Die Autoren bedanken sich bei Branden Moriarity, David Largaespada und Vincent Keng an der University of Minnesota danken und Adam Dupuy an der University of Iowa für ihre Unterstützung bei der Entwicklung des oben beschriebenen Protokoll.

Ein. Zucht und Altern von transgenen Tieren <ol><li> Wählen Sie die Stämme von transgenen Mäusen für Ihre Experiment. Ein typisches Experiment werden drei transgenen Linien; ein bedingter Transposase Maus, eine Maus beherbergen ein Konkatamer von Transposons, und eine Maus die Cre-Rekombinase in den Zellen vermutlich die Zellen des Ursprungs für die gewünschte Krebs. Wenn sich der Krebs zu modellierenden weist eine bekannte Mutation in einem großen Prozentsatz der Patienten kann es erwünscht sein, diese Mutation zu Beginn umfassen. Beispiele für diese &quot;prädisponierenden&quot; Mutationen sind aktiviert Kras, dominant negative TP53 oder eine floxed Pten Allel. Durch die Zugabe in einer prädisponierenden Mutation kann das Modell besser repräsentieren die menschliche Krebs (siehe 1.3). Mehrere Sleeping Beauty Transposase und Transposon-Mäuse sind von der National Cancer Institute Maus Repository (verfügbar <a href="http://mouse.ncifcrf.gov/" target="_blank">http://mouse.ncifcrf.gov/</a> ). </li><li> Breed bedingte Transposase Mäuse mit Mäusen beherbergt die Transposons, um schließlich zu erhalten Mäusen homozygot für beide Allele, wenn möglich. Breed homozygote Nachkommen zu Mäusen, die Cre-Rekombinase Ihre dreifach transgene Versuchsmäusen (Abbildung 2) zu erzeugen. Hinweis: Beziehen homozygote Mäuse sind nicht immer möglich oder ideal. Beispielsweise sind homozygot p53 dominant negative Mäusen viel schwieriger als heterozygote Mäuse zu züchten. Darüber hinaus ist es hilfreich, um sicherzustellen, dass Würfe Mendelschen Genetik folgen, um zu bestätigen, dass die Züchtungsschema erfolgreich ist. </li><li> Bei Verwendung einer Prädisposition Hintergrund, erste Rasse Mäuse mit der Transposase an Mäusen mit dem prädisponierende Allel. Gleichzeitig Ausdruck Rasse Mäusen Cre-Rekombinase, um Mäuse, die Transposons. Erstellen homozygote Mäuse für jedes Allel, wenn möglich. Schließlich züchten die homozygote Nachkommen aus den beiden vorangegangenen Zuchtprogramme zu vervierfachen transgenen experimentellen anim erzeugenALS. </li><li> Neben den Versuchstieren, erzeugen Kontrollkohorten von Mäusen. Die Kontrollgruppe besteht normalerweise aus Wurfgeschwistern aus dem experimentellen Zucht, die nur erben zwei der drei Allele (Abbildung 2). Im Falle eines prädisponiert Hintergrund wird Mäusen einschließlich drei der vier Allele auch notwendig sein. </li><li> Überwachen Versuchs-und Kontrollmäusen täglich für Tumor-Entwicklung und / oder Siechtum. Folgen Sie Ihrem institutionelle Pflege der Tiere und die Nutzung Ausschuss (IACUC) Anforderungen für die Tierhaltung. Auch ist es üblich, ein Alter, in dem man ein Tier zu opfern, wenn es nicht noch geworden moribund bestimmen. Achtzehn Monate ist ein typisches Alter, in dem Mäuse eingeschläfert. </li></ol> 2. Necropsy transgener Tiere <table border="1"><tbody><tr><td> Name des Reagenzes </td><td> Firma </td><td> Katalog-Nummer </td></tr><tr><td> Sure-Seal Induction Kammer </td><td> Gehirn-Baum Scientific </td><td> EZ-177 </td></tr><tr><td> Cryovial </td><td> Bioexpress </td><td> C-3355-2 </td></tr><tr><td> 10% gepuffertem Formalin </td><td> Sigma Aldrich </td><td> HT501128-4L </td></tr></tbody></table> Tabelle 1. Reagenzien benötigt. <ol><li> Wenn eine Maus moribund ist oder hat das Ende des ermittelten Lebensdauer, einschläfern Tier mit einem CO 2-Kammer nach Ihrer IACUC Richtlinien. Generell stellen das Tier in einer Reingaskammer, öffnen Sie den Gastank und stellen Sie den Regler auf nicht höher als 5 Pfund pro Quadratzoll zu lesen. Füllen Sie langsam auf Nasen-und Augenreizungen und Abneigung gegen CO 2 zu minimieren. Stellen Sie sicher, dass das Tier das Herz nicht mehr schlagen und reagiert nicht, wenn in den Augen berührt. </li><li> Spray Äußeren geopfert Maus mit 70% Ethanol. </li><li> Bewegen Sie die Maus auf einer Autopsie Bord und befestigen Sie sie mit Sezieren Pins. Mit einer Schere eind Pinzette zu öffnen Maus und Organe entnehmen. Die Festlegung, welche Organe sollten gesammelt werden ist ein Projekt abhängig. Es wird jedoch empfohlen, immer sammeln die Milz und Leber als diese Organe geben oft wichtige Einblick, warum die Maus war moribund. Sammeln Sie auch das Brustbein zur Potenzialanalyse von Knochenmark. Darüber hinaus ist es immer günstig für jedes Organ oder Gewebe, das abnormale erscheint sammeln. </li><li> Geweben und Tumoren, die gesammelt werden sollte in vier Abschnitte unterteilt werden. Ein Abschnitt wird in 10% gepuffertem Formalin für 18 Stunden um 70% Ethanol. Dieser Abschnitt kann für H &amp; E-Färbung und / oder IHC eingesetzt werden. Die verbleibenden drei Abschnitten, die im allgemeinen 50 bis 100 mg in der Größe sind Schnappverbindung in flüssigem Stickstoff eingefroren. Diese können für die DNA-, RNA-und Protein-Isolierung verwendet werden. </li><li> Entsorgen Karkasse und dem restlichen Gewebe nach IACUC Richtlinien. </li></ol> 3. Isolieren genomischer DNA aus Tumoren <table border="1"><tbody><tr><td> &lt;strong&gt; Name des Reagenzes </td><td> Firma </td><td> Katalog-Nummer </td></tr><tr><td> Protein Precipitation Lösung </td><td> Qiagen </td><td> 158910 </td></tr><tr><td> Zelllysepuffer </td><td> Qiagen </td><td> 158906 </td></tr><tr><td> Proteinase K </td><td> Qiagen </td><td> 158920 </td></tr><tr><td> RNase A </td><td> Qiagen </td><td> 158924 </td></tr><tr><td> TE-Puffer </td><td> Promega </td><td> V6232 </td></tr></tbody></table> Tabelle 2. Reagenzien benötigt. <ol><li> Fein zerkleinern das gefrorene Tumorprobe (50 bis 100 mg) mit einem sauberen Rasierklinge. </li><li> Ort zerkleinert Gewebe in einem 1,5 ml Mikrozentrifugenröhrchen und 1 ml der Zell-Lyse-Puffer mit 5 ul Proteinase K-Lösung (20 mg / ml). </li><li> Vortex gründlich. </li><li> Inkubieren in einem 55 ° C Schüttler bei 250 rpm eingestellt für mindestens 4 Stunden, am besten über Nacht. </li><li> Fügen Sie 1 ul RNase A-Lösung (10 mg / ml) und invertieren Rohr 25 mal. </li><li> Bei 37 ° C für 30 min. </li><li> Abkühlen auf Raumtemperatur durch Anordnen auf Eis für 3 min. </li><li> Fügen Sie 333 ul Protein Precipitation Lösung und Vortex kräftig. </li><li> Zentrifuge bei 14.000 rpm 10 min. Proteine ​​sollten Pellet. Wenn Pellet ist sehr klein, Wirbel wieder auf Eis inkubieren für 5 min und dann re-Zentrifuge. </li><li> Giesst Überstand enthaltende DNA in ein sauberes 15-ml-Zentrifugenröhrchen. </li><li> Fügen gleichen Volumen 100% Isopropanol und mischen durch vorsichtiges Umdrehen 50 mal. </li><li> Zentrifuge bei 3.500 rpm für 3 min. </li><li> Überstand verwerfen. </li><li> 1 ml 70% Ethanol und invertieren Röhrchen mehrmals um das Pellet zu waschen. </li><li> Übertragen des gewaschenen Pellet zusammen mit dem Ethanol zu einem 1,5 ml Mikrozentrifugenröhrchen. </li><li> Zentrifugieren bei 14.000 UpM für 5 min bei 4 ° C. </li><li> Abgießen Ethanol und invertieren Rohr an der Luft trocknen (ca. 5 bis 30 min). </li><li> Resuspendieren DNA pEllet in 50 bis 500 ul TE je nach Größe der DNA-Pellet. </li><li> Optional Inkubation bei 37 ° C zu resuspendieren DNA. </li><li> Lagerung bei 4 ° C oder -20 ° C für die langfristige Lagerung. </li></ol> 4. Linker Mediated-PCR unter Verwendung von genomischer DNA aus Tumoren <table border="1"><tbody><tr><td> Name des Reagenzes </td><td> Firma </td><td> Katalog-Nummer </td></tr><tr><td> BfaI </td><td> New England Biolabs </td><td> R0568S </td></tr><tr><td> NlaIII </td><td> New England Biolabs </td><td> R0125S </td></tr><tr><td> MinElute Platten mit 96 Vertiefungen </td><td> Qiagen </td><td> 28051 </td></tr><tr><td> QIAvac 96 Vakuumkammer </td><td> Qiagen </td><td> 19504 </td></tr><tr><td> Multi-MicroPlate Genie, 120V </td><td> Scientific Industries, Inc. </td><td> SI-4000 </td></tr><tr><td> T4 DNA-Ligase mit 5x Ligationspuffer </td><td> Invitrogen </td><html><td> 15224-041 </td></tr><tr><td> BamHI </td><td> New England Biolabs </td><td> R0136S </td></tr><tr><td> 25 mM dNTPs </td><td> Bioexpress </td><td> C-5014-200 </td></tr><tr><td> Platinum Taq </td><td> Invitrogen </td><td> 10966-034 </td></tr><tr><td> FastStart Taq DNA Polymerase </td><td> Roche </td><td> 12032929001 </td></tr><tr><td> Agarose </td><td> Promega </td><td> V3121 </td></tr><tr><td> TAE-Puffer </td><td> Promega </td><td> V4271 </td></tr><tr><td> TE-Puffer </td><td> Promega </td><td> V6232 </td></tr><tr><td> Ethidiumbromid </td><td> Promega </td><td> H5041 </td></tr></tbody></table> Tabelle 3. Reagenzien benötigt. Linkersequenzen BfaI Linker + 5 &#39;GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3&#39; BfaI Linker-5 &#39;-Phos TAGTCCCTTAAGCGGAG 3&#39;NH2 &quot;&gt; Linker NlaIII + 5&#39;GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 &#39; NlaIII Linker-5 &#39;-Phos GTCCCTTAAGCGGAGCC 3&#39; Primersequenzen Primäre PCR vorne rechts (NlaIII): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC Primäre PCR vorne links (bfai): Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC Primäre PCR Reverse sowohl für links und rechts: Spl Link1 1 GTAATACGACTCACTATAGGGC Sekundären PCR vorderen rechten Seite: Beispiel einer Illumina strichcodierten sekundären Primer 5 &#39;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (Ns Die Betreiber der 12 bp Barcode-Sequenz in Großbuchstaben sind für die Plattform erforderlich Illumina und die Sequenz in Kleinbuchstaben wird dem Transposon binden.) Sekundäre PCR vorne links: Beispiel einer Illumina strichcodiert gebrauchtdary Primer 5&#39;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (Ns Die Betreiber der 12 bp Barcode-Sequenz in Großbuchstaben sind für die Plattform erforderlich Illumina und die Sequenz in Kleinbuchstaben wird dem Transposon binden.) Sekundäre PCR Reverse sowohl für links und rechts: Linker verschachtelte Rückwärtsprimer 5 &#39;CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC <ol><li> Glühen die + und - Linker für beide BfaI Linker und NlaII Linker durch Mischen von 50 ul von Linker + (100 uM) mit 50 ul Linker-(100 uM) und fügen Sie 2 ul NaCl (5 M) in einem 1,5 ml Mikrozentrifugenröhrchen. Place in 95 ° C Heizblock für 5 min. Schalten Sie Heizblock und lassen sich langsam auf Raumtemperatur abkühlen (dies dauert eine Stunde oder mehr). Nach dem Abkühlen kann geglühten Linker in einem -20 ° C-Gefrierschrank gelagert werden, bis sie benötigt. </li><li> Bereiten Sie zwei Aliquots der Tumor-DNA, jedes Aliquot mit 1 ug DNA. Ein Aliquot wird wit verdaut werdenha Restriktionsenzym, das in der Nähe des &quot;richtigen&quot; Ende des Transposons geschnitten wird. Das zweite Aliquot wird mit einem Restriktionsenzym, das in der Nähe des &quot;linken&quot; Ende des Transposons schneidet verdaut werden. Dies geschieht, um die Chancen Verstärken jedes Transposon Insertionsstelle maximieren. </li><li> Verdauen die Tumor-DNA in einem aliquoten mit der &quot;richtigen&quot; Seite Enzym NlaII und verdauen die Tumor-DNA in der anderen Aliquot mit der &quot;linken&quot; Seite Enzym BfaI: Kombinieren Sie 1 ul Enzym, 5 ul 10x NEB Buffer # 4, DNA ( 1 ug) und ddH 2 O auf ein Gesamtvolumen von 50 ul. Ausgewählte DNA über Nacht bei 37 ° C im Wasserbad oder Inkubator. </li><li> Hitzeeinwirkung deaktivieren Enzyme (BfaI = 80 ° C für 20 min, NlaIII = 65 ° C für 20 min). </li><li> Reinigen Sie die verdauten Proben, indem Proben in MinElute 96-Well-Platte, schauen Platzteller in Vakuumkammer und Vakuum für ca. 15 min bis zum Brunnen trocken. </li><li> Entfernen Platte von Vakuum-Verteiler und blot unteren 96-Well-Platte mit einem Papiertuch, um alle liqui entfernend </li><li> Fügen Sie 30 ul ddH 2 O in jede Vertiefung und schütteln auf einem Orbitalschüttler Satz auf hoch für 2 min, oder und Abpipettieren 20 bis 40 mal. </li><li> Übertragen gesamte Volumen in Brunnen (30 ul) von MinElute 96-Well-Platte in einen sauberen 96-Well-Platten. </li><li> Führen Linkerligation Reaktionen mit verdaute DNA von Schritt 4,8 und Linker von Schritt 4,1. Mix 10 ul verdaute DNA, 4 ul 5x Ligationspuffer 5,5 ul geglüht Linker (950 ug / ul), 0,5 ul T4-Ligase (5 U / ul). </li><li> Inkubieren für 4 Stunden bis über Nacht bei 16 ° C. </li><li> Erhitzen inaktivieren die T4-DNA-Ligase bei 65 ° C für 10 min. </li><li> Clean up Ligation mit MinElute 96-Well-Platten und eine Vakuumkammer wie in den Schritten 4.5 beschrieben - 4,6. </li><li> Resuspendieren in 30 ul H 2 O und übertragen auf eine saubere 96-Well-Platte. </li><li> Führen Sie eine zweite DNA-Verdau, um zu zerstören verbleibenden Konkatamer Transposons. Dies wird durch das Schneiden der DNA ein zweites Mal unter Verwendung eines Enzyms, das die Plasmid v schneidet erreichtektor DNA, die verwendet werden, um die transgenen Mäuse der das Transposon enthaltenden Konkatamer erstellen. </li><li> Ausgewählte DNA mit BamHI (links und rechts): Mix von 25 ul Linker-ligierten DNA aus Schritt 4,13, 5 ul 10x NEB Puffer Nr. 3, 0,5 ul BamHI (20 U / ul), 0,5 ul BSA (10 mg / ml ) und 19 ul ddH 2 O. </li><li> Ausgewählte 3-6 Stunden oder über Nacht bei 37 ° C. </li><li> Führen primären PCR unter Verwendung eines Primers spezifisch für das Transposon und einem Primer, die spezifisch für den Linker. Diese variieren je nachdem, was Transposon und Linker die Sie verwenden. Die Primer in dem Primer obigen Tabelle für die Arbeit und T2/Onc T2/Onc2 Transposons aufgeführt. </li><li> Primäre PCR: 5 ul 10x Puffer, 2,0 ul MgCl2 (50 mM), 4 ul dNTPs (2,5 nM), 1 ul Primer 1 (20 uM), 1 ul Primer 2 (20 uM), 0,25 ul Platinum Taq (5 U / ul), 3 ul verdaute DNA mit Linker (Betrag kann variieren) bis zu 50 ul ddH 2 O. </li><li> PCR-Programm: 94 ° C für 5 min, 30 Zyklen von 94 ° C für 30 sec, 60 &amp; d.zB, C für 30 sec, 72 ° C für 90 sek. Abschließende Extension bei 72 ° C für 5 min. </li><li> Bereinigen PCR-Produkt unter Verwendung MinElute 96 Well Platten und einen Vakuumverteiler, wie oben beschrieben. </li><li> Resuspendieren in 30 ul H 2 O und übertragen auf eine saubere 96-Well-Platte. </li><li> Einen 1:75 Verdünnung der 1 ° PCR durch Verdünnen von 2 ul DNA aus Schritt in 148 ul 4,21 ddH 2 O </li><li> Führen sekundären PCR unter Verwendung verschachtelte Versionen der Primer, der auch die erforderliche Sequenz für das Illumina GAIIx Maschine sowie eine 12 Basenpaar Barcode, der einzigartig für jede Tumorprobe verarbeitet (siehe Tabelle oben Primer für Beispiele dieser Primer) ist. </li><li> Sekundäre PCR: 10 ul 10x Puffer mit MgCl2, 8 ul dNTPs (2,5 mM), 1 ul Illumina strichcodiert sekundären Primer (20 uM), 1 ul Illumina Nest 1 sekundäre Primer (20 uM), 0,25 ul FastStart Taq (5 U / ul ), 2 ul DNA aus verdünnten primären PCR 1:75, bis 100 ul ddH 2 O. </li><li> PCR-Programm: 94 °, C für 2 min, 30 Zyklen von 94 ° C für 30 sec, 53 ° C für 45 sec, 72 ° C für 90 sek. Abschließende Extension bei 72 ° C für 5 min. </li><li> Ausführen 45 ul dieser PCR-Reaktion auf einem 1% Agarosegel mit Ethidiumbromid (0,5 mg / ml). Es sollte ein &quot;schmieren&quot; von PCR-Produkten vertreten Amplikons der vielen verschiedenen Transposon-Insertionen in den Tumor (Abbildung 3). </li><li> Bereinigen restlichen 50 ul PCR-Produkt unter Verwendung MinElute 96 Well Platten und einen Vakuumverteiler, wie oben beschrieben. Waschen einer Zeit, indem 50 pl ddH 2 O in den Vertiefungen und Absaugen wieder. </li><li> Resuspendieren in 30 ul TE und übertragen auf eine saubere 96-Well-Platte. </li><li> Bestimmung der Konzentration von DNA in jeder Probe. Kombinieren gleiche Mengen an DNA in einer einzelnen 1,5-ml-Mikrozentrifugenröhrchen. Dies wird die Bibliothek, die in einem einzigen Spur einer Illumina HiSeq 2000 Maschine sequenziert werden. Es ist möglich, mehrere hundert Tumoren Sequenz in einer einzelnen Spur einer Illumina Lauf. </li><li> Einreichendie einzelnen Röhrchen mit gleichen Mengen von DNA aus allen Tumoren zur Sequenzierung. Dies kann durch Ihre Institution oder kommerziell durchgeführt werden. </li></ol> 5. Analyse der Transposon Insertions <ol><li> Software zur Analyse von Transposon-Insertion Daten verfügbar zum kostenlosen Download via SourceForge ( <a href="http://sourceforge.net/projects/tapdancebio/" target="_blank">http://sourceforge.net/projects/tapdancebio/</a> ). Das Programm, genannt Tapdance erfordert die Sequenz-Datei von der Illumina-Plattform und einem Barcode-Bibliothek Karte Textdatei. </li></ol>

<ol>
	<li>Fearon, E. R., Vogelstein, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+model+for+colorectal+tumorigenesis.">A genetic model for colorectal tumorigenesis.</a> Cell. 61, 759-767 (1990).</li><li>Wood, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Genomic+Landscapes+of+Human+Breast+and+Colorectal+Cancers.">The Genomic Landscapes of Human Breast and Colorectal Cancers.</a> Science. 318, 1108-1113 (2007).</li><li>Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsv&#225;k, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+Reconstruction+of+Sleeping+Beauty,+a+Tc1-like+Transposon+from+Fish,+and+Its+Transposition+in+Human+Cells.">Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells.</a> Cell. 91, 501-510 (1997).</li><li>Starr, T. K., Largaespada, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+gene+discovery+using+the+Sleeping+Beauty+transposon.">Cancer gene discovery using the Sleeping Beauty transposon.</a> Cell Cycle. 4, 1744-1748 (2005).</li><li>Mueller, P. R., Wold, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Footprinting+of+a+Muscle+Specific+Enhancer+by+Ligation+Mediated+PCR.">In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR.</a> Science. 246, 780-786 (1989).</li><li>Bergemann, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+methods+for+finding+common+insertion+sites+and+co-occurring+common+insertion+sites+in+transposon-+and+virus-based+genetic+screens.">New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens.</a> Nucleic acids research. 40, 3822-3833 (2012).</li><li>Copeland, N. G., Jenkins, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Harnessing+transposons+for+cancer+gene+discovery.">Harnessing transposons for cancer gene discovery.</a> Nature Reviews Cancer. 10, 696-706 (2010).</li><li>Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+gene+discovery+in+solid+tumours+using+transposon-based+somatic+mutagenesis+in+the+mouse.">Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse.</a> Nature. 436, 272-276 (2005).</li><li>Starr, T. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transposon-based+genetic+screen+in+mice+identifies+genes+altered+in+colorectal+cancer.">A transposon-based genetic screen in mice identifies genes altered in colorectal cancer.</a> Science. 323, 1747-1750 (2009).</li><li>Keng, V. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+transposon-based+insertional+mutagenesis+screen+for+genes+associated+with+mouse+hepatocellular+carcinoma.">A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma.</a> Nature. 27, 264-274 (2009).</li><li>Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+mutagenesis+using+a+highly+mobile+somatic+Sleeping+Beauty+transposon+system.">Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system.</a> Nature. 436, 221-226 (2005).</li></ol>

