Un agradecimiento especial a Kris Reddi en la UCLA para la creación de reactivos y verter los geles y Erin Sanders en la UCLA en busca de inspiración, guía y apoyo y la corrección del manuscrito. También me gustaría que gracias Giancarlo Costaguta y Gregory S. Payne para suministrar el ADN genómico de la levadura y los cebadores para amplificar el gen GAL3. También me gustaría dar las gracias a Shah Bhairav ​​para tomar fotografías de los equipos de laboratorio y los reactivos utilizados para hacer las figuras 2 a 4. Los fondos para este proyecto fue proporcionado por el HHMI (HHMI Grant N º 52.006.944).

<ol>
	<li>Albert, J., Fenyo, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+sensitive,+and+specific+detection+of+human+immunodeficiency+virus+type+1+in+clinical+specimens+by+polymerase+chain+reaction+with+nested+primers.">Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers.</a> J. Clin. Microbiol. 28, 1560-1564 (1990).</li><li>Baskaran, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uniform+amplification+of+a+mixture+of+deoxyribonucleic+acids+with+varying+GC+content.">Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content.</a> Genome Res. 6, 633-638 (1996).</li><li>Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+buffer+optimization+with+uniform+temperature+regimen+to+facilitate+automation.">PCR buffer optimization with uniform temperature regimen to facilitate automation.</a> PCR Methods Appl. 2, 234-240 (1993).</li><li>Borer, P. N., Dengler, B., Tinoco, I., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stability+of+ribonucleic+acid+double-stranded+helices.">Stability of ribonucleic acid double-stranded helices.</a> J. Mol. Biol. 86, 843-853 (1974).</li><li>Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+DNA+duplex+stability+from+the+base+sequence.">Predicting DNA duplex stability from the base sequence.</a> Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).</li><li>Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevention+of+pre-PCR+mis-priming+and+primer+dimerization+improves+low-copy-number+amplifications.">Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications.</a> Nucleic Acids Res. 20, 1717-1723 (1992).</li><li>Coleman, W. B., Tsongalis, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Diagnostics for the clinical laboration. , (2005).</li><li>D'Aquila, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+sensitivity+and+specificity+of+PCR+by+pre-amplification+heating.">Maximizing sensitivity and specificity of PCR by pre-amplification heating.</a> Nucleic Acids Res. 19, 3749 (1991).</li><li>Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+concepts+for+PCR+primer+design.">General concepts for PCR primer design.</a> PCR Methods Appl. 3, S30-S37 (1993).</li><li>Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term='Touchdown'+PCR+to+circumvent+spurious+priming+during+gene+amplification.">'Touchdown' PCR to circumvent spurious priming during gene amplification.</a> Nucleic Acids Res. 19, 4008 (1991).</li><li>Erlich, H. A., Gelfand, D., Sninsky, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+the+polymerase+chain+reaction.">Recent advances in the polymerase chain reaction.</a> Science. 252, 1643-1651 (1991).</li><li>Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-amplification+of+GC-rich+regions:+'slowdown+PCR.">PCR-amplification of GC-rich regions: 'slowdown PCR.</a> Nat. Protoc. 3, 1312-1317 (2008).</li><li>Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+amplification+with+PCR+of+a+refractory+segment+of+genomic+DNA.">Specific amplification with PCR of a refractory segment of genomic DNA.</a> Nucleic Acids Res. 16, 11844 (1988).</li><li>Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+improves+the+PCR+amplification+of+GC-rich+DNA+sequences.">Betaine improves the PCR amplification of GC-rich DNA sequences.</a> Nucleic Acids Res. 25, 3957-3958 (1997).</li><li>Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PCR Protocols: A guide to methods and applications. , (1990).</li><li>King, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Molecular Biology. 630, (2010).</li><li>Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+polynucleotides.+XCVI.+Repair+replications+of+short+synthetic+DNA's+as+catalyzed+by+DNA+polymerases.">Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases.</a> J. Mol. Biol. 56, 341-361 (1971).</li><li>Korbie, D. J., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Touchdown+PCR+for+increased+specificity+and+sensitivity+in+PCR+amplification.">Touchdown PCR for increased specificity and sensitivity in PCR amplification.</a> Nat. Protoc. 3, 1452-1456 (2008).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+DNA+by+PCR:+standard+procedures+and+optimization.">Enzymatic amplification of DNA by PCR: standard procedures and optimization.</a> Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction.">The polymerase chain reaction.</a> Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).</li><li>Kreader, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relief+of+amplification+inhibition+in+PCR+with+bovine+serum+albumin+or+T4+gene+32+protein.">Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein.</a> Appl. Environ. Microbiol. 62, 1102-1106 (1996).</li><li>Kwok, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+human+immunodeficiency+virus+sequences+by+using+in+vitro+enzymatic+amplification+and+oligomer+cleavage+detection.">Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection.</a> J. Virol. 61, 1690-1694 (1987).</li><li>McConlogue, L., Brow, M. A., Innis, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-independent+DNA+amplification+by+PCR+using+7-deaza-2'-deoxyguanosine.">Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine.</a> Nucleic Acids Res. 16, 9869 (1988).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+unusual+origin+of+the+polymerase+chain+reaction.">The unusual origin of the polymerase chain reaction.</a> Sci. Am. 262, 56-65 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Target+amplification+for+DNA+analysis+by+the+polymerase+chain+reaction.">Target amplification for DNA analysis by the polymerase chain reaction.</a> Ann. Biol. Clin. (Paris). 48, 579-582 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction+in+an+anemic+mode:+how+to+avoid+cold+oligodeoxyribonuclear+fusion).">The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion).</a> PCR Methods Appl. 1, 1-4 (1991).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Paabo, S., Gifford, J. A., Wilson, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+sequences+from+a+7000-year+old+brain.">Mitochondrial DNA sequences from a 7000-year old brain.</a> Nucleic Acids Res. 16, 9775-9787 (1988).</li><li>Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+can+eliminate+the+base+pair+composition+dependence+of+DNA+melting.">Betaine can eliminate the base pair composition dependence of DNA melting.</a> Biochemistry. 32, 137-144 (1993).</li><li>Roux, K. H., Hecker, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+optimization+using+touchdown+and+stepdown+PCR.">One-step optimization using touchdown and stepdown PCR.</a> Methods Mol. Biol. 67, 39-45 (1997).</li><li>Rychlik, W., Spencer, W. J., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro.">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer-directed+enzymatic+amplification+of+DNA+with+a+thermostable+DNA+polymerase.">Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.</a> Science. 239, 487-491 (1988).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+beta-globin+genomic+sequences+and+restriction+site+analysis+for+diagnosis+of+sickle+cell+anemia.">Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.</a> Science. 230, 1350-1354 (1985).</li><li>Sambrook, J. A. R., David, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning A Laboratory Manual. 2, (2001).</li><li>Sarkar, G., Kapelner, S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formamide+can+dramatically+improve+the+specificity+of+PCR.">Formamide can dramatically improve the specificity of PCR.</a> Nucleic Acids Res. 18, 7465 (1990).</li><li>Smit, V. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KRAS+codon+12+mutations+occur+very+frequently+in+pancreatic+adenocarcinomas.">KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas.</a> Nucleic Acids Res. 16, 7773-7782 (1988).</li><li>Wilson, I. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+and+facilitation+of+nucleic+acid+amplification.">Inhibition and facilitation of nucleic acid amplification.</a> Appl. Environ. Microbiol. 63, 3741-3751 (1997).</li><li>Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Enzymology. 218, (1993).</li></ol>

