Este trabajo fue apoyado por becas R01DE018138 de los Institutos Nacionales de Salud (PX) y, en parte, por la Virginia Commonwealth University Programa Presidencial de Incentivos de Investigación (PRIP) 144602-3 (PX). Agradecemos a los Dres. Lei Chen, Yuetan Dou y Wang Xiaojing para ayudar con la construcción de mutantes del genoma de ancho. Agradecemos también a la facilidad de la base de ADN en la Universidad Virginia Commonwealth University para la secuenciación del ADN.

1. Primer Diseño <ol><li> Los cebadores se diseñan utilizando en los guiones de las casas basado en el S. sanguinis SK36 secuencia del genoma. Tres conjuntos de cebadores, F1/R1, F2/R2, y F3/R3 están diseñados para la amplificación de la 1-kb secuencia arriba del gen diana, la aphA-3 gen que codifica la resistencia a la kanamicina (Km r) proteína 3 y 1 el -kb aguas abajo secuencia del gen diana, respectivamente (Figura 1). Entre estos cebadores, F1 y R3 están diseñados usando ePrimer3 en la suite de programas de EMBOSS ( <a href="http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html" target="_blank">http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html</a> ) para amplificar las regiones flanqueantes aguas arriba o aguas abajo de la diana gen. Cebadores específicos de genes, R1 y F3, se han diseñado basándose en el 5 &#39;y 3&#39; secuencias del gen diana. Cebadores R1 y F3 contiene 25-bp secuencias de adaptador en su extremo 5 &#39;que son complementarias a la aphA-3gen. Las temperaturas de fusión de cada cebador fueron diseñados para ser lo más cercano posible a 60 ° C para permitir el uso de una temperatura de recocido uniforme para todas las reacciones de PCR en 96-y formato. </li><li> F1, R1, R3 F3 y cebadores se sintetizan en placas de 96 pocillos con base en una orden de genes. Cada placa contiene un tipo de cebadores en el orden mismo gen. Diluir los cebadores en 96-y la placa de cebador de trabajo a una concentración final de 10 mM para la amplificación por PCR utilizando una pipeta multicanal. </li></ol> 2. De alto rendimiento PCR amplificación y purificación <ol><li> Para alto rendimiento amplificar 1-kb aguas arriba o aguas abajo de la diana S. genes sanguinis, montar una mezcla de cóctel PCR en hielo en un tubo cónico de 15-ml que contiene 1640 l ddH 2 O, 250 l 10xHigh Fidelity PCR Buffer, 200 l de 10 mM de mezcla dNTP, 100 l de 50 mM MgSO 4, 100 l de 10 ng / l S. sanguinis SK36 de ADN genómico y 10 l Platinum Taq ADN polymerase alta fidelidad y la transferencia de 23 l de la mezcla en cada pocillo en placas de 96 pocillos PCR usando una pipeta multicanal. Transferir 1 l de cada F1 y R1 (o F3 y R3) a partir de los 10 mM de trabajo placas de cebadores para la placa de PCR usando una pipeta multicanal. Sellar la placa de PCR y realizar la amplificación a 94 ° C durante 1 min, y 30 ciclos de 94 ° C durante 30 seg, 54 ° C durante 30 seg y 68 ° C durante 1,5 min. </li><li> Preparar un 1% en gel de agarosa que contengan bromuro de etidio con 48 pozos de ajuste de carga pipeta multicanal. Mezclar 4 l producto de PCR con 1 l de tampón de carga 5xDNA en placa de 96 pocillos y cargar las muestras en un gel de agarosa utilizando una pipeta multicanal 10-l. Ejecutar la electroforesis a 135 V durante 30 min. Examine la banda en el gel bajo UVP documentación y sistema de análisis. </li><li> Purificar los productos de PCR por PureLink 96 kit de purificación de PCR usando centrifugación de acuerdo con las instrucciones del fabricante. Para eluir el ADN, añadir 40 l estéril ddH 2 O para el bienestar de la bncontrar plato. </li><li> Escoger al azar varios amplicones purificados en la placa para examinar las concentraciones de ADN utilizando espectrofotómetro NanoDrop. Ajustar la concentración de los amplicones en la placa a ~ 10 ng / ul. </li><li> Un plásmido que contiene kilometros casete r es digerido usando EcoR I como molde de PCR. El plásmido digerido se purificó por kit de purificación de PCR QIAquick y el ADN del plásmido lineal se ajusta a la concentración de ADN final de 10 ng / ul. Ensamble mezcla 25 l para amplicón kilometros casete r incluyendo 16.4 l O ddH 2, 2,5 l 10xHigh Fidelity PCR Buffer, 2 l de 10 mM dNTP mezcla, 1 l de 50 mM Mg SO 4, 1 l de 10 mM F2, 1 l de 10 mM R2, 1 l de ADN plásmido lineal y 0,1 l de platino Taq ADN polimerasa de alta fidelidad. Realizar la amplificación de PCR a 94 ° C durante 1 min, y 30 ciclos de 94 ° C durante 30 seg, 55 ° C durante 30 seg y 68 ° C durante 1 min. Examine el producto de la PCR por electroforesis en gel de agarosa al 1%. Poola mayor parte de la amplificación de casete de 10 kilometros r individuo PCR purificado con el kit de purificación de PCR QIAquick. Ajustar la concentración de amplicón a 10 ng / ul. </li><li> Para obtener la última lineal amplicón PCR recombinante, tres amplicones de PCR se combinan con cada l 1 (en cantidades casi iguales-molar) en una placa de PCR así como la plantilla para la PCR. Otros componentes de la PCR se añade incluyendo 14.4 l O ddH 2, 2,5 l 10xHigh Fidelity PCR Buffer, 2 l de 10 mM dNTP mezcla, 1 l de 50 mM Mg SO 4, 1 l de 10 mM F1, 1 l de 10 R3 mu M, 0,1 l Platinum Taq DNA polimerasa de alta fidelidad. Amplificación por PCR se realizó a 94 º C durante 2 min, 30 ciclos de 94 ° C durante 30 seg 55 ° C durante 30 seg y 68 ° C durante 3,5 min, y finalmente 68 ° C durante 4 min. </li><li> Examinar los amplicones de PCR en gel de agarosa. Purificar y cuantificar los amplicones de la PCR como se describe anteriormente. Congelar los recombinados amplicones de la PCR a -20 ° C. </li></ol> 3. ComCélulas Preparación competente <ol><li> Caldo Todd Hewitt se preparó, pH ajustado a 7,6 con NaOH 10 N, se calienta a ebullición y después se enfrió a temperatura ambiente y se esterilizó usando poliestireno 0,22 micras filtro 4. Añadir 300 l caballo inactivado por calor suero (concentración final de 2,5%) a 11,7 