Wildtyp (Mavs + / +) und Knockout (Mavs - / -)-Mäusen, Wildtyp (Mavs + / +) und Knockout (Mavs - / -) MEFs wurden freundlicherweise von Dr. J. Chen Zhijian (Universität bereitgestellt Texas Southwestern Medical Center) 13. Diese Veröffentlichung basiert auf der Arbeit durch Zuschüsse aus NIH (R01 und R01 CA134241 DE021445) und American Cancer Society (RSG-11-162-01-MPC) finanziert basiert.

Ethikerklärung: Alle Tier Arbeit wurde unter strikter Übereinstimmung mit den Empfehlungen in der Bedienungsanleitung für die Pflege und Verwendung von Labortieren der National Institutes of Health durchgeführt. Das Protokoll wurde von der Institutional Animal Care und Verwenden Committee (IACUC) der Universität von Süd-Kalifornien genehmigt. 1. Zytokin-Genexpression durch quantitative Echtzeit-PCR und Sekretion mittels ELISA in γHV68-infizierte Mäuse <ol><li> Anesthetize geschlechtsspezifische, 6-8 Wochen alte C57BL / 6 (B6) Geschwistern (8-12 Mäuse / Gruppe) über intraperitoneale Injektion von 1,5 mg ketamine/0.12 mg Xylazin und impfen intranasal mit 40 PFU γHV68 in 40 ul (Infektion in Dong Feng und 11 beschrieben). Zu verschiedenen Zeitpunkten nach der Infektion wurden die Mäuse euthanize durch Verwendung von CO 2-Inhalation durch Genickbruch folgte. </li><li> Öffnen Sie die Brust mit einem linken seitlichen Schnitt entlang der sternum und durch die Rippen mit einer scharfen Schere abgeschnitten. Sammeln Sie die Lungengewebe. </li><li> Sammeln Sie die Hälfte des Lungengewebes (links Keule) in sterile 1,5-ml-Röhrchen mit Schraubverschluss mit 500 ul 1,0 mm Zirkonia / Silica-Perlen. 1 ml kaltes serumfreies DMEM in das Rohr und homogenisieren das Lungengewebe durch Kugelschlagen für 30 sek. Chill-Röhrchen auf Eis für 2 min und wiederholen Sie diesen Vorgang einmal. </li><li> Zentrifugieren Sie die Röhrchen (15.000 x g für 10 min) bei 4 ° C, Sammeln des Überstandes und Messung der Cytokin-Produktion, wie nachfolgend beschrieben. </li><li> Messen Sie Zytokine mit kommerziell erhältlichen Zytokin-ELISA-Kits nach der Anleitung des Herstellers. </li><li> Sammeln Sie die andere Hälfte des Lungengewebes (rechten Lappen) in eine andere Perle haltige Rohr und 1 ml TRIzol. Homogenisieren und sammeln Stand wie in Schritt 1.3 und RNA-Extrakt nach Anweisungen des Herstellers beschrieben. Bestimmen RNA-Konzentration von unter Absorptionswerte bei 260 und 280 nm auf. </li&gt; <li> Bereiten cDNA mit 1 ug Gesamt-RNA und Reverse-Transkriptase nach Anweisungen des Herstellers (die endgültige Gesamtvolumen betrug 20 ul). Verdünnen cDNA 50-mal mit DNAse-und RNAse-freies Wasser und führen quantitative Echtzeit-PCR. </li><li> Führen Sie das Programm auf eine quantitative Echtzeit-PCR-Maschine. Jede Reaktion enthält 0,5 &amp;mgr; l eines Paares von genspezifischen Primern oder Kontrolle des GAPDH-Primer (der Arbeits Konzentration der Primer waren 10 &amp;mgr; M, CE 500 nM für jeden Primer), 5 &amp;mgr; l des SYBR Master Mix und 4 &amp;mgr; l der verdünnten cDNA. Berechnen ΔΔCt, um die relative Menge der mRNA-Transkripte von antiviralen Zytokinen zu bestimmen. </li></ol> 2. MEF Zellen-Infektion und Zytokin-Quantifizierung mittels ELISA und qRT-PCR <ol><li> Wachsen Mavs + / + und Mavs - / - MEF-Zellen subkonfluente (ca. 80%) Dichte vor dem Beschichten Zellen. </li><li> Split MEF-Zellen in 12-wirll Platten bei 100.000 Zellen / Well (die Zelldichte etwa 70% am zweiten Tag sein). Durchführung γHV68 Infektion in Triplikaten mit einer Multiplizität der Infektion (MOI) von 5-10 zu synchronisieren und zu maximieren Cytokin-Induktion. </li><li> Bereiten γHV68 Suspension in komplettem DMEM-Medium mit entsprechenden Virusmenge (1 ml pro Vertiefung). </li><li> Medium entfernen und fügen γHV68 haltigen Suspension auf MEF-Zellen. </li><li> Die Platte wird in Gewebekultur-Inkubator, rocken alle 30 Minuten und lassen insgesamt 2 h Inkubation. </li><li> Entfernen γHV68-haltigem Medium, einmal mit PBS waschen, und ersetzen mit frischen kompletten DMEM. </li><li> Zu verschiedenen Zeitpunkten nach der Infektion, Erntemedium in 1,5 ml-Eppendorf-Röhrchen. Waschen der Zellen mit kaltem PBS und sammeln infizierten Zellen durch Trypsin-Verdauung. </li><li> Messen antiviralen Zytokinen in Medium, wie in Schritt 1.5 beschrieben. </li><li> Auszug RNA, cDNA vorzubereiten und durchzuführen, qRT-PCR, um antivirale Zytokin-Genexpression bestimmenwie in den Schritten 1.5-1.7 beschrieben. </li></ol> 3. Lentiviren Produktion, Infektion, und Generierung von stabilen Zelllinien <ol><li> Split-293T-Zellen einen Tag vor der Transfektion und damit die Zellen zu ca. 40% Konfluenz zum Zeitpunkt der Transfektion zu erreichen. </li><li> Transfektion von 10 cm Schüssel von 293T-Zellen mit den Plasmiden Verpackung (1,2 ug pVSV-G und 6 ug pDR8.9) und 7,2 ug PCDH-FLAG-MAVS oder PCDH Kontrolle durch Calciumphosphat-Niederschlag. </li><li> Medium ersetzen bei 6 bis 8 Stunden nach der Transfektion mit frischem DMEM komplett. </li><li> Bei 72 Stunden nach der Transfektion, sammeln Medium mit Lentiviren, Zentrifuge bei 4000 g für 15 min und Filter mit 0,22 um-Membran. Um die Lentiviren Titer zu erhöhen, zentrifugieren wir die virushaltige Medium bei 110.000 g für 2,5 h bei 4 ° C Vorsichtig resuspendieren Viruspellet in kleinen Volumen Medium von Interesse. </li><li> Seed Mavs - / - MEF-Zellen oder anderen KO-MEF-Zellen 1 Tag befoRe-Infektion in 6-Well-Platten bei ~ 30-40% Konfluenz. </li><li> Infizieren MEF-Zellen mit 1 ml Lentivirus und 2 ml frisches komplettes DMEM mit Polybren bis zu einer Endkonzentration von 10 ug / ml ergänzt. </li><li> Zentrifugieren Sie die Platte bei 500 × g bei 30 ° C für 30 min und übertragen Sie die Platte an einer Gewebekultur-Inkubator. </li><li> Medium ersetzen bei 6 Stunden nach der Infektion mit frischem Komplett DMEM. </li><li> Split MEF-Zellen bei 24 Stunden nach der Infektion und fügen Puromycin zu einer endgültigen Konzentration von 1 pg / ml bei 48 Stunden nach der Infektion auf Zellen auswählen stabil exprimieren MAVS. </li><li> Pflegen MEF-Zellen in Puromycin-haltigem Medium und überprüfen Proteinexpression durch Immunoblotting mit entsprechenden Antikörpern. </li><li> Die Zellen können für die Virusinfektion, Zytokin-Genexpression und Sekretion Experimente wie in Protokoll Nr. 2 beschrieben, verwendet werden. </li></ol>

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

Die Autoren erklären, keine Interessenkonflikte.

Viral Immunevasion ist einer der dynamischsten und faszinierende Wechselwirkungen Anbindung viralen Angriff und Abwehr 9. Die Wirts angeborenen Immunkomponenten werden so strukturiert, dass die Signaltransduktion wirksam initiiert und originalgetreu übertragen. Absteckung der Hierarchie und Regulierung von Signalkaskaden ist eine herausragende Thema der angeborenen Immunität. Hier stellen wir ein Protokoll, um die regulatorischen Rolle der angeborenen Immunkomponente, MAVS, der Virushinterziehung von Zytoki...

Jüngste Studien haben die gesamten Signalkaskaden bei der Montage Host angeborenen Immunantwort beschrieben. Wohnen in unterschiedlichen Fächern, pattern recognition receptors (PRR) erkennen pathogen-associated molecular patterns (PAMPs) unterschiedlicher Herkunft zu angeborenen Immunsignal 1 auslösen. Die Retinsäure-induzierte Gen I (RIG-I) und Melanom-Differenzierungsantigen 5 (MDA5) cytosolische Proteine ​​sind Sensoren, die RNA-Spezies mit spezifischen Strukturmerkmale 2 zu erkennen. Nach der Aktivierung, RIG-I interagiert mit seinem stromabwärts gelegenen MAVS Adapter, der wiederum aktiviert die IKK (IKKαβγ) und IKK-verwandten Kinase (TBK1 und IKKε, auch IKKi bekannt (auch als IPS-1, VISA, und CARDIF bekannt) )-Komplexe 3-6. Aktiviert angeborenen Immun Kinasen phosphoryliert Schlüsselregulatoren der Genexpression, darunter Transkriptionsfaktoren und deren Inhibitoren und aktivieren Transkriptionsaktivierung von Host-antivirale Gene (z. B. IL-6, TNF &amp; #945;, CCL5 und IFN &amp;bgr;). Diese Signalkaskaden bilden starke intrinsische angeborenen Immunantwort, die eine anti-mikrobielle Staat zu errichten, um Krankheitserreger Ausbreitung während der frühen Stadien der Infektion zu beschränken. Murine γHV68 ist eng mit der menschlichen onkogenen KSHV und EBV zusammen. Somit γHV68 Infektion von Mäusen eine lenkbar Kleintiermodell, um die Immunantwort des Wirts gegenüber Gammaherpesvirus-Infektion in vivo 7 zu prüfen. Mit γHV68 hat unser Labor eine komplizierte Strategie aufgedeckt, wobei γHV68 entführt Gastgeber angeborenen Immun Signalisierung an Virusinfektion zu ermöglichen. Auf der einen Seite aktiviert γHV68 die Mavs-IKK Weg zum viralen Transkriptionsaktivierung über die Leitung aktiviert IKK Replikation Transaktivator (RTA), die virale Transkriptionsfaktor Schlüssel für γHV68 Replikation 8 phosphorylieren fördern. Auf der anderen Seite, Primzahlen die IKK-vermittelte Phosphorylierung RelA für Abbau-und Zeitinates NFkB-Aktivierung 9. Als solche γHV68 Infektion vermeidet effektiv antivirale Zytokin-Produktion. Interessant ist, dass ein Screening unter Verwendung einer Expressionsbibliothek von γHV68 identifiziert RTA als E3-Ligase RelA Abbau zu induzieren, und hebt NFkB-Aktivierung 10. Diese Ergebnisse enthüllen ein kompliziertes Immunevasion Strategie, bei der die vor-Immunsignalereignisse werden durch γHV68 genutzt, um den ultimativen antivirale Zytokin-Produktion zu negieren. Hier beschreiben wir ein Protokoll, um die antivirale Zytokin-Produktion in Mäusen mit γHV68 sowohl in vivo und ex viv o infiziert zu messen. In dem Protokoll weiter wir die &quot;wiederhergestellten&quot; Ausdruck der angeborenen Immunkomponenten in der Ko-embryonale Fibroblasten erkunden lentiviralen Transduktion, die die Funktion der spezifischen angeborenen Immunmoleküle in der Regulation des antivirale Zytokin-Produktion lokalisiert. Dieses Protokoll kann leicht auf andere Viru angepasst werdenses und Signalwege.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

