Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.

1. Cultivo Celular y Marcaje fluorescente de líneas celulares de cáncer de ovario <ol><li> Preparar medios SKOV3: medios McCoy suplementado con 10% de suero bovino fetal (FBS), 0,1 mM de L-glutamina, 50 U / ml de penicilina, y 50 mg / ml de estreptomicina. Mantener OVCA429 células en medio mínimo esencial (MEM) suplementado con 10% FBS, piruvato sódico 1 mM, 0,1 mM de L-glutamina, 50 U / ml de penicilina y 50 mg / ml de estreptomicina. </li><li> Propagar las líneas celulares SKOV3 y OVCA429 en un incubador humidificado a 37 ° C con 5% de CO 2. Se cultivan las células a 40-50% de confluencia. </li><li> Generar células que expresan la proteína fluorescente roja (RFP) con el fin de controlar la viabilidad in vitro e in vivo. <ol><li> Para generar células que expresan SKOV3 RFP, añadir partículas lentivirales que expresan RFP y 10 g / ml de polibreno a los medios SKOV3 en ausencia de penicilina y estreptomicina durante 72 horas. </li><li> Después de 72 horas, seleccione para RFP células positivas por fluorescencia de células activado Sorting (FACS) como sigue: trypsinize RFP y no las células que expresan RFP, centrifugar a 125 xg durante 5 min, se resuspenden las células en 10 7 células / ml en PBS que contenía 0,1% de BSA. En un clasificador de células, usar células no RFP para determinar los parámetros de clasificación. Luego recoger células que expresan altos RFP usando un láser de 561 nm. </li><li> Alternativamente, si el plásmido lentiviral expresa un casete de resistencia a los antibióticos, seleccionar las células que expresan RFP mediante el cultivo en el antibiótico apropiado (por ejemplo, 10 mg / ml de blasticidina). NOTA: La cantidad de partículas lentivirales que necesita ser usada puede variar por lote y por tipo de célula. Lentiviral título adecuado debe determinarse para cada tipo de célula. </li></ol></li></ol> 2. enriquecimiento de las células madre del cáncer <ol><li> Tratar SKOV3, SKOV3-RFP, o OVCA429 líneas celulares con 20 M de cisplatino durante 72 horas. PRECAUCIÓN: El cisplatino es tóxico. Use ropa de protección / guantes y evitar el contacto con la piel y las membranas mucosas. No se deshaga de cisplatino in de aguas residuales. </li><li> Preparar medios CSC: suero libre de medio DMEM / F12 suplementado con 5 mg / ml de insulina, 10 ng / factor de crecimiento epidérmico humano recombinante ml (EGF), 10 ng / factor de crecimiento de fibroblastos básico ml (bFGF), 12 ng / ml del factor inhibidor de la leucemia , y 0,4% de albúmina de suero bovino (BSA). </li><li> Células trypsinize. Cultura células supervivientes en los medios de CSC. NOTA: Después de 2 días en cultivo esferoides no adherentes se formarán. </li><li> Cambio de medio cada 2 días mediante la recopilación de los medios de comunicación que contiene las células y centrifugar a 125 xg durante 5 min. Entonces resuspender el precipitado en los medios de comunicación CSC fresco. Compruebe las células para la viabilidad cada 2 días contando las células y la realización de exclusión con azul de tripano. </li><li> Luego recoger CSC para experimentos adicionales por centrifugación 129 xg durante 5 min y resuspender el sedimento en fenol que contiene tiocianato de guanidinio (ARN), solución salina tamponada con fosfato (PBS: NaCl 137 mM, KCl 2,7 mM, y 11,9 mM de tampón de fosfato, pH 7,4) con 0,1% de BSA (por citometría de flujo), o los medios de comunicación CSC para continuarcultivar las células. </li><li> Controle la morfología celular CSC utilizando un microscopio óptico a 20x y 40x aumentos. </li></ol> 3. CSC Caracterización mediante análisis de expresión génica de marcadores de células madre <ol><li> Recoger 3 preparaciones de células madre cancerosas mediante la recopilación de medios que contienen células, centrifugar a 129 xg durante 5 min, y resuspender el precipitado en una solución de fenol que contiene tiocianato de guanidinio (otros métodos para la extracción de ARN se pueden utilizar). </li><li> Preparar el ARN total usando TRIzol según el protocolo del fabricante. Sintetizar ADN complementario (ADNc) 0,1-1 g de ARN usando un kit de transcripción inversa de ADNc disponibles comercialmente. </li><li> Realizar transcripción inversa reacción en cadena de la polimerasa cuantitativa (QRT-PCR). <ol><li> Maquillaje mezcla maestra para cada conjunto de cebadores que contenían la mezcla de QRT-PCR, cebadores, y agua a un total de 8 l por muestra (cebadores con diferentes fluoróforos se pueden amplificar en el mismo pocillo). Por ejemplo, generaruna mezcla maestra para Oct4-FAM, Nanog-Hex, y GAPDH-CY5. Generar mezclas maestras separadas para Nestin y PROM1. Añadir 2 l de cDNA plantilla por muestra. NOTA: Para este estudio, QRT-PCR se realizó usando los cebadores listados en la Tabla 1. </li><li> Realizar todos los QRT-PCR por duplicado para cada muestra utilizando un termociclador de PCR en tiempo real capaz de detectar múltiples fluoróforos. Incluya la plantilla no controles. </li><li> Normalizar la expresión génica de células madre para la expresión de GAPDH en cada muestra usando el método ΔΔC T. </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0" width="746"><colgroup><col /><col /></colgroup><tbody><tr height="21"><td height="63" rowspan="3" style="height:62px;width:111px;"> Oct-4-FAM </td><td style="width:636px;"> Cebador 1: 5&#39;-CCCAAGGAATAGTCTGTAGAAGTG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Primer 2: 5&#39;-TGCATGAGTCAGTGAACAGG-3 &#39;</td></tr><tr height="21"><td height="21" style="height:21px;"> FAM: 5&#39;-CTTCCAAGC / ZEN / TGCCCACCTAACTTCT / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> Nanog-HEX </td><td> Cebador 1: 5&#39;-CCTTCTGCGTCACACCATT-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Primer 2: 5&#39;-AACTCTCCAACATCCTGAACC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Sonda HEX: 5&#39;-CTGCCACCT / ZEN.CTTAGATTTCATTCTCTGGT / 3IABkFQ-3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> