreicherung von Zellen, die mehrere Deletionen basiert.

Serie: The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

A Rapid Technique for the Visualization of Live Immobilized Yeast Cells

We present here a simple, rapid, and extremely flexible technique for the immobilization and visualization of growing yeast cells by epifluorescence microscopy. The technique is equally suited for visualization of static yeast populations, or time courses experiments up to ten hours in length. My microscopy investigates epigenetic inheritance at the silent mating loci in S. cerevisiae. There are two silent mating loci, HML and HMR, which are normally not expressed as they are packaged in heterochromatin. In the sir1 mutant background silencing is weakened such that each locus can either be in the expressed or silenced epigenetic state, so in the population as a whole there is a mix of cells of different epigenetic states for both HML and HMR. My microscopy demonstrated that there is no relationship between the epigenetic state of HML and HMR in an individual cell. sir1 cells stochastically switch epigenetic states, establishing silencing at a previously expressed locus or expressing a previously silenced locus. My time course microscopy tracked individual sir1 cells and their offspring to score the frequency of each of the four possible epigenetic switches, and thus the stability of each of the epigenetic states in sir1 cells. See also  Xu et al., Mol. Cell 2006.

A rapid technique for the visualization of growing immobilized yeast cells, here applied to fluorescent reporters at the silent mating loci HML and HMR

Ein schnelles Verfahren für die Visualisierung von Live-immobilisierten Hefezellen

We present here a simple, rapid, and extremely flexible technique for the immobilization and visualization of growing yeast cells by epifluorescence ...

Forschung

Biologie

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell  electroporation system and Gene Pulser  electroporation buffer were specifically developed to transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells.This video demonstrates how to establish primary hematopoietic cell cultures from murine bone marrow, and then prepare them for electroporation in the MXcell system. We begin by isolating femur and tibia. Bone marrow from both femur and tibia are then harvested and cultures are established. Cultured bone marrow cells are then transfected and analyzed.

This procedure describes how to establish primary hematopoietic cell cultures from murine bone marrow and is followed by transfection using the Gene Pulser MXCell electroporation system.

Die Herstellung von primären hämatopoetischen Zellkulturen aus Knochenmark der Maus für die Elektroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Single-Molecule Imaging of Nuclear Transport

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the last decade. The investigation of molecular interactions with high temporal and spatial resolutions deep within cells has remained challenging due to the inherently weak signals arising from individual molecules. Recent works by Yang et al. demonstrated that narrow-field epifluorescence microscopy allows visualization of nucleocytoplasmic transport at the single molecule level. By the single molecule approach, important kinetics, such as nuclear transport time and efficiency, for signal-dependent and independent cargo molecules have been obtained. Here we described a protocol for the methodological approach with an improved spatiotemporal resolution of 0.4 ms and 12 nm. The improved resolution enabled us to capture transient active transport and passive diffusion events through the nuclear pore complexes (NPC) in semi-intact cells. We expect this method to be used in elucidating other binding and trafficking events within cells.

Single molecule microscopy approch provided novel insights into nuclear transport.

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the ...

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.
Telomerase is a specialized reverse transcriptase1 that adds short DNA repeats, called telomeres, to the 3' end of linear chromosomes2 that serve to protect them from end-to-end fusion and degradation. Following DNA replication, a short segment is lost at the end of the chromosome3 and without telomerase, cells continue dividing until eventually reaching their Hayflick Limit4. Additionally, telomerase is dormant in most somatic cells5 in adults, but is active in cancer cells6 where it promotes cell immortality7.
The minimal telomerase enzyme consists of two core components: the protein subunit (TERT), which comprises the catalytic subunit of the enzyme and an integral RNA component (TER), which contains the template TERT uses to synthesize telomeres8,9. Prior to 2008, only structures for individual telomerase domains had been solved10,11. A major breakthrough in this field came from the determination of the crystal structure of the active12, catalytic subunit of T. castaneum telomerase, TcTERT1.
Here, we present methods for producing large quantities of the active, soluble TcTERT for structural and biochemical studies, and the reconstitution of the telomerase RNP complex in vitro for telomerase activity assays. An overview of the experimental methods used is shown in Figure 1.