In Reaktion auf eine virale Infektion ist der Host angeborenen Immunantwort zu hoch zu regulieren die Genexpression und die Produktion antiviraler Cytokine aktiviert. Umgekehrt haben Viren komplizierte Strategien, um für das Überleben und die Fortpflanzung zu entziehen und zu nutzen Immun Signalisierung entwickelt. Viral Immunevasion und beinhaltet Abwehr und virale Steuerhinterziehung, bietet eine der faszinierendsten und dynamischen Schnittstellen, um die Wirt-Virus-Interaktion zu erkennen. Diese Studien unser Verständnis der angeborenen Immunregulation und ebnen den Weg zu neuen antiviralen Therapien zu entwickeln. Murine γHV68 ist eine natürliche Erreger der murinen Nagetiere. γHV68 Infektion von Mäusen eine gefügig Kleintiermodell, um die antivirale Antwort auf menschliche KSHV und EBV, von denen Störung der in-vivo-Virus-Wirt-Wechselwirkungen ist nicht anwendbar zu untersuchen. Hier beschreiben wir ein Protokoll, um die antivirale Zytokin-Produktion zu bestimmen. Dieses Protokoll kann auch auf andere vir angepasst werdenverwendet und Signalwege. Vor kurzem haben wir entdeckt, dass γHV68 entführt MAVS und IKK, Schlüssel angeborenen Immunsignalkomponenten hinter der cytosolischen RIG-I und MDA5, um NFkB-Aktivierung und antivirale Zytokin-Produktion aufzuheben. Insbesondere γHV68 Infektion aktiviert IKK und die IKK phosphoryliert aktiviert RelA zu RelA Abbau beschleunigen. Als solche γ HV68 effizient entkoppelt NFkB-Aktivierung bei den vorgelagerten aktiviert IKK, negiert antivirale Zytokin-Genexpression. Diese Studie verdeutlicht eine komplizierte Strategie, bei der die vorgeschaltete angeborenen Immunaktivierung wird durch eine virale Erreger abgefangen, die unmittelbar nachgeschalteten Transkriptionsaktivierung zunichte machen und entziehen antivirale Zytokin-Produktion.

Drei repräsentative Zahlen werden hier gezeigt, darunter Zytokin-Produktion in der Lunge von γHV68-infizierten Mavs + / + und Mavs-/ - Maus, Zytokinsekretion und Gen-Expression von γHV68-infizierten Mavs + / + und Mavs - / - MEFs und Zytokin-mRNA-Spiegel von γHV68-infizierten Mavs - / - MEFs &quot;wiederhergestellt&quot; mit MAVS. Diese repräsentativen Experimenten nutzen Gen-Knockout-Mäusen, die antivirale Zytokin-...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Wir beschreiben ein Protokoll, um die antivirale Zytokin-Produktion in Mäusen mit einem Modell-Herpesvirus, murinen Gammaherpesvirus-68 (γ HV68) infiziert, die für die menschliche Kaposi-Sarkom-assoziierten Herpesvirus (KSHV) und Epstein-Barr-Virus (EBV) eng verwandt ist, zu messen. Mit Hilfe genetisch veränderter Mausstämme und embryonalen Maus-Fibroblasten (MEF), untersuchten wir die antivirale Zytokin-Produktion in vivo und ex vivo. &quot;Reconstituting&quot; den Ausdruck der angeborenen Immunkomponenten in Knockout embryonale Fibroblasten von lentiviralen Transduktion, weiter wir spezifische angeborene Immunmoleküle erkennen und sezieren die wichtigsten Signalwege, die unterschiedlich regeln die antivirale Zytokin-Produktion.