ml de caldo Todd Hewitt en 15-ml tubo cónico para compensar TH + HS medio. TH alícuota + HS medio a 2 ml y 10 ml en tubos. </li><li> Inocular 5 l de existencias S. sanguinis SK36 congelado a -80 ° C en 2 ml de medio de TH + HS e incubar el cultivo durante la noche con tapado herméticamente a 37 º C, acompañada de pre-incubación de la 10 ml-TH + tubo HS. </li><li> Después de toda la noche, transferir 50 cultura l en 10 ml TH + HS y se incuba el tubo a 37 º C durante 3 h (correspondiente a OD 660 de 0.07 hasta 0.08), de usar inmediatamente para la transformación. </li></ol> 4. Celular Transformación y selección de antibióticos <ol><li> Añadir 2 l de 70 ng S. sanguinis SK36 competenciatencia péptido estimulante (CSP) y 2 l lineal de amplificación de PCR recombinante (~ 50 ng) a tubos Eppendorf de 96 pocillos bloque y los pre-calentamiento a 37 º C. Transferir 330 l de 3 hr-incubado SK36 cultura en cada tubo. Incubar a 37 ° C durante 1 hr. Reemplazar con ADN estéril O ddH 2 como control. </li><li> Colocar el bloque de hielo y se extendió en 100 l de cada transformación en infusión de cerebro corazón (BHI) placa de agar con 500 mg / ml de kanamicina. Incubar las placas a 37 ° C durante 2 días bajo condiciones microaeróbicas. </li></ol> 5. Confirmación mutante y almacenamiento <ol><li> Para cada mutante de reemplazo, escoger al azar hasta 2 colonias individuales, inocular la colonia en 5 ml de BHI que contenía 500 ug / ml de kanamicina y se incuba el inóculo microaerobically durante la noche a 37 ° C. Criopreservar cada cultivo en 30% de glicerol a -80 ° C </li><li> Para examinar si el mutante que contiene el reemplazo de genes de esperar, realizar la PCR de colonias para cada mutante utilizando F1 y R3cebadores en placas de 96 pocillos PCR. Acerca de 1-l cultivo de una noche de colonia individual se utiliza como el molde de ADN en 25-l PCR-amplificación de la reacción. PCR se realizó a 94 º C durante 5 min, 35 ciclos de 94 ° C durante 30 seg, 55 ° C durante 30 seg y 68 ° C durante 3,5 min, y finalmente 68 ° C durante 4 min. </li><li> Para identificar con precisión doble banda mutantes o contaminante amplificación PCR, examine la amplificación de PCR mediante electroforesis durante 4 horas a&gt; 12 cm de largo 2% en gel de agarosa con tinción de bromuro de etidio. Bajo esta condición, la electroforesis en gel de agarosa, los amplicones con ≥ 100 pb se diferencia claramente identificados. Cuando las bandas resultantes de la amplificación de la casete r kilometros y el gen de tipo salvaje se prevé que difieren en &lt;100 pb, se utiliza un cebador T1 interna para determinar si un gen de tipo salvaje puede ser detectada por PCR. </li><li> Para confirmar aún más la eliminación, los amplicones se purificó por PureLink 96 kit de purificación de PCR y se secuenciaron usando el cebador P1 cualse une a la casete r kilometros. Mantener sólo mutantes correctos confirmados por secuenciación. </li></ol>