Die Autoren haben nichts zu offenbaren.

Eine vorausschauende genetische Bildschirm mit dem Dornröschen Transposon-System bietet eine Methode zur Identifizierung von Mutationen, die Krebs verursachen. Durch Auswahl des geeigneten Promotors mit Cre-Rekombinase zusätzlich zu irgendwelchen Mutationen prädisponierende steuern, wird der Bildschirm zu identifizieren SB bekannten und neuartigen Kandidaten Krebsgene. Der Erfolg einer SB-Bildschirm ist weitgehend abhängig von den Mäusen für die Erstellung des Bildsch...

<table border="1"><tbody><tr><td> Name des Reagenzes </td><td> Firma </td><td> Katalog-Nummer </td><td> Kommentare (optional) </td></tr><tr><td> Sure-Seal Induction Kammer </td><td> Gehirn-Baum Scientific </td><td> EZ-177 </td><td></td></tr><tr><td> Cryovial </td><td> Bioexpress </td><td> C-3355-2 </td><td></td></tr><tr><td> 10% gepuffertem Formalin </td><td> Sigma Aldrich </td><td> HT501128-4L </td><td></td></tr><tr><td> Protein Precipitation Lösung </td><td> Qiagen </td><td> 158910 </td><td></td></tr><tr><td> Zelllysepuffer </td><td> Qiagen </td><td> 158906 </td><td></td></tr><tr><td> Proteinase K </td><td> Qiagen </td><td> 158920 </td><td></td></tr><tr><td> RNase A </td><td> Qiagen </td><td> 158924 </td><td></td></tr><tr><td> TE-Puffer </td> &lt;td&gt; Promega </td><td> V6232 </td><td></td></tr><tr><td> BfaI </td><td> New England Biolabs </td><td> R0568S </td><td></td></tr><tr><td> NlaIII </td><td> New England Biolabs </td><td> R0125S </td><td></td></tr><tr><td> MinElute Platten mit 96 Vertiefungen </td><td> Qiagen </td><td> 28051 </td><td></td></tr><tr><td> QIAvac 96 Vakuumkammer </td><td> Qiagen </td><td> 19504 </td><td></td></tr><tr><td> Multi-MicroPlate Genie, 120V </td><td> Scientific Industries, Inc. </td><td> SI-4000 </td><td></td></tr><tr><td> T4 DNA-Ligase mit 5x Ligationspuffer </td><td> Invitrogen </td><td> 15224-041 </td><td></td></tr><tr><td> BamHI </td><td> New England Biolabs </td><td> R0136S </td><td></td></tr><tr><td> 25mM dNTPs </td><td> Bioexpress </td><td> C-5014-200 </td><td></td></tr><tr><td> Platinum Taq </td><td> Invitrogen </td><td&gt; 10966-034 </td><td></td></tr><tr><td> FastStart Taq DNA Polymerase </td><td> Roche </td><td> 12032929001 </td><td></td></tr><tr><td> Agarose </td><td> Promega </td><td> V3121 </td><td></td></tr><tr><td> TAE-Puffer </td><td> Promega </td><td> V4271 </td><td></td></tr><tr><td> TE-Puffer </td><td> Promega </td><td> V6232 </td><td></td></tr><tr><td> Ethidiumbromid </td><td> Promega </td><td> H5041 </td><td></td></tr></tbody></table>

identification of sleeping beauty transposon insertions in solid tumors using linker-mediated pcr