Zergliedern Angeborene Immunsystem Signaling in Viral Evasion von Zytokin-Produktion

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

dissecting-innate-immune-signaling-viral-evasion-cytokine

Research

JoVE Journal

Immunology and Infection

10.4K Aufrufe.  Keck School of Medicine, University of Southern California.  Wir beschreiben ein Protokoll, um die antivirale Zytokin-Produktion in Mäusen mit einem Modell-Herpesvirus, murinen Gammaherpesvirus-68 (γ HV68) infiziert, die für die menschliche Kaposi-Sarkom-assoziierten Herpesvirus (KSHV) und Epstein-Barr-Virus (EBV) eng verwandt ist, zu messen. Mit Hilfe genetisch veränderter Mausstämme und embryonalen Maus-Fibroblasten (MEF), untersuchten wi...

Serie: Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Production and Titering of Recombinant Adeno-associated Viral Vectors

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently being tested in human clinical trials. Wild-type AAV is a non-pathogenic member of the parvoviridae family and inherently replication-deficient. The broad transduction profile, low immune response as well as the strong and persistent transgene expression achieved with these vectors has made them a popular and versatile tool for in vitro and in vivo gene delivery. rAAVs can be easily and cheaply produced in the laboratory and, based on their favourable safety profile, are generally given a low safety classification. Here, we describe a method for the production and titering of chimeric rAAVs containing the capsid proteins of both AAV1 and AAV2. The use of these so-called chimeric vectors combines the benefits of both parental serotypes such as high titres stocks (AAV1) and purification by affinity chromatography (AAV2). These AAV serotypes are the best studied of all AAV serotypes, and individually have a broad infectivity pattern. The chimeric vectors described here should have the infectious properties of AAV1 and AAV2 and can thus be expected to infect a large range of tissues, including neurons, skeletal muscle, pancreas, kidney among others. The method described here uses heparin column purification, a method believed to give a higher viral titer and cleaner viral preparation than other purification methods, such as centrifugation through a caesium chloride gradient. Additionally, we describe how these vectors can be quickly and easily titered to give accurate reading of the number of infectious particles produced.

Recombinant adeno-associated virus (rAAVs) vectors are becoming increasingly valuable for in vivo studies in animals. We describe how rAAVs can be produced in the laboratory and how these vectors can be titered to give an accurate reading of the number of infectious particles produced.

Produktion und Titrierung von rekombinanten Adeno-assoziierte virale Vektoren

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Forschung

Immunologie und Infektion

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

The phagocyte respiratory burst is part of the innate immune response to pathogen infection and involves the production of reactive oxygen species (ROS). ROS are toxic and function to kill phagocytized microorganisms. In vivo quantification of phagocyte-derived ROS provides information regarding an organism's ability to mount a robust innate immune response. Here we describe a protocol to quantify and compare ROS in whole zebrafish embryos upon chemical induction of the phagocyte respiratory burst. This method makes use of a non-fluorescent compound that becomes fluorescent upon oxidation by ROS. Individual zebrafish embryos are pipetted into the wells of a microplate and incubated in this fluorogenic substrate with or without a chemical inducer of the respiratory burst. Fluorescence in each well is quantified at desired time points using a microplate reader. Fluorescence readings are adjusted to eliminate background fluorescence and then compared using an unpaired t-test. This method allows for comparison of the respiratory burst potential of zebrafish embryos at different developmental stages and in response to experimental manipulations such as protein knockdown, overexpression, or treatment with pharmacological agents. This method can also be used to monitor the respiratory burst response in whole dissected kidneys or cell preparations from kidneys of adult zebrafish and some other fish species. We believe that the relative simplicity and adaptability of this protocol will complement existing protocols and will be of interest to researchers who seek to better understand the innate immune response.