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

No hay conflictos de interés declarado.

Para minimizar los posibles efectos polares de la sustitución de un gen diana con el gen exógeno antibióticos en los genes vecinos, dos pasos se toman mientras imprimación inicial de diseñar. Para la mayoría de los genes suprimidos, la cebadores R1 y F3 están diseñadas para eliminar la región de codificación de 6 pb después del codón de inicio a 30 pb antes del codón de parada. Los últimos 30 pares de bases se mantienen para proteger potencial sitio de unión ribosómica utilizado por el gen corriente abaj...

<table border="1"&gt;<tbody&gt;<tr&gt;<td<strong&gt; Nombres</strong</td&gt;<td<strong&gt; Empresa</strong</td&gt;<td<strong&gt; Catálogo #</strong</td&gt;<td<strong&gt; Comentarios (opcional)</strong</td&gt;</tr&gt;<tr&gt;<td&gt; Primer F2</td&gt;<td&gt; Integrated DNA Tecnologías</td&gt;<td</td&gt;<td&gt; TGACTAACTAGGAGGAATAAATG<br/&gt; GCTAAAATGAGAATAT</td&gt;</tr&gt;<tr&gt;<td&gt; Primer R2</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; CATTATTCCCTCCAGGTACTAAAA<br/&gt; CAATTCATCCAGT</td&gt;</tr&gt;<tr&gt;<td&gt; Primer F2P</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GATAAACCCAGCGAACCATTTGA</td&gt;</tr&gt;<tr&gt;<td&gt; Primer P1</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GCTTATATACCTTAGCAGGAGACA</td&gt;</tr&gt;<tr&gt;<td&gt; Primer P2</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GTATGACATTGCCTTCTGCGTCC</td&gt;</tr&gt;<tr&gt;<td&gt; Cebador 5 &#39;end_R1_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GCCATTTATTCCTCCTAGTTAGTCA</td&gt;</tr&gt;<tr&gt;<td&gt; Cebador 5 &#39;end_F3_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GTTTTAGTACCTGGAGGGAATAATG</td&gt;</tr&gt;<tr&gt;<td&gt; Cebador 5 &#39;end_R1p_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; CCTCAAATGGTTCGCTGGGTTTATC</td&gt;</tr&gt;<tr&gt;<td&gt; CSP</td&gt;<td&gt; Synprep</td&gt;<td</td&gt;<td&gt; Secuencia: NH2-DLRGVPNPWGWIFGR-COOH</td&gt;</tr&gt;<tr&gt;<td&gt; ADN polimerasa</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; 11304-102</td&gt;<td&gt; Platinum Taq ADN polimerasa de alta fidelidad</td&gt;</tr&gt;<tr&gt;<td&gt; EcoRI</td&gt;<td&gt; New England Biolabs Inc</td&gt;<tdR0101S&gt;</td&gt;<td&gt; Enzima de restricción</td&gt;</tr&gt;<tr&gt;<td&gt; Agar</td&gt;<td&gt; Bioanalytical americano</td&gt;<td&gt; AB01185</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Agarosa</td&gt;<td&gt; Promega</td&gt;<td&gt; V3125</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; BHI</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 237500</td&gt;<td&gt; Infusión de cerebro y corazón</td&gt;</tr&gt;<tr&gt;<td&gt; El suero de caballo</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; SH3007403</td&gt;<td&gt; El suero de caballo</td&gt;</tr&gt;<tr&gt;<td&gt; Km</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; BP906-5</td&gt;<td&gt; Kanamicina</td&gt;</tr&gt;<tr&gt;<td&gt; TH caldo</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 249240</td&gt;<td&gt; Todd Hewitt caldo</td&gt;</tr&gt;<tr&gt;<td&gt; 96 PureLink</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; K310096</td&gt;<td&gt; PureLink 96 kit de purificación de PCR</td&gt;</tr&gt;<tr&gt;<td&gt; QIAquick</td&gt;<td&gt; Qiagen</td&gt;<td&gt; 28106</td&gt;<td&gt; QIAquick PCR purification kit</td&gt;</tr&gt;<tr&gt;<td&gt; Filtro</td&gt;<td&gt; Corning</td&gt;<td&gt; 431117</td&gt;<td&gt; 0,22 micras filtro de poliestireno</td&gt;</tr&gt;<tr&gt;<td&gt; Sistema Anoxomat</td&gt;<td&gt; Mart Microbiología bv</td&gt;<td&gt; Anoxomat Mark II</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Centrífuga de sobremesa</td&gt;<td&gt; Thermo Scientific</td&gt;<td&gt; 75004377</td&gt;<td&gt; Sorvall Legend RT Plus rotor para microplacas</td&gt;</tr&gt;<tr&gt;<td&gt; Gel Documentación</td&gt;<td&gt; UVP LLC</td&gt;<td&gt; BioDoc-It 210</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Incubadora</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; 11-690-625D</td&gt;<td&gt; Isotemp</td&gt;</tr&gt;<tr&gt;<td&gt; Labnet de Gel XL</td&gt;<td&gt; Labnet</td&gt;<td&gt; E0160</td&gt;<td&gt; Labnet de Gel XL</td&gt;</tr&gt;<tr&gt;<td&gt; Microcentrífuga</td&gt;<td&gt; Eppendorf</td&gt;<td&gt; 22621408</td&gt;<td&gt; Microcentrífuga 5415 R</td&gt;</tr&gt;<tr&gt;<td&gt; Pipetas multicanal</td&gt;<td&gt; Thermo Scientfic</td&gt;<td&gt; 4661040, 4661020</td&gt;<td&gt; Finnpipette F1</td&gt;</tr&gt;<tr&gt;<td&gt; Thermal Cycler</td&gt;<td&gt; Applied Biosystems Inc.</td&gt;<td&gt; N805-0200</td&gt;<td&gt; GeneAmp PCR system 9700</td&gt;</tr&gt;</tbody&gt;</table