Genomik, Proteomik, Transkriptom und epigenomischen Analysen von menschlichen Tumoren zeigen, dass es Tausende von Anomalien innerhalb der einzelnen Krebs-Genom im Vergleich zum angepassten normalem Gewebe. Basierend auf diesen Untersuchungen ist es offensichtlich, dass es viele unentdeckte genetischen Fahrer von Krebs ein. Leider sind diese Treiber sind in einer viel größeren Anzahl von Personen Anomalien im Genom, die nicht direkt zur Tumorbildung beitragen versteckt. Ein weiterer Aspekt der Krebsgenoms ist, dass es erhebliche genetische Heterogenität innerhalb ähnlicher Tumorarten. Jeder Tumor kann beherbergen verschiedene Mutationen, die einen selektiven Vorteil für die Tumorbildung 2 bereitzustellen. Durchführen eines unvoreingenommene vorne genetischen Screen bei Mäusen liefert die Werkzeuge, um Tumore zu generieren und zu analysieren, ihre genetische Zusammensetzung, bei gleichzeitiger Reduzierung der Hintergrund der Passagier Mutationen. The Sleeping Beauty (SB) Transposonsystem ist eine solche Methode 3. Das SB-System nutzt mobilen vektoren (Transposons), die über das Genom von der Transposase-Enzym eingesetzt werden kann. Mutationen werden auf einen bestimmten Zelltyp durch die Verwendung eines bedingten Transposase-Allel, die durch Cre-Rekombinase aktiviert ist begrenzt. Viele Mauslinien bestehen, dass ausdrückliche Cre-Rekombinase in bestimmten Geweben. Durch die Kreuzung eine dieser Leitungen zu dem bedingten Transposase Allels (zB Lox-Stop-Lox-SB11) wird der SB-System nur in Zellen, die Cre-Rekombinase ausdrückliche aktiviert. Die Cre-Rekombinase wird verbrauchsteuerpflichtigen einen Anschlag Kassette dass Blöcke Expression der Transposase-Allel und aktiviert damit Transposon-Mutagenese innerhalb der bezeichneten Zelltyp. Ein SB-Bildschirm wird durch Züchtung drei Stämmen von transgenen Mäusen eingeleitet, so dass die experimentelle Mäuse eine bedingte Transposase-Allel, ein Konkatamer von Transposons, und einen Gewebe-spezifischen Rekombinase Cre-Allel tragen. Diese Mäuse sind auf das Alter, bis die Tumoren Form erlaubt und werden sie verenden. Die Mäuse werden dannseziert und genomische DNA wird aus den Tumoren isoliert. Als nächstes wird die genomische DNA-Linker-vermittelten-PCR unterzogen (LM-PCR), die zu Amplifikation von genomischen Loci, die ein Transposon SB. LM-PCR durchgeführt auf einem einzigen Tumor in Hunderten von verschiedenen Amplikons, die die Hunderte von genomischen Loci mit Transposon-Insertionen in einem Tumor 4 führen. Die Transposon-Insertionen in allen Tumoren analysiert und gemeinsame Insertionsstellen (CISS) identifiziert werden unter Verwendung eines geeigneten statistischen Methode 5. Gene innerhalb der GUS sind sehr wahrscheinlich Onkogene oder Tumor-Suppressor-Gene, und gelten als Kandidaten Krebsgene. Die Vorteile der Verwendung des Systems, um Kandidaten SB Krebsgene identifiziert sind: 1) das Transposon kann leicht im Genom lokalisiert werden, weil seine Sequenz bekannt ist, 2) die Umsetzung kann auf nahezu jeden Zelltyp gerichtet sein und 3) das Transposon in der Lage ist Einführung sowohl Gewinn-und Verlust-of-function Mutationen 6. Die following Protokoll beschreibt, wie die Entwicklung und Umsetzung eine vorausschauende genetische Bildschirm mit dem SB Transposon System Kandidaten Krebsgene (Abbildung 1) zu identifizieren.

Nach dem Züchtungsschema festgestellt wurde, sollten Züchter produzieren einen Wurf alle 19-21 Tage. Wurfgröße variiert zwischen 5 und 12 Welpen, je nach dem Alter der Züchter und den genetischen Hintergrund. Darüber hinaus stellen Sie sicher, dass der Genotyp des Wurfes Mendelschen Genetik folgt als einen Weg, um zu bestätigen, dass die Züchtungsschema als richtig und erfolgreich ist. Für das Experiment erfolgreich zu sein, sollte Tumorinzidenz bei den Versuchstieren deutlich grö?...

Watch this Scientific Journal Video about Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR at JoVE.com

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

Verfahren zur Identifizierung unbekannter Fahrer von Karzinogenese Verwendung eines unvoreingenommene Ansatz beschrieben. Das Verfahren verwendet das<em&gt; Dornröschen</em&gt; Transposon als eine zufällige Mutagen auf spezifische Gewebe. Genomic Mapping von Transposon-Insertionen, die Tumorbildung zu fahren identifiziert neue Onkogene und Tumor-Suppressor-Gene

Identifizierung von<em&gt; Dornröschen</em&gt; Transposon Insertionen in Solid Tumors mit Linker-vermittelte PCR

Genomic, proteomic, transcriptomic, and epigenomic analyses of human tumors indicate that there are thousands of anomalies within each cancer genome ...

identification-sleeping-beauty-transposon-insertions-solid-tumors

Research

JoVE Journal

Medicine

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

14.0K Aufrufe.  University of Minnesota, Minneapolis. Verfahren zur Identifizierung unbekannter Fahrer von Karzinogenese Verwendung eines unvoreingenommene Ansatz beschrieben. Das Verfahren verwendet das Dornröschen Transposon als eine zufällige Mutagen auf spezifische Gewebe. Genomic Mapping von Transposon-Insertionen, die Tumorbildung zu fahren identifiziert neue Onkogene und Tumor-Suppressor-Gene

Serie: Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

Establishment and Propagation of Human Retinoblastoma Tumors in Immune Deficient Mice

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited time. These cultured tumorspheres may exhibit markedly different cellular phenotypes when compared to the original tumors. Demonstration that cultured cells have the capability of forming new tumors is important to ensure that cultured cells model the biology of the original tumor. 
Here we present a protocol for propagating human retinoblastoma tumors in vivo using Rag2-/- immune deficient mice. Cultured human retinoblastoma tumorspheres of low passage or cells obtained from freshly harvested human retinoblastoma tumors injected directly into the vitreous cavity of murine eyes form tumors within 2-4 weeks. These tumors can be harvested and either further passaged into murine eyes in vivo or grown as tumorspheres in vitro. Propagation has been successfully carried out for at least three passages thus establishing a continuing source of human retinoblastoma tissue for further experimentation. 
Wesley S. Bond and Lalita Wadhwa are co-first authors.