No tengo nada que revelar.

PCR se ha convertido en una herramienta indispensable en el arsenal de la ciencia biológica. PCR ha alterado el curso de la ciencia que permite a los biólogos a ceder el poder sobre los genomas, y hacer que los genes híbridos con nuevas funciones, permitiendo que las pruebas clínicas específicas y precisas, obteniendo conocimientos sobre los genomas y la diversidad, así como los genes simplemente de clonación para el análisis bioquímico más. Aplicación de la PCR está limitado sólo por la imaginación de los científicos que ejerce su poder. Hay muchos libros y artículos que describen los nuevos usos especializados de la PCR, y muchos más que se desarrollará en la próxima generación de la ciencia biológica. Sin embargo, independientemente de los enfoques previstos, el marco fundamental se ha mantenido el mismo. PCR, en toda su grandeza, es una aplicación in vitro para generar grandes cantidades de un segmento específico de ADN. El diseño de un experimento de PCR requiere de pensamiento y de paciencia. Los resultados mostrados en la Figura 3 ejemplifican uno de los canales principalesallenges la hora de diseñar una estrategia de optimización para la PCR. Es decir, como un parámetro de la PCR se cambia, puede afectar a otra. Como un ejemplo, si la PCR inicial se llevó a cabo a la temperatura sub-óptima de recocido (58 ° C) con un óptimo de Mg 2 + concentración de 2,0 mM, a continuación, el resultado sería producir un frotis como se ve en la Figura 3c. Un intento de resolver el frotis puede implicar la creación de las condiciones de PCR con las reacciones que contienen 2,0 mM MgCl 2 y el ajuste de la temperatura de templado a 61 ° C. Sin embargo, como se ve en la Figura 3a, esto no produciría ningún producto. En consecuencia, es aconsejable titular reactivos, en lugar de añadir una concentración a una sola reacción, cuando reparación resultados falsos. Además, los ajustes más comunes que se requieren para la optimización de un experimento de PCR son para cambiar el Mg 2 + concentración y para corregir las temperaturas de recocido. Sin embargo, si estos cambios no minimizar o anular los resultados aberrantes, la valoración de additiVES y / o cambiar los protocolos de la condición de ciclismo que se describen en las Tablas 2-6 puede aliviar el problema. Si todo esto falla, rediseñar los cebadores y de intentar, intentar de nuevo.

<table border="1"><tbody><tr><td> Nombre del reactivo </td><td> Empresa </td><td> Número de catálogo </td><td> Comentarios </td></tr><tr><td> Taq Polymeras </td><td> Sigma </td><td> D4545-25UN </td><td></td></tr><tr><td> dNTPs </td><td> Qiagen </td><td> 201225 </td><td></td></tr><tr><td> 0,2 ml de paredes delgadas tubos PCR </td><td> Bio Rad </td><td> 223-9469 </td><td></td></tr><tr><td> 0,2 ml de pared delgada tapones de los tubos </td><td> Bio Rad </td><td> 223-9472 </td><td></td></tr><tr><td> Tampón TE: </td><td></td><td></td><td></td></tr><tr><td> EDTA disódico dihidrato de la sal </td><td> Sigma </td><td> E5134 </td><td></td></tr><tr><td> Trizma-HCl </td><td> Sigma </td><td> T-3253 </td><td></td></tr><tr><td> Primer Custom Fago </td><td> Invitrogen </td><td colspan="2"> 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG </td></tr><tr><td> Primer Custom Fago </td><td> Invitrogen </td><td colspan="2"> 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT </td></tr><tr><td> Primer levadura personalizada </td><td> Integrado de Tecnologías de ADN </td><td colspan="2"> SacI Gal3 (-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG </td></tr><tr><td> Primer levadura personalizada </td><td> Integrado de Tecnologías de ADN </td><td colspan="2"> Gal3 (1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG </td></tr><tr><td> Termociclador </td><td> Bio Rad </td><td> 170-9703 </td><td> Mi Ciclador </td></tr><tr><td> Agarosa </td><td> ISC BioExpress </td><td> E-3120-500 </td><td></td></tr><tr><td> La electroforesis en gel </td><td> Hoeffer Scientific Instruments </td><td> Modelo HE33 </td><td></td></tr><tr><td> 1 kb DNA Ladder </td><td> New England BioLabs </td><td> N3232S </td><td></td></tr><tr><td> Bio Rad Power Pack </td><td> Bio Rad </td><td> 164-5050 </td><td> PowerPac básica </td></tr><tr><td> Gel Doc sistema de </td><td> Fotodyne Incorporated </td><td colspan="2"> FOTO / Analista Investigador FX estación de trabajo </td></tr></tbody></table>

polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies

En las ciencias biológicas se han producido avances tecnológicos que catapultan a la disciplina en las edades de oro del descubrimiento. Por ejemplo, el campo de la microbiología se transformó con el advenimiento de microscopio Anton van Leeuwenhoek, que permitió a los científicos visualizar procariotas, por primera vez. El desarrollo de la reacción en cadena de la polimerasa (PCR) es una de las innovaciones que cambiaron el curso de la ciencia molecular, con el impacto que abarca un sinnúmero de subdisciplinas de la biología. El proceso teórico fue esbozada por Keppe y compañeros de trabajo en 1971, sin embargo, fue otro de 14 años hasta que el procedimiento completo de PCR se describe y se aplica experimentalmente por Kary Mullis, mientras que en la Cetus Corporation en 1985. Automatización y refinamiento de esta técnica progresó con la introducción de una ADN polimerasa térmica estable a partir de la bacteria Thermus aquaticus, en consecuencia, el nombre de la ADN polimerasa Taq. La PCR es una Powetécnica de amplificación rful que puede generar un amplio suministro de un segmento específico de ADN (es decir, una amplificación) a partir de sólo una pequeña cantidad de material de partida (es decir, molde de ADN o secuencia diana). Si bien sencilla y, en general sin problemas, hay dificultades que complican la reacción que produce resultados falsos. Cuando la PCR no se puede llevar a muchos productos no específicos de ADN de diferentes tamaños que aparecen como una escalera o un frotis de bandas en geles de agarosa. A veces hay productos forman en absoluto. Otro problema potencial se produce cuando las mutaciones se introdujeron involuntariamente en los amplicones, resultando en una población heterogénea de productos de PCR. Los fallos de la PCR puede ser frustrante no ser la paciencia y la solución de problemas de cuidado se emplean para resolver y solucionar el problema (s). Este protocolo describe los principios básicos de la PCR, proporciona una metodología que se traducirá en la amplificación de secuencias de la mayoría de objetivo, y presenta estrategias para la optimización de una reacción. Siguiendo esta guía de PCR, víaudents debe ser capaz de: <ul><li> Establecer las reacciones y las condiciones de ciclos térmicos convencionales para un experimento de PCR </li><li> Comprender la función de varios componentes de la reacción y su efecto global sobre un experimento de PCR </li><li> Diseñar y optimizar un experimento de PCR para cualquier molde de DNA </li><li> Solucionar problemas de fallidos experimentos de PCR </li></ul>

Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

PCR se ha convertido en una técnica común en muchos laboratorios de biología molecular. Siempre que aquí hay una guía rápida de varios protocolos de PCR convencionales. Debido a que cada reacción es un experimento único, las condiciones óptimas requeridas para generar un producto variar. La comprensión de las variables en una reacción en gran medida mejorar la eficiencia de la solución de problemas, lo que aumenta la posibilidad de obtener el resultado deseado.

Reacción en cadena: Protocolo Básico Plus Estrategias de resolución de problemas y optimización

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of ...

polymerase-chain-reaction-basic-protocol-plus-troubleshooting

Research

JoVE Journal

Biology

399.5K vistas.  University of California, Los Angeles. PCR se ha convertido en una técnica común en muchos laboratorios de biología molecular. Siempre que aquí hay una guía rápida de varios protocolos de PCR convencionales. Debido a que cada reacción es un experimento único, las condiciones óptimas requeridas para generar un producto variar. La comprensión de las variables en una reacción en gran medida mejorar la eficiencia de la solución de problemas, lo que aumenta la posibilidad de obtener el resultado deseado...

Video: Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

Optimization of the Ugi Reaction Using Parallel Synthesis and Automated Liquid Handling

The optimization of a Ugi reaction involving the mixing of furfurylamine, benzaldehyde, boc-glycine and t-butylisocyanide is described. Triplicate runs of 48 parallel experiments are reported, varying concentration, solvent and the excess of some of the reagents. The isolation of the product was achieved by a simple filtration and wash procedure. The highest yield obtained was 66% from 0.4 M methanol with 1.2 eq. of imine. This is significantly above the 49% yield obtained from the initial reaction under equimolar concentration at 0.4 M in methanol. Methanol solutions with reagent concentrations of 0.4M or 0.2M gave superior yields while all solvent systems at 0.07M performed poorly. At 0.2M, methanol and ethanol/methanol (60/40) mixtures were statistically equally good while THF/methanol (60/40) was poor and acetonitrile/methanol (60/40) was intermediate. Good reproducibility of the precipitate yields was obtained in these replicate experiments, allowing for subtle interaction effects to be positively identified.

The Ugi reaction has proved to be a convenient way to quickly create diverse libraries of compounds. It involves the reaction of an amine, an aldehyde, a carboxylic acid and an isonitrile typically in methanol at room temperature. In this video, we utilize a 48-slot Mettler-Toledo MiniBlock equipped with filtration tubes and a Mettler-Toledo MiniMapper automated liquid handler was used to deliver the reagents and solvent. The parameters of interest were the concentration, the solvent composition and the excess of some of the reagents.

Optimización de la reacción de Ugi mediante la síntesis en paralelo y manejo de líquidos automatizados

The optimization of a Ugi reaction involving the mixing of furfurylamine, benzaldehyde, boc-glycine and t-butylisocyanide is described.  Triplicate runs ...

Investigación

Biología

Elevated Plus Maze for Mice

Although the mouse genome is now completely sequenced, the functions of most of the genes expressed in the brain are not known. The influence of a given gene on a specific behavior can be determined by behavioral analysis of mutant mice. If a target gene is expressed in the brain, behavioral phenotype of the mutant mice could elucidate the genetic mechanism of normal behaviors. The elevated plus maze test is one of the most widely used tests for measuring anxiety-like behavior. The test is based on the natural aversion of mice for open and elevated areas, as well as on their natural spontaneous exploratory behavior in novel environments. The apparatus consists of open arms and closed arms, crossed in the middle perpendicularly to each other, and a center area. Mice are given access to all of the arms and are allowed to move freely between them. The number of entries into the open arms and the time spent in the open arms are used as indices of open space-induced anxiety in mice. Unfortunately, the procedural differences that exist between laboratories make it difficult to duplicate and compare results among laboratories. Here, we present a detailed movie demonstrating our protocol for the elevated plus maze test. In our laboratory, we have assessed more than 90 strains of mutant mice using the protocol shown in the movie. These data will be disclosed as a part of a public database that we are now constructing.
Visualization of the protocol will promote better understanding of the details of the entire experimental procedure, allowing for standardization of the protocols used in different laboratories and comparisons of the behavioral phenotypes of various strains of mutant mice assessed using this test. 


The elevated plus maze test is one of the most widely used tests for measuring anxiety-like behavior in mice. Here, we present a movie showing the detailed procedures for conducting the test.

Laberinto elevado Plus para ratones

Although the mouse genome is now completely sequenced, the functions of most of the genes expressed in the brain are not known. The influence of a given ...

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the richness of biological information it provides. MR does not require any ionizing radiation and can noninvasively provide higher resolution and better signal-to-noise ratio in comparison to other tomographic or spectroscopic modalities. In this protocol, we will focus on small animal MR imaging and MR spectroscopy (MRI/MRS) to noninvasively acquire relaxation weighted 1H images of mouse and to obtain 31P spectra of mouse muscle. This work does not attempt to cover every aspect of small animal MRI/MRS but rather introduces basic procedures of mouse MRI/MRS experiments. The main goal of this work is to inform researchers of the basic procedures for in vivo MR experiments on small animals. The goal is to provide a better understanding of basic experimental procedures to allow researchers new to the MR field to better plan for non-MR components of their studies so that both MR and non-MR procedures are seamlessly integrated.

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

This work describes basic procedures of noninvasive small animal MRI and MRS in vivo.

No invasiva En Vivo Pequeños Animales MRI y MRS: Procedimientos básicos Experimental

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the ...

Multiplexed Fluorometric ImmunoAssay Testing Methodology and Troubleshooting

To ensure the quality of animal models used in biomedical research we have developed a number of diagnostic testing strategies and methods to determine if animals have been exposed to adventitious infectious agents (viruses, mycoplasma, and other fastidious microorganisms). Infections of immunocompetent animals are generally transient, yet serum antibody responses to infection often can be detected within days to weeks and persist throughout the life of the host. Serology is the primary diagnostic methodology by which laboratory animals are monitored. Historically the indirect enzyme-linked immunosorbent assay (ELISA) has been the main screening method for serosurveillance. The ELISA is performed as a singleplex, in which one microbial antigen-antibody reaction is measured per well. In comparison the MFIA is performed as a multiplexed assay. Since the microspheres come in 100 distinct color sets, as many as 100 different assays can be performed simultaneously in a single microplate well. This innovation decreases the amount of serum, reagents and disposables required for routine testing while increasing the amount of information obtained from a single test well. In addition, we are able to incorporate multiple internal control beads to verify sample and system suitability and thereby assure the accuracy of results. These include tissue control and IgG anti-test serum species immunoglobulin (&alpha;Ig) coated bead sets to evaluate sample suitability. As in the ELISA and IFA, the tissue control detects non-specific binding of serum immunoglobulin. The &alpha;Ig control (Serum control) confirms that serum has been added and contains a sufficient immunoglobulin concentration while the IgG control bead (System Suitability control), coated with serum species immunoglobulin, demonstrates that the labeled reagents and Luminex reader are functioning properly.

Using Luminex Corporation&#x2019;s xMAP microsphere technology, we have developed the Multiplexed Fluorometric ImmunoAssay (MFIA) for serosurveillance of various laboratory animal species. The MFIA is a suspension microarray where antigen, tissue control or immunoglobulins are covalently linked to color-coded polystyrene microspheres. The MFIA testing method as well as various troubleshooting topics is addressed.

Multiplexado inmunoensayo fluorométrico Metodología de prueba y solución de problemas

To ensure the quality of animal models used in biomedical research we have developed a number of diagnostic testing strategies and methods to determine if ...

Basic Caenorhabditis elegans Methods: Synchronization and Observation

Research into the molecular and developmental biology of the nematode Caenorhabditis elegans was begun in the early seventies by Sydney Brenner and it has since been used extensively as a model organism 1. C. elegans possesses key attributes such as simplicity, transparency and short life cycle that have made it a suitable experimental system for fundamental biological studies for many years 2. Discoveries in this nematode have broad implications because many cellular and molecular processes that control animal development are evolutionary conserved 3.
C. elegans life cycle goes through an embryonic stage and four larval stages before animals reach adulthood. Development can take 2 to 4 days depending on the temperature. In each of the stages several characteristic traits can be observed. The knowledge of its complete cell lineage 4,5 together with the deep annotation of its genome turn this nematode into a great model in fields as diverse as the neurobiology 6, aging 7,8, stem cell biology 9 and germ line biology 10. 
An additional feature that makes C. elegans an attractive model to work with is the possibility of obtaining populations of worms synchronized at a specific stage through a relatively easy protocol. The ease of maintaining and propagating this nematode added to the possibility of synchronization provide a powerful tool to obtain large amounts of worms, which can be used for a wide variety of small or high-throughput experiments such as RNAi screens, microarrays, massive sequencing, immunoblot or in situ hybridization, among others. 
Because of its transparency, C. elegans structures can be distinguished under the microscope using Differential Interference Contrast microscopy, also known as Nomarski microscopy. The use of a fluorescent DNA binder, DAPI (4',6-diamidino-2-phenylindole), for instance, can lead to the specific identification and localization of individual cells, as well as subcellular structures/defects associated to them.

Basic Caenorhabditis elegans Methods: Synchronization and Observation

The easiness of maintaining and propagating the nematode C. elegans make it a nice model organism to work with. The possibility of synchronizing worms allows the work with a significant amount of subjects at the same developmental stage, what facilitates the study of one particular process in many animals.

Básico<em&gt; Caenorhabditis elegans</em&gt; Métodos de sincronización y de observación

Research into the molecular and developmental biology of the nematode Caenorhabditis elegans was begun in the early seventies by Sydney Brenner and it has ...

A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies

The late 1970s saw the first publicly reported use of the western blot, a technique for assessing the presence and relative abundance of specific proteins within complex biological samples. Since then, western blotting methodology has become a common component of the molecular biologists experimental repertoire. A cursory search of PubMed using the term &#8220;western blot&#8221; suggests that in excess of two hundred and twenty thousand published manuscripts have made use of this technique by the year 2014. Importantly, the last ten years have seen technical imaging advances coupled with the development of sensitive fluorescent labels which have improved sensitivity and yielded even greater ranges of linear detection. The result is a now truly Quantifiable Fluorescence based Western Blot (QFWB) that allows biologists to carry out comparative expression analysis with greater sensitivity and accuracy than ever before. Many &#8220;optimized&#8221; western blotting methodologies exist and are utilized in different laboratories. These often prove difficult to implement due to the requirement of subtle but undocumented procedural amendments. This protocol provides a comprehensive description of an established and robust QFWB method, complete with troubleshooting strategies.

The advancement of western blotting using fluorescence has allowed detection of subtle changes in protein expression enabling quantitative analyses. Here we describe a robust methodology for detection of a range of proteins across a variety of species and tissue types. A strategy to overcome common technical problems is also provided.

Una guía para la moderna cuantitativa fluorescente Western Blot con las estrategias de solución de problemas

The late 1970s saw the first publicly reported use of the western blot, a technique for assessing the presence and relative abundance of specific proteins ...

A Strategy to Validate the Role of Callose-mediated Plasmodesmal Gating in the Tropic Response

The plant hormone auxin plays an important role in many growth and developmental processes, including tropic responses to light and gravity. The establishment of an auxin gradient is a key event leading to phototropism and gravitropism. Previously, polar auxin transport (PAT) was shown to establish an auxin gradient in different cellular domains of plants. However, Han et al. recently demonstrated that for proper auxin gradient formation, plasmodesmal callose-mediated symplasmic connectivity between the adjacent cells is also a critical factor. In this manuscript, the strategy to elucidate the role of particular genes, which can affect phototropism and gravitropism by altering the symplasmic connectivity through modulating plasmodesmal callose synthesis, is discussed. The first step is to screen aberrant tropic responses from 3-day-old etiolated seedlings of mutants or over-expression lines of a gene along with the wild type. This preliminary screening can lead to the identification of a range of genes functioning in PAT or controlling symplasmic connectivity. The second screening involves the sorting of candidates that show altered tropic responses by affecting symplasmic connectivity. To address such candidates, the movement of a symplasmic tracer and the deposition of plasmodesmal callose were examined. This strategy would be useful to explore new candidate genes that can regulate symplasmic connectivity directly or indirectly during tropic responses and other developmental processes.

This article describes the methods for screening the genes controlling plasmodesmal permeability and hence auxin gradient during tropic response. This includes the measurement of the degree of tropic response in hypocotyl of Arabidopsis thaliana and checking plasmodesmal permeability by 8-hydroxypyrene-1,3,6-trisulfonic acid (HPTS) loading and finally callose level assessment.

Una estrategia para validar el papel de callosa mediada Plasmodesmal de apertura de puerta en la respuesta Tropic

The plant hormone auxin plays an important role in many growth and developmental processes, including tropic responses to light and gravity. The ...

A Rapid Automated Protocol for Muscle Fiber Population Analysis in Rat Muscle Cross Sections Using Myosin Heavy Chain Immunohistochemistry

Quantification of muscle fiber populations provides a deeper insight into the effects of disease, trauma, and various other influences on skeletal muscle composition. Various time-consuming methods have traditionally been used to study fiber populations in many fields of research. However, recently developed immunohistochemical methods based on myosin heavy chain protein expression provide a quick alternative to identify multiple fiber types in a single section. Here, we present a rapid, reliable and reproducible protocol for improved staining quality, allowing automatic acquisition of whole cross sections and automatic quantification of fiber populations with ImageJ. For this purpose, embedded skeletal muscles are cut in cross sections, stained using myosin heavy chains antibodies with secondary fluorescent antibodies and DAPI for cell nuclei staining. Whole cross sections are then scanned automatically using a slide scanner to obtain high-resolution composite pictures of the entire specimen. Fiber population analyses are subsequently performed to quantify slow, intermediate and fast fibers using an automated macro for ImageJ. We have previously shown that this method can identify fiber populations reliably to a degree of &#177;4%. In addition, this method reduces inter-user variability and time per analyses significantly using the open source platform ImageJ.

Here, we present a protocol for rapid muscle fiber analyses, which allows improved staining quality, and thereby automatic acquisition and quantification of fiber populations using the freely available software ImageJ.

Un Protocolo Automatizado Rápido de Fibra Análisis Población en músculo de rata Secciones representativas Uso de la cadena pesada de miosina inmunohistoquímica

Quantification of muscle fiber populations provides a deeper insight into the effects of disease, trauma, and various other influences on skeletal muscle ...

Procedure and Key Optimization Strategies for an Automated Capillary Electrophoretic-based Immunoassay Method

New technologies that utilize capillary-based immunoassays promise faster and more quantitative protein assessment compared to traditional immunoassays. However, similar to other antibody-based protein assays, optimization of capillary-based immunoassay parameters, such as protein concentration, antibody dilution, and exposure time is an important prerequisite to the generation of meaningful and reliable data. Measurements must fall within the linear range of the assay where changes in signal are directly proportional to changes in lysate concentration. The process of choosing appropriate lysate concentrations, antibody dilutions, and exposure times in the human bronchial epithelial cell line, BEAS-2B, is demonstrated here. Assay linearity is shown over a range of whole cell extract protein concentrations with p53 and &#945;-tubulin antibodies. An example of signal burnout is seen at the highest concentrations with long exposure times, and an &#945;-tubulin antibody dilution curve is shown demonstrating saturation. In addition, example experimental results are reported for doxorubicin-treated cells using optimized parameters.

A capillary-based immunoassay using a commercial platform to measure target proteins from total protein preparations is demonstrated. In addition, assay parameters of exposure time, protein concentration, and antibody dilution are optimized for a cell culture model system.

Procedimiento y estrategias clave de la optimización para un método de inmunoensayo de basadas en electroforesis capilar automatizado

New technologies that utilize capillary-based immunoassays promise faster and more quantitative protein assessment compared to traditional immunoassays. ...

Simultaneous Measurements of Intracellular Calcium and Membrane Potential in Freshly Isolated and Intact Mouse Cerebral Endothelium

Cerebral arteries and their respective microcirculation deliver oxygen and nutrients to the brain via blood flow regulation. Endothelial cells line the lumen of blood vessels and command changes in vascular diameter as needed to meet the metabolic demand of neurons. Primary endothelial-dependent signaling pathways of hyperpolarization of membrane potential (Vm) and nitric oxide typically operate in parallel to mediate vasodilation and thereby increase blood flow. Although integral to coordinating vasodilation over several millimeters of vascular length, components of endothelium-derived hyperpolarization (EDH) have been historically difficult to measure. These components of EDH entail intracellular Ca2+ [Ca2+]i increases and subsequent activation of small- and intermediate conductance Ca2+-activated K+ (SKCa/IKCa) channels.
Here, we present a simplified illustration of the isolation of fresh endothelium from mouse cerebral arteries; simultaneous measurements of endothelial [Ca2+]i and Vm using Fura-2 photometry and intracellular sharp electrodes, respectively; and a continuous superfusion of salt solutions and pharmacological agents under physiological conditions (pH 7.4, 37 &#176;C). Posterior cerebral arteries from the Circle of Willis are removed free of the posterior communicating and the basilar arteries. Enzymatic digestion of cleaned posterior cerebral arterial segments and subsequent trituration facilitates removal of adventitia, perivascular nerves, and smooth muscle cells. Resulting posterior cerebral arterial endothelial &#34;tubes&#34; are then secured under a microscope and examined using a camera, photomultiplier tube, and one to two electrometers while under continuous superfusion. Collectively, this method can simultaneously measure changes in endothelial [Ca2+]i and Vm in discrete cellular locations, in addition to the spreading of EDH through gap junctions up to millimeter distances along the intact endothelium. This method is expected to yield a high-throughput analysis of the cerebral endothelial functions underlying mechanisms of blood flow regulation in the normal and diseased brain.

Demonstrated here are protocols for (1) freshly isolating intact cerebral endothelial "tubes" and (2) simultaneous measurements of endothelial calcium and membrane potential during endothelium-derived hyperpolarization. Further, these methods allow for pharmacological tuning of endothelial cell calcium and electrical signaling as individual or interactive experimental variables.

Medidas simultáneas de calcio intracelular y el potencial de membrana en el endotelio Cerebral de ratón recién aislado e intacto

Cerebral arteries and their respective microcirculation deliver oxygen and nutrients to the brain via blood flow regulation. Endothelial cells line the ...