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

Mutagénesis de transposones y deleción de un solo gen son dos métodos aplicados en knockout de genes en todo el genoma en 1,2 bacterias. Aunque mutagénesis de transposones consume menos tiempo, menos costoso, y no requiere la información completa del genoma, hay dos puntos débiles en este método: (1) la posibilidad de una mutantes dispares en la biblioteca mixta mutante que contra-selecciona mutantes con competencia disminuido; y (2) la posibilidad de la inactivación parcial del gen mediante el cual los genes no totalmente perder su función después de la inserción de un transposón. De un solo gen análisis de deleción puede compensar los inconvenientes asociados con la mutagénesis de transposones. Para mejorar la eficiencia de todo el genoma deleción del gen individual, tratamos de establecer una técnica de alto rendimiento para todo el genoma deleción del gen único usando Streptococcus sanguinis como organismo modelo. Cada supresión construcción génica en S. sanguinis genoma está diseñado para comprender 1-Kb aguas arriba del gen diana, el gen aphA-3, proteína que codifica resistencia a la kanamicina, y 1-kb aguas abajo del gen diana. Tres conjuntos de cebadores F1/R1, F2/R2, y F3/R3, respectivamente, se diseñaron y sintetizaron en un formato de placa de 96 pocillos para PCR-amplificaciones de los tres componentes de cada construcción de deleción. Cebadores R1 y F3 contiene 25-bp secuencias que son complementarias a las regiones del gen aphA-3 en su extremo 5 &#39;. A gran escala amplificación por PCR del gen aphA-3 se realiza una vez para crear todas las construcciones de deleción de un solo gen. El promotor del gen aphA-3 está inicialmente excluidos para minimizar el potencial efecto polar de casete de kanamicina. Para crear las construcciones de deleción de genes, de alto rendimiento de la amplificación por PCR y la purificación se realizan en un formato de placa de 96 pocillos. Un amplicón de PCR recombinante lineal para cada gen de supresión se hace a través de cuatro reacciones de PCR de alta fidelidad utilizando ADN polimerasa. El expon inicialfase de crecimiento preferencial de S. sanguinis cultivadas en caldo Todd Hewitt suplementado con 2,5% de suero de caballo inactivado se utiliza para aumentar la competencia para la transformación de la PCR recombinante construcciones. Bajo esta condición, hasta el 20% de S. células sanguinis se puede transformar usando ~ 50 ng de ADN. Sobre la base de este enfoque, 2048 mutantes con deleción de un solo gen se obtuvieron en última instancia de los 2.270 genes en S. sanguinis excluyendo cuatro ORFs de genes contenida enteramente dentro de otros ORFs en S. sanguinis SK36 y 218 genes esenciales potenciales. La técnica en la creación de construcciones de genes de deleción es de alto rendimiento y podría ser fácil de usar en todo el genoma deleciones de genes individuales para cualquier bacteria transformables.

Después de la amplificación por PCR usando los cebadores F1 y R1, R3 y F3 y, aproximadamente 1-kb aguas arriba y aguas abajo de cada S. sanguinis gen se obtuvieron en formato de 96-pocillos, respectivamente (Figura 2A). Bajo nuestras condiciones de PCR y usando cebadores diseñados, un producto específico se amplificó a partir de S. sanguinis de ADN genómico en cada reacción de PCR. Este resultado indica los cebadores eran altamente específicos para los objetivos de S. sangu...

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Un genoma único método eficaz mutación del gen se ha establecido utilizando<em&gt; Streptococcus sanguinis</em&gt; Como un organismo modelo. Este método se logra a través de PCR recombinante de alto rendimiento y transformaciones.