A method is described to propagate human retinoblastoma tumors in mice. Tumor cells are directly injected into the eyes of immune deficient mice. Secondary tumors have been successfully established using both cells directly harvested from human tumors and cultured tumorspheres.

Aufbau und Verbreitung der Menschenrechte Retinoblastoma Tumore in immundefizienten Mäuse

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited ...

Forschung

Medizin

Evaluation of Nanoparticle Uptake in Tumors in Real Time Using Intravital Imaging

Current technologies for tumor imaging, such as ultrasound, MRI, PET and CT, are unable to yield high-resolution images for the assessment of nanoparticle uptake in tumors at the microscopic level1,2,3, highlighting the utility of a suitable xenograft model in which to perform detailed uptake analyses. Here, we use high-resolution intravital imaging to evaluate nanoparticle uptake in human tumor xenografts in a modified, shell-less chicken embryo model. The chicken embryo model is particularly well-suited for these in vivo analyses because it supports the growth of human tumors, is relatively inexpensive and does not require anesthetization or surgery 4,5. Tumor cells form fully vascularized xenografts within 7 days when implanted into the chorioallantoic membrane (CAM) 6. The resulting tumors are visualized by non-invasive real-time, high-resolution imaging that can be maintained for up to 72 hours with little impact on either the host or tumor systems. Nanoparticles with a wide range of sizes and formulations administered distal to the tumor can be visualized and quantified as they flow through the bloodstream, extravasate from leaky tumor vasculature, and accumulate at the tumor site. We describe here the analysis of nanoparticles derived from Cowpea mosaic virus (CPMV) decorated with near-infrared fluorescent dyes and/or polyethylene glycol polymers (PEG) 7, 8, 9,10,11. Upon intravenous administration, these viral nanoparticles are rapidly internalized by endothelial cells, resulting in global labeling of the vasculature both outside and within the tumor7,12. PEGylation of the viral nanoparticles increases their plasma half-life, extends their time in the circulation, and ultimately enhances their accumulation in tumors via the enhanced permeability and retention (EPR) effect 7, 10,11. The rate and extent of accumulation of nanoparticles in a tumor is measured over time using image analysis software. This technique provides a method to both visualize and quantify nanoparticle dynamics in human tumors.

We present a novel approach to quantify nanoparticle localization in the vasculature of human xenografted tumors using dynamic, real-time intravital imaging in an avian embryo model.

Evaluation von Nanopartikel-Aufnahme in Tumoren in Echtzeit über Intravital Imaging

Current technologies for tumor imaging, such as ultrasound, MRI, PET and CT, are unable to yield high-resolution images for the assessment of nanoparticle ...

Heterogeneity Mapping of Protein Expression in Tumors using Quantitative Immunofluorescence

Morphologic heterogeneity within an individual tumor is well-recognized by histopathologists in surgical practice. While this often takes the form of areas of distinct differentiation into recognized histological subtypes, or different pathological grade, often there are more subtle differences in phenotype which defy accurate classification (Figure 1). Ultimately, since morphology is dictated by the underlying molecular phenotype, areas with visible differences are likely to be accompanied by differences in the expression of proteins which orchestrate cellular function and behavior, and therefore, appearance. The significance of visible and invisible (molecular) heterogeneity for prognosis is unknown, but recent evidence suggests that, at least at the genetic level, heterogeneity exists in the primary tumor1,2, and some of these sub-clones give rise to metastatic (and therefore lethal) disease. 
Moreover, some proteins are measured as biomarkers because they are the targets of therapy (for instance ER and HER2 for tamoxifen and trastuzumab (Herceptin), respectively). If these proteins show variable expression within a tumor then therapeutic responses may also be variable. The widely used histopathologic scoring schemes for immunohistochemistry either ignore, or numerically homogenize the quantification of protein expression. Similarly, in destructive techniques, where the tumor samples are homogenized (such as gene expression profiling), quantitative information can be elucidated, but spatial information is lost. Genetic heterogeneity mapping approaches in pancreatic cancer have relied either on generation of a single cell suspension3, or on macrodissection4. A recent study has used quantum dots in order to map morphologic and molecular heterogeneity in prostate cancer tissue5, providing proof of principle that morphology and molecular mapping is feasible, but falling short of quantifying the heterogeneity. Since immunohistochemistry is, at best, only semi-quantitative and subject to intra- and inter-observer bias, more sensitive and quantitative methodologies are required in order to accurately map and quantify tissue heterogeneity in situ.
We have developed and applied an experimental and statistical methodology in order to systematically quantify the heterogeneity of protein expression in whole tissue sections of tumors, based on the Automated QUantitative Analysis (AQUA) system6. Tissue sections are labeled with specific antibodies directed against cytokeratins and targets of interest, coupled to fluorophore-labeled secondary antibodies. Slides are imaged using a whole-slide fluorescence scanner. Images are subdivided into hundreds to thousands of tiles, and each tile is then assigned an AQUA score which is a measure of protein concentration within the epithelial (tumor) component of the tissue. Heatmaps are generated to represent tissue expression of the proteins and a heterogeneity score assigned, using a statistical measure of heterogeneity originally used in ecology, based on the Simpson's biodiversity index7.
To date there have been no attempts to systematically map and quantify this variability in tandem with protein expression, in histological preparations. Here, we illustrate the first use of the method applied to ER and HER2 biomarker expression in ovarian cancer. Using this method paves the way for analyzing heterogeneity as an independent variable in studies of biomarker expression in translational studies, in order to establish the significance of heterogeneity in prognosis and prediction of responses to therapy.

Here we describe a method to quantify molecular heterogeneity in histological sections of tumor material using quantitative immunofluorescence, image analysis, and a statistical measure of heterogeneity. The method is intended for use in clinical biomarker development and analysis.

Heterogenität Mapping von Protein Expression in Tumoren mittels quantitativer Immunfluoreszenz

Morphologic heterogeneity within an individual tumor is well-recognized by histopathologists in surgical practice. While this often takes the form of ...