The innate immune response protects organisms against pathogen infection. A critical component of the innate immune response, the phagocyte respiratory burst, generates reactive oxygen species that kill invading microorganisms. We describe a respiratory burst assay that quantifies reactive oxygen species produced when the innate immune response is chemically induced.

Die Quantifizierung der Atem Burst Antwort als Indikator für Angeborene Immunsystem Gesundheit in Zebrafisch

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

Mit RNA-Interferenz, um die angeborene Immunantwort in Makrophagen der Maus Untersuchen

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of causing systemic disease in both fish and humans. A better understanding of S. iniae disease pathogenesis requires an appropriate model system. The genetic tractability and the optical transparency of the early developmental stages of zebrafish allow for the generation and non-invasive imaging of transgenic lines with fluorescently tagged immune cells. The adaptive immune system is not fully functional until several weeks post fertilization, but zebrafish larvae have a conserved vertebrate innate immune system with both neutrophils and macrophages. Thus, the generation of a larval infection model allows the study of the specific contribution of innate immunity in controlling S. iniae infection.
The site of microinjection will determine whether an infection is systemic or initially localized. Here, we present our protocols for otic vesicle injection of zebrafish aged 2-3 days post fertilization as well as our techniques for fluorescent confocal imaging of infection. A localized infection site allows observation of initial microbe invasion, recruitment of host cells and dissemination of infection. Our findings using the zebrafish larval model of S. iniae infection indicate that zebrafish can be used to examine the differing contributions of host neutrophils and macrophages in localized bacterial infections. In addition, we describe how photolabeling of immune cells can be used to track individual host cell fate during the course of infection.

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Here, we present a protocol for the generation and imaging of a localized bacterial infection in the zebrafish otic vesicle.

Nicht-invasive Bildgebung von der angeborenen Immunantwort in einem Zebrafisch-Larven Modell<em&gt; Streptococcus iniae</em&gt; Infektions

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research is deciphering how these dynamic protein complexes act to integrate signals from multiple sources in order to direct a specific biological response, and how this becomes deregulated in many disease settings. Despite the importance of this key biochemical mechanism, there is a lack of experimental techniques that can facilitate the specific and sensitive deconvolution of these multi-molecular signaling complexes.
Here this shortcoming is addressed through the combination of a protein complementation assay with a conformation-specific nanobody, which we have termed Bimolecular Complementation Affinity Purification (BiCAP). This novel technique facilitates the specific isolation and downstream proteomic characterization of any pair of interacting proteins, to the exclusion of un-complexed individual proteins and complexes formed with competing binding partners. 
The BiCAP technique is adaptable to a wide array of downstream experimental assays, and the high degree of specificity afforded by this technique allows more nuanced investigations into the mechanics of protein complex assembly than is currently possible using standard affinity purification techniques.

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

This manuscript describes the protocol for Bimolecular Complementation Affinity Purification (BiCAP). This novel method facilitates the specific isolation and downstream proteomic characterization of any two interacting proteins, while excluding un-complexed individual proteins as well as complexes formed with competing binding partners.

Sezieren Signalisierung Multi-Protein-komplexe durch eine Bimolekulare Ergänzung Affinitätsreinigung (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies in an attempt to understand the precise mechanisms that lead to the breakdown of self-tolerance and subsequent autoimmunity. Approaches thus far have been based on the study of one specific aspect of the immune system (a single or few cell types or cytokines), and do not offer a global assessment of complex autoimmune disease. While patient sera-based studies have afforded important insights into autoimmunity, they do not provide the specific cellular source of the dysregulated cytokines detected. A comprehensive single-cell approach to evaluate cytokine production in multiple immune cell subsets, within the context of &#34;intrinsic&#34; patient-specific plasma circulating factors, is described here. This approach enables monitoring of the patient-specific immune phenotype (surface markers) and function (cytokines), either in its native &#34;intrinsic pathogenic&#34; disease state, or in the presence of therapeutic agents (in vivo or ex vivo).