Genoma escala supresiones de genes en<em&gt; Streptococcus sanguinis</em&gt; Por PCR de alto rendimiento

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

genome-wide-gene-deletions-streptococcus-sanguinis-high-throughput

Research

JoVE Journal

Biology

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

16.4K vistas.  Virginia Commonwealth University. Un genoma único método eficaz mutación del gen se ha establecido utilizando Streptococcus sanguinis Como un organismo modelo. Este método se logra a través de PCR recombinante de alto rendimiento y transformaciones.

Video: Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

Análisis de todo el genoma con chip para identificar objetivos específicos para cada isoforma Gene

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

Investigación

Biología

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

Genoma toda la pantalla de los genes miARN objetivos mediante el objetivo de la misión Carnet de identificación

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. elegans, gene function can be knocked down simply and efficiently by feeding worms with bacteria expressing a dsRNA corresponding to a specific gene 1. While the creation of libraries of RNAi clones covering most of the C. elegans genome 2,3 opened the way for true functional genomic studies (see for example 4-7), most established methods are laborious. Moy and colleagues have developed semi-automated protocols that facilitate genome-wide screens 8. The approach relies on microscopic imaging and image analysis. 
	Here we describe an alternative protocol for a high-throughput genome-wide screen, based on robotic handling of bacterial RNAi clones, quantitative analysis using the COPAS Biosort (Union Biometrica (UBI)), and an integrated software: the MBioLIMS (Laboratory Information Management System from Modul-Bio) a technology that provides increased throughput for data management and sample tracking. The method allows screens to be conducted on solid medium plates. This is particularly important for some studies, such as those addressing host-pathogen interactions in C. elegans, since certain microbes do not efficiently infect worms in liquid culture.
	We show how the method can be used to quantify the importance of genes in anti-fungal innate immunity in C. elegans. In this case, the approach relies on the use of a transgenic strain carrying an epidermal infection-inducible fluorescent reporter gene, with GFP under the control of the promoter of the antimicrobial peptide gene nlp 29 and a red fluorescent reporter that is expressed constitutively in the epidermis. The latter provides an internal control for the functional integrity of the epidermis and nonspecific transgene silencing9. When control worms are infected by the fungus they fluoresce green. Knocking down by RNAi a gene required for nlp 29 expression results in diminished fluorescence after infection. Currently, this protocol allows more than 3,000 RNAi clones to be tested and analyzed per week, opening the possibility of screening the entire genome in less than 2 months.

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

We describe a protocol using C. elegans and RNAi feeding libraries that allows automated measurement of multiple parameters such as fluorescence, size and opacity of individual worms in a population. We give one example of a screen to identify genes involved in anti-fungal innate immunity in C. elegans.

Cuantitativos y automatizada de alto rendimiento del genoma completo de RNAi pantallas en C. elegans</em

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. ...

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

El Proceso de Monstruo Verde para la generación de cepas de levadura que llevan deleciones múltiples genes

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

Perfiles de Células Madre Embrionarias Humanas individual por RT-PCR cuantitativa

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay (PCA) in Living Cells

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often depend on its interactions with other proteins. Here, we describe a protocol for the yeast protein-fragment complementation assay (PCA), a powerful method to detect direct and proximal associations between proteins in living cells. The interaction between two proteins, each fused to a dihydrofolate reductase (DHFR) protein fragment, translates into growth of yeast strains in presence of the drug methotrexate (MTX). Differential fitness, resulting from different amounts of reconstituted DHFR enzyme, can be quantified on high-density colony arrays, allowing to differentiate interacting from non-interacting bait-prey pairs. The high-throughput protocol presented here is performed using a robotic platform that parallelizes mating of bait and prey strains carrying complementary DHFR-fragment fusion proteins and the survival assay on MTX. This protocol allows to systematically test for thousands of protein-protein interactions (PPIs) involving bait proteins of interest and offers several advantages over other PPI detection assays, including the study of proteins expressed from their endogenous promoters without the need for modifying protein localization and for the assembly of complex reporter constructs.