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR (qPCR)

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process including development1, apoptosis2, and cell cycle regulation3. MiRNAs are estimated to regulate the expression of 30% to 90% of human genes4 by binding to their target messenger RNAs (mRNAs)5. Widespread dysregulation of miRNAs has been reported in various diseases and cancer subtypes6. Due to their prevalence and unique structure, these small molecules are likely to be the next generation of biomarkers, therapeutic agents and/or targets.
Methods used to investigate miRNA expression include SYBR green I dye- based as well as Taqman-probe based qPCR. If miRNAs are to be effectively used in the clinical setting, it is imperative that their detection in fresh and/or archived clinical samples be accurate, reproducible, and specific. qPCR has been widely used for validating expression of miRNAs in whole genome analyses such as microarray studies7. The samples used in this protocol were from patients who underwent radical prostatectomy for clinically localized prostate cancer; however other tissues and cell lines can be substituted in. Prostate specimens were snap-frozen in liquid nitrogen after resection. Clinical variables and follow-up information for each patient were collected for subsequent analysis8.
Quantification of miRNA levels in prostate tumor samples. The main steps in qPCR analysis of tumors are: Total RNA extraction, cDNA synthesis, and detection of qPCR products using miRNA-specific primers. Total RNA, which includes mRNA, miRNA, and other small RNAs were extracted from specimens using TRIzol reagent. Qiagen's miScript System was used to synthesize cDNA and perform qPCR (Figure 1). Endogenous miRNAs are not polyadenylated, therefore during the reverse transcription process, a poly(A) polymerase polyadenylates the miRNA. The miRNA is used as a template to synthesize cDNA using oligo-dT and Reverse Transcriptase. A universal tag sequence on the 5' end of oligo-dT primers facilitates the amplification of cDNA in the PCR step. PCR product amplification is detected by the level of fluorescence emitted by SYBR Green, a dye which intercalates into double stranded DNA. Specific miRNA primers, along with a Universal Primer that binds to the universal tag sequence will amplify specific miRNA sequences. 
The miScript Primer Assays are available for over a thousand human-specific miRNAs, and hundreds of murine-specific miRNAs. Relative quantification method was used here to quantify the expression of miRNAs. To correct for variability amongst different samples, expression levels of a target miRNA is normalized to the expression levels of a reference gene. The choice of a gene on which to normalize the expression of targets is critical in relative quantification method of analysis. Examples of reference genes typically used in this capacity are the small RNAs RNU6B, RNU44, and RNU48 as they are considered to be stably expressed across most samples. In this protocol, RNU6B is used as the reference gene.

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR qPCR

Quantitative Real Time polymerase chain reaction (qPCR) is a rapid and sensitive method to investigate the expression levels of various microRNA (miRNA) molecules in tumor samples. Using this method expression of hundreds of different miRNA molecules can be amplified, quantified, and analyzed from the same cDNA template.

MicroRNA-Detektion in Prostatatumoren durch quantitative real-time PCR (qPCR)

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process ...

In vitro Organoid Culture of Primary Mouse Colon Tumors

Several human and murine colon cancer cell lines have been established, physiologic integrity of colon tumors such as multiple cell layers, basal-apical polarity, ability to differentiate, and anoikis are not maintained in colon cancer derived cell lines. The present study demonstrates a method for culturing primary mouse colon tumor organoids adapted from Sato T et al. 1, which retains important physiologic features of colon tumors. This method consists of mouse colon tumor tissue collection, adjacent normal colon epithelium dissociation, colon tumor cells digestion into single cells, embedding colon tumor cells into matrigel, and selective culture based on the principle that tumor cells maintain growth on limiting nutrient conditions compared to normal epithelial cells.
The primary tumor organoids if isolated from genetically modified mice provide a very useful system to assess tumor autonomous function of specific genes. Moreover, the tumor organoids are amenable to genetic manipulation by virus meditated gene delivery; therefore signaling pathways involved in the colon tumorigenesis could also be extensively investigated by overexpression or knockdown. Primary tumor organoids culture provides a physiologic relevant and feasible means to study the mechanisms and therapeutic modalities for colon tumorigenesis.

In vitro Organoid Culture of Primary Mouse Colon Tumors

A simple method to establish primary murine colon tumor organoid is described. This method utilizes the feature that colon tumor cells survive and grow into organoids in media containing limited growth factors, whereas normal colon epithelial do not.

In-vitro-Kultur von Organoide Primäre Maus Kolontumoren

Several  human and murine colon cancer cell lines have been established, physiologic  integrity of colon tumors such as multiple cell layers, basal-apical ...

Cerebrospinal Fluid MicroRNA Profiling Using Quantitative Real Time PCR

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their translational repression. Changes in miRNA expression have been shown to be involved in the development of all major complex diseases. Furthermore, recent findings showed that miRNAs can be secreted to the extracellular environment and enter the bloodstream and other body fluids where they can circulate with high stability. The function of such circulating miRNAs remains largely elusive, but systematic high throughput approaches, such as miRNA profiling arrays, have lead to the identification of miRNA signatures in several pathological conditions, including neurodegenerative disorders and several types of cancers. In this context, the identification of miRNA expression profile in the cerebrospinal fluid, as reported in our recent study, makes miRNAs attractive candidates for biomarker analysis.
There are several tools available for profiling microRNAs, such as microarrays, quantitative real-time PCR (qPCR), and deep sequencing. Here, we describe a sensitive method to profile microRNAs in cerebrospinal fluids by quantitative real-time PCR. We used the Exiqon microRNA ready-to-use PCR human panels I and II V2.R, which allows detection of 742 unique human microRNAs. We performed the arrays in triplicate runs and we processed and analyzed data using the GenEx Professional 5 software.
Using this protocol, we have successfully profiled microRNAs in various types of cell lines and primary cells, CSF, plasma, and formalin-fixed paraffin-embedded tissues.

We describe a protocol of real time PCR to profile microRNAs in the cerebrospinal fluid (CSF). With the exception of RNA extraction protocols, the procedure can be extended to RNA extracted from other body fluids, cultured cells, or tissue specimens.

Liquor microRNA Profiling mittels quantitativer Real-Time PCR

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their ...

In Vivo Optical Imaging of Brain Tumors and Arthritis Using Fluorescent SapC-DOPS Nanovesicles

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo monitoring of physiopathological processes labeled with a fluorescent marker. Mouse models (brain tumor and arthritis) were used to evaluate the usefulness of this method. Saposin C (SapC)-dioleoylphosphatidylserine (DOPS) nanovesicles tagged with CellVue Maroon (CVM) fluorophore were administered intravenously. Animals were then placed in the rotational holder (MARS) of the in vivo imaging system. Images were acquired in 10&#176; steps over 380&#176;. A rectangular&#160;region of interest (ROI) was placed across the full image width at the model disease site. Within the ROI, and for every image, mean fluorescence intensity was computed after background subtraction. In the mouse models studied, the labeled nanovesicles were taken up in both the orthotopic and transgenic brain tumors, and in the arthritic sites (toes and ankles). Curve analysis of the multi angle image ROIs determined the angle with the highest signal. Thus, the optimal angle for imaging each disease site was characterized. The MAROI method applied to imaging of fluorescent compounds is a noninvasive, economical, and precise tool for in vivo quantitative analysis of the disease states in the described mouse models.