Here we describe a single-cell proteomic approach to evaluate immune phenotypic and functional (intracellular cytokine induction) alterations in peripheral whole blood samples, analyzed via mass cytometry.

Einzellige Analyse der Immunophenotype und Produktion von Zytokinen im peripheren Blut über Masse Zytometrie

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence rates of S. aureus infection climbing annually, there is a demand for additional research in its&#160;pathogenicity. Animal models of infectious disease advance our understanding of the host-pathogen response and lead to the development of effective therapeutics. Neutrophils play a primary role in the innate immune response that controls S. aureus infections by forming an abscess to wall off the infection and facilitate bacterial clearance; the number of neutrophils that infiltrate an S. aureus skin infection often correlates with disease outcome. LysM-EGFP mice, which possess the enhanced green fluorescent protein (EGFP) inserted in the Lysozyme M (LysM) promoter region (expressed primarily by neutrophils), when used in conjunction with in vivo whole animal fluorescence imaging (FLI) provide&#160;a means of quantifying neutrophil emigration noninvasively and longitudinally into wounded skin. When combined with a bioluminescent S. aureus strain and sequential in vivo whole animal bioluminescent imaging (BLI), it is possible to longitudinally monitor both the neutrophil recruitment dynamics and in vivo bacterial burden at the site of infection in anesthetized mice from onset of infection to resolution or death. Mice are more resistant to a number of virulence factors produced by S. aureus that facilitate effective colonization and infection in humans. Immunodeficient mice provide a more sensitive animal model to examine persistent S. aureus infections and the ability of therapeutics to boost innate immune responses. Herein, we characterize responses in LysM-EGFP mice that have been bred to MyD88-deficient mice (LysM-EGFP&#215;MyD88-/- mice) along with wild-type LysM-EGFP mice to investigate S. aureus skin wound infection. Multispectral simultaneous detection enabled study of neutrophil recruitment dynamics by using in vivo FLI, bacterial burden by using in vivo BLI, and wound healing longitudinally and noninvasively over time.

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

An approach is described for real-time detection of the innate immune response to cutaneous wounding and Staphylococcus aureus infection of mice. By comparing LysM-EGFP mice (which possess fluorescent neutrophils) with a LysM-EGFP crossbred immunodeficient mouse strain, we advance our understanding of infection and the development of approaches to combat infection.

Ein Mausmodell zu beurteilen, angeborene Immunantwort auf Staphylococcus Aureus -Infektion

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal host-microbe interactions. It is well established that different commensals exhibit a different potential to stimulate the host intestinal immune system. Such investigations involve vertebrate animals, especially rodents. Since increasing ethical concerns are linked with experiments involving vertebrates, there is a high demand for invertebrate replacements models. 
Here, we provide a Galleria mellonella oral administration model using commensal non-pathogenic bacteria and the possible assessment of the immunogenic potential of commensals on the G. mellonella immune system. We demonstrate that G. mellonella is a useful alternative invertebrate replacement model that allows the analysis of commensals with different immunogenic potential such as Bacteroides vulgatus and Escherichia coli. Interestingly, the bacteria exhibited no killing effect on the larvae, which is similar to mammals. The immune responses of G. mellonella were comparable with vertebrate innate immune responses and involve recognition of the bacteria and production of antimicrobial molecules. We propose that G. mellonella was able to restore previous microbiota balance, which is well known from healthy mammalian individuals. Although providing comparable innate immune responses in both G. mellonella and vertebrates, G. mellonella does not harbor an adaptive immune system. Since the investigated components of the innate immune system are evolutionary conserved, the model allows a prescreening and first analysis of bacterial immunogenic properties.