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.

In vitro Rekonstitution der Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.

Genomweiten Gen-Deletionen in<em&gt; Streptococcus sanguinis</em&gt; Von High Throughput PCR

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously hard to disrupt. Here we describe the use of a bead mill homogenizer for the extraction of proteins into buffers optimized to maintain the functions, interactions and post-translational modifications of proteins. Logarithmically growing cells expressing the protein of interest are grown in a liquid growth media of choice. The growth media may be supplemented with reagents to induce protein expression from inducible promoters (e.g. galactose), synchronize cell cycle stage (e.g. nocodazole), or inhibit proteasome function (e.g. MG132). Cells are then pelleted and resuspended in a suitable buffer containing protease and/or phosphatase inhibitors and are either processed immediately or frozen in liquid nitrogen for later use. Homogenization is accomplished by six cycles of 20 sec&#160;bead-beating (5.5 m/sec), each followed by one minute incubation on ice. The resulting homogenate is cleared by centrifugation and small particulates can be removed by filtration. The resulting cleared whole cell extract (WCE) is precipitated using 20% TCA for direct analysis of total proteins by SDS-PAGE followed by Western blotting. Extracts are also suitable for affinity purification of specific proteins, the detection of post-translational modifications, or the analysis of co-purifying proteins. As is the case for most protein purification protocols, some enzymes and proteins may require unique conditions or buffer compositions for their purification and others may be unstable or insoluble under the conditions stated. In the latter case, the protocol presented may provide a useful starting point to empirically determine the best bead-beating strategy for protein extraction and purification. We show the extraction and purification of an epitope-tagged SUMO E3 ligase, Siz1, a cell cycle regulated protein that becomes both sumoylated and phosphorylated, as well as a SUMO-targeted ubiquitin ligase subunit, Slx5.

The preparation of high quality yeast cell extracts is a necessary first step in the analysis of individual proteins or entire proteomes. Here we describe a fast, efficient, and reliable homogenization protocol for budding yeast cells that has been optimized to preserve protein functions, interactions, and post-translational modifications.

Bäckerhefe Protein Extraktion und Reinigung für das Studium der Funktion, Wechselwirkungen, und post-translationale Modifikationen

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously ...

Nanogold Labeling of the Yeast Endosomal System for Ultrastructural Analyses

Endosomes are one of the major membrane sorting checkpoints in eukaryotic cells and they regulate recycling or destruction of proteins mostly from the plasma membrane and the Golgi. As a result the endosomal system plays a central role in maintaining cell homeostasis, and mutations in genes belonging to this network of organelles interconnected by vesicular transport, cause severe pathologies including cancer and neurobiological disorders. It is therefore of prime relevance to understand the mechanisms underlying the biogenesis and organization of the endosomal system. The yeast Saccharomyces cerevisiae has been pivotal in this task. To specifically label and analyze at the ultrastructural level the endosomal system of this model organism, we present here a detailed protocol for the positively charged nanogold uptake by spheroplasts followed by the visualization of these particles through a silver enhancement reaction. This method is also a valuable tool for the morphological examination of mutants with defects in endosomal trafficking. Moreover, it is not only applicable for ultrastructural examinations but it can also be combined with immunogold labelings for protein localization investigations.

Yeast, Saccharomyces cerevisiae, has been a key model organism to identify and study genes regulating the biogenesis and functions of the endosomal system. Here we present a detailed protocol for the specific labeling of the endosomal compartments for ultrastructural studies.

Nanogold Markierung der Hefe Endosomale System für Ultrastrukturanalysen

Endosomes are one of the major membrane sorting checkpoints in eukaryotic cells and they regulate recycling or destruction of proteins mostly from the ...

Isolating Potentiated Hsp104 Variants Using Yeast Proteinopathy Models

Many protein-misfolding disorders can be modeled in the budding yeast Saccharomyces cerevisiae. Proteins such as TDP-43 and FUS, implicated in amyotrophic lateral sclerosis, and &#945;-synuclein, implicated in Parkinson&#8217;s disease, are toxic and form cytoplasmic aggregates in yeast. These features recapitulate protein pathologies observed in patients with these disorders. Thus, yeast are an ideal platform for isolating toxicity suppressors from libraries of protein variants. We are interested in applying protein disaggregases to eliminate misfolded toxic protein conformers. Specifically, we are engineering Hsp104, a hexameric AAA+ protein from yeast that is uniquely capable of solubilizing both disordered aggregates and amyloid and returning the proteins to their native conformations. While Hsp104 is highly conserved in eukaryotes and eubacteria, it has no known metazoan homologue. Hsp104 has only limited ability to eliminate disordered aggregates and amyloid fibers implicated in human disease. Thus, we aim to engineer Hsp104 variants to reverse the protein misfolding implicated in neurodegenerative disorders. We have developed methods to screen large libraries of Hsp104 variants for suppression of proteotoxicity in yeast. As yeast are prone to spontaneous nonspecific suppression of toxicity, a two-step screening process has been developed to eliminate false positives. Using these methods, we have identified a series of potentiated Hsp104 variants that potently suppress the toxicity and aggregation of TDP-43, FUS, and &#945;-synuclein. Here, we describe this optimized protocol, which could be adapted to screen libraries constructed using any protein backbone for suppression of toxicity of any protein that is toxic in yeast.

Yeast proteinopathy models are valuable tools to assess the toxicity and aggregation of proteins implicated in disease. Here, we present methods for screening Hsp104 variant libraries for toxicity suppressors. This protocol could be adapted to screen any protein library for toxicity suppressors of any protein that is toxic in yeast.

Isolieren Potenzierte Hsp104 Varianten unter Verwendung von Hefe Proteinopathy Models

Many protein-misfolding disorders can be modeled in the budding yeast Saccharomyces cerevisiae. Proteins such as TDP-43 and FUS, implicated in amyotrophic ...

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific eukaryotic genome engineering. CRISPR/Cas9 is an inexpensive, facile, and efficient genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple methodology for CRISPR design, cloning, and delivery for the production of genomic deletions. In addition, we describe techniques for deletion, identification, and characterization. This strategy relies on cellular delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a locus in order to delete the intervening DNA segment by non-homologous end joining (NHEJ) repair. Deletions have potential advantages as compared to single-site small indels given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function, and utility for the study of non-coding elements. This approach can be used for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines.

CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

Generierung von Genomic Löschungen in Säugerzelllinien über CRISPR / Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

Applications of pHluorin for Quantitative, Kinetic and High-throughput Analysis of Endocytosis in Budding Yeast

Green fluorescent protein (GFP) and its variants are widely used tools for studying protein localization and dynamics of events such as cytoskeletal remodeling and vesicular trafficking in living cells. Quantitative methodologies using chimeric GFP fusions have been developed for many applications; however, GFP is somewhat resistant to proteolysis, thus its fluorescence persists in the lysosome/vacuole, which can impede quantification of cargo trafficking in the endocytic pathway. An alternative method for quantifying endocytosis and post-endocytic trafficking events makes use of superecliptic pHluorin, a pH-sensitive variant of GFP that is quenched in acidic environments. Chimeric fusion of pHluorin to the cytoplasmic tail of transmembrane cargo proteins results in a dampening of fluorescence upon incorporation of the cargo into multivesicular bodies (MVBs) and delivery to the lysosome/vacuole lumen. Thus, quenching of vacuolar fluorescence facilitates quantification of endocytosis and early events in the endocytic pathway. This paper describes methods using pHluorin-tagged cargos for quantification of endocytosis via fluorescence microscopy, as well as population-based assays using flow cytometry.

Accurate quantification of vesicular trafficking events often provides key insights into roles for specific proteins and the effects of mutations. This paper presents methods for using superecliptic pHluorin, a pH-sensitive GFP variant, as a tool for quantification of endocytic events in living cells using quantitative fluorescence microscopy and flow cytometry.

Anwendungen von pHluorin für Quantitative, Kinetic und Hochdurchsatz-Analyse von Endozytose in Bäckerhefe

Green fluorescent protein (GFP) and its variants are widely used tools for studying protein localization and dynamics of events such as cytoskeletal ...