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay PCA in Living Cells

Proteins interact with each other and these interactions determine in a large part their functions. Protein interaction partners can be identified at high-throughput in vivo using a yeast fitness assay based on the dihydrofolate reductase protein-fragment complementation assay (DHFR-PCA).

Genoma toda la Proteína-proteína interacción Screening por Complementación de ensayo de proteínas-fragmento (PCA) en las células vivas

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Selección de alto rendimiento para moduladores químicos de genes post-transcripcionalmente regulados

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

qPCRTag Analysis - A High Throughput, Real Time PCR Assay for Sc2.0 Genotyping

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic chromosome, synIII1, and one synthetic chromosome arm, synIXR2, have been constructed and their in vivo function validated in the absence of the corresponding wild type chromosomes. An important design feature of Sc2.0 chromosomes is the introduction of PCRTags, which are short, re-coded sequences within open reading frames (ORFs) that enable differentiation of synthetic chromosomes from their wild type counterparts. PCRTag primers anneal selectively to either synthetic or wild type chromosomes and the presence/absence of each type of DNA can be tested using a simple PCR assay. The standard readout of the PCRTag assay is to assess presence/absence of amplicons by agarose gel electrophoresis. However, with an average PCRTag amplicon density of one per 1.5 kb and a genome size of ~12 Mb, the completed Sc2.0 genome will encode roughly 8,000 PCRTags. To improve throughput, we have developed a real time PCR-based detection assay for PCRTag genotyping that we call qPCRTag analysis. The workflow specifies 500 nl reactions in a 1,536 multiwell plate, allowing us to test up to 768 PCRTags with both synthetic and wild type primer pairs in a single experiment.

Designer chromosomes of the Synthetic Yeast Genome project, Sc2.0, can be distinguished from their native counterparts using a PCR-based genotyping assay called PCRTagging, which has a presence/absence endpoint. Here we describe a high-throughput real time PCR detection method for PCRTag genotyping.

Análisis qPCRTag - Un alto rendimiento, Tiempo real ensayo PCR para Sc2.0 Genotipado

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to dose-limiting toxicity and many adverse side effects. Targeting the genome with sequence-specific small molecules may enable molecules with increased therapeutic index and fewer off-target effects. N-methylpyrrole/N-methylimidazole polyamides are molecules that can be rationally designed to target specific DNA sequences with exquisite precision. And unlike most natural transcription factors, polyamides can bind to methylated and chromatinized DNA without a loss in affinity. The sequence specificity of polyamides has been extensively studied in vitro with cognate site identification (CSI) and with traditional biochemical and biophysical approaches, but the study of polyamide binding to genomic targets in cells remains elusive. Here we report a method, the crosslinking of small molecules to isolate chromatin (COSMIC), that identifies polyamide binding sites across the genome. COSMIC is similar to chromatin immunoprecipitation (ChIP), but differs in two important ways: (1) a photocrosslinker is employed to enable selective, temporally-controlled capture of polyamide binding events, and (2) the biotin affinity handle is used to purify polyamide&#8211;DNA conjugates under semi-denaturing conditions to decrease DNA that is non-covalently bound. COSMIC is a general strategy that can be used to reveal the genome-wide binding events of polyamides and other genome-targeting chemotherapeutic agents.

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

Identifying the direct targets of genome-targeting molecules remains a major challenge. To understand how DNA-binding molecules engage the genome, we developed a method that relies on crosslinking of small molecules to isolate chromatin (COSMIC).

Mapeo de todo el genoma de la droga-ADN interacciones en células con COSMIC (reticulación de pequeñas moléculas para aislar la cromatina)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

-DamID siguientes: Genoma de toda la cartografía de la proteína-ADN Interacciones de alto rendimiento de secuenciación de fragmentos de ADN adenina-metilado

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...