In Vivo Optical Imaging of Brain Tumors and Arthritis Using Fluorescent SapC-DOPS Nanovesicles

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo quantitation of a fluorescent marker delivered by saposin C (SapC)-dioleoylphosphatidylserine (DOPS) nanovesicles. Employing mouse models of cancer and arthritis, we demonstrate how the MAROI signal curve analysis can be used for the precise mapping and biological characterization of disease processes.

In Vivo Optical Imaging von Hirntumoren und Arthritis mit fluoreszierenden SapC-DOPS Nanovesicles

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo monitoring of physiopathological processes labeled with a fluorescent ...

Quantitative Mass Spectrometric Profiling of Cancer-cell Proteomes Derived From Liquid and Solid Tumors

In-depth analyses of cancer cell proteomes are needed to elucidate oncogenic pathomechanisms, as well as to identify potential drug targets and diagnostic biomarkers. However, methods for quantitative proteomic characterization of patient-derived tumors and in particular their cellular subpopulations are largely lacking. Here we describe an experimental set-up that allows quantitative analysis of proteomes of cancer cell subpopulations derived from either liquid or solid tumors. This is achieved by combining cellular enrichment strategies with quantitative Super-SILAC-based mass spectrometry followed by bioinformatic data analysis. To enrich specific cellular subsets, liquid tumors are first immunophenotyped by flow cytometry followed by FACS-sorting; for solid tumors, laser-capture microdissection is used to purify specific cellular subpopulations. In a second step, proteins are extracted from the purified cells and subsequently combined with a tumor-specific, SILAC-labeled spike-in standard that enables protein quantification. The resulting protein mixture is subjected to either gel electrophoresis or Filter Aided Sample Preparation (FASP) followed by tryptic digestion. Finally, tryptic peptides are analyzed using a hybrid quadrupole-orbitrap mass spectrometer, and the data obtained are processed with bioinformatic software suites including MaxQuant. By means of the workflow presented here, up to 8,000 proteins can be identified and quantified in patient-derived samples, and the resulting protein expression profiles can be compared among patients to identify diagnostic proteomic signatures or potential drug targets.

In-depth analyses of cancer cell proteomes facilitate identification of novel drug targets and diagnostic biomarkers. We describe an experimental workflow for quantitative analysis of (phospho-)proteomes in cancer cell subpopulations derived from liquid and solid tumors. This is achieved by combining cellular enrichment strategies with quantitative Super-SILAC-based mass spectrometry.

Quantitative massenspektrometrische Analyse von Krebs-Zellen-Proteome Abgeleitet von Liquid und soliden Tumoren

In-depth analyses of cancer cell proteomes are needed to elucidate oncogenic pathomechanisms, as well as to identify potential drug targets and diagnostic ...

Spatial Measurements of Perfusion, Interstitial Fluid Pressure and Liposomes Accumulation in Solid Tumors

The heterogeneous intra-tumoral accumulation of liposomes is a critical determinant of their efficacy. Both the chaotic tumor microcirculation and elevated IFP are linked to the heterogeneous intra-tumoral distribution of nanotechnology-based drug delivery systems such as liposomes. In the present study, the relationship between tumor microcirculation, elevated IFP, and accumulation of nanoparticles was investigated through in vivo experimentation. This was accomplished by evaluation of the tumor microcirculation using dynamic contrast enhanced computed tomography (DCE-CT) and measurement of tumor IFP using a novel image-guided robotic needle placement system connected to the micro-CT scanner. The intra-tumoral accumulation of liposomes was determined by CT image-based assessment of a nanoparticle liposomal formulation that stably encapsulate the contrast agent iohexol (CT-liposomes). CT imaging allowed for co-localization of the spatial distribution of tumor hemodynamics, IFP and CT-liposome accumulation in an individual subcutaneous xenograft mouse model of breast cancer. Measurements led to the discovery that perfusion and plasma volume fraction are strong mediators of the intra-tumoral distribution of liposomes. Furthermore, the results suggest that IFP plays an indirect role in mediating liposome distribution through modulating blood flow.

The heterogeneous intra-tumoral accumulation of liposomes has been linked to an abnormal tumor microenvironment. Herein methods are presented to measure tumor microcirculation by perfusion imaging and elevated interstitial fluid pressure (IFP) using an image-guided robotic system. Measurements are compared to the intra-tumoral accumulation of liposomes, determined using volumetric micro-CT imaging.

Räumliche Messungen der Perfusion, interstitielle Fluiddruck und Liposome Anreicherung in soliden Tumoren

The heterogeneous intra-tumoral accumulation of liposomes is a critical determinant of their efficacy. Both the chaotic tumor microcirculation and ...

Multicolor 3D Printing of Complex Intracranial Tumors in Neurosurgery

Three-dimensional (3D) printing technologies offer the possibility of visualizing patient-specific pathologies in a physical model of correct dimensions. The model can be used for planning and simulating critical steps of a surgical approach. Therefore, it is important that anatomical structures such as blood vessels inside a tumor can be printed to be colored not only on their surface, but throughout their whole volume. During simulation this allows for the removal of certain parts (e.g., with a high-speed drill) and revealing internally located structures of a different color. Thus, diagnostic information from various imaging modalities (e.g., CT, MRI) can be combined in a single compact and tangible object.
However, preparation and printing of such a fully colored anatomical model remains a difficult task. Therefore, a step-by-step guide is provided, demonstrating the fusion of different cross-sectional imaging data sets, segmentation of anatomical structures, and creation of a virtual model. In a second step the virtual model is printed with volumetrically colored anatomical structures using a plaster-based color 3D binder jetting technique. This method allows highly accurate reproduction of patient-specific anatomy as shown in a series of 3D-printed petrous apex chondrosarcomas. Furthermore, the models created can be cut and drilled, revealing internal structures that allow for simulation of surgical procedures.

The protocol describes the fabrication of fully colored three-dimensional prints of patient-specific, anatomical skull models to be used for surgical simulation. The crucial steps of combining different imaging modalities, image segmentation, three-dimensional model extraction, and production of the prints are explained.

Mehrfarbiger 3D-Druck komplexer intrakranieller Tumoren in der Neurochirurgie

Three-dimensional (3D) printing technologies offer the possibility of visualizing patient-specific pathologies in a physical model of correct dimensions. ...