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

Here, we provide a detailed protocol for an oral administration model using Galleria mellonella larvae and how to characterize induced innate immune responses. Using this protocol, researchers without practical experience will be able to use the G. mellonella force-feeding method.

Ein Galleria Mellonella mündliche Administrationsmodell zu Study Commensal-Induced angeborene Immunantwort

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal immunity, because they can model host-pathogen interactions in the tissue. While isolated cells derived from tissues were the first cell culture model, their use has been neglected because tissue can be hard to obtain. In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells (TMCs) from healthy human tonsils to study innate immune responses upon activation, mimicking viral infection in mucosal tissues. Isolation of TMCs from the tonsils is quick, because the tonsils barely have any epithelium and yield up to billions of all major immune cell types. This method allows detection of cytokine production using several techniques, including immunoassays, qPCR, microscopy, flow cytometry, etc., similar to the use of peripheral mononuclear cells (PBMCs) from blood. Furthermore, TMCs show a higher sensitivity to drug testing than PBMCs, which needs to be considered for future toxicity assays. Thus, ex vivo TMCs cultures are an easy and accessible mucosal model.

In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells from healthy humans undergoing partial surgical tonsillectomy to study innate immune responses upon activation, mimicking viral infection in mucosal tissues.

Isolierung von Tonsillar Mononukleären Zellen zur Untersuchung von Ex-Vivo-angeborenen Immunantworten in einem menschlichen Mukosal-Lymphgewebe

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...

Microfluidic Co-Culture Models for Dissecting the Immune Response in in vitro Tumor Microenvironments

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise invisible processes. Advanced cell assays closely mimicking in vivo scenery are establishing themselves as novel ways to visualize and measure the bidirectional tumor-host interplay influencing the progression of cancer. Here we describe two versatile protocols to recreate highly controllable 2D and 3D co-cultures in microdevices, mimicking the complexity of the tumor microenvironment (TME), under natural and therapy-induced immunosurveillance. In section 1, an experimental setting is provided to monitor crosstalk between adherent tumor cells and floating immune populations, by bright field time-lapse microscopy. As an applicative scenario, we analyze the effects of anti-cancer treatments, such as the so-called immunogenic cancer cell death inducers on the recruitment and activation of immune cells. In section 2, 3D tumor-immune microenvironments are assembled in a competitive layout. Differential immune infiltration is monitored by fluorescence snapshots up to 72 h, to evaluate combination therapeutic strategies. In both settings, image processing steps are illustrated to extract a plethora of immune cell parameters (e.g., immune cell migration and interaction, response to therapeutic agents). These simple and powerful methods can be further tailored to simulate the complexity of the TME encompassing the heterogeneity and plasticity of cancer, stromal and immune cells subtypes, as well as their reciprocal interactions as drivers of cancer evolution. The compliance of these rapidly evolving technologies with live-cell high-content imaging can lead to the generation of large informative datasets, bringing forth new challenges. Indeed, the triangle &#39;&#39;co-cultures/microscopy/advanced data analysis&#34; sets the path towards a precise problem parametrization that may assist tailor-made therapeutic protocols. We expect that future integration of cancer-immune on-a-chip with artificial intelligence for high-throughput processing will synergize a large step forward in leveraging the capabilities as predictive and preclinical tools for precision and personalized oncology.

In the age of immunotherapy and single-cell genomic profiling, cancer biology requires novel in vitro and computational tools for investigating the tumor-immune interface in a proper spatiotemporal context. We describe protocols to exploit tumor-immune microfluidic co-cultures in 2D and 3D settings, compatible with dynamic, multiparametric monitoring of cellular functions.

Mikrofluidische Co-Kulturmodelle zur Analyse der Immunantwort in in vitro Tumormikroumgebungen

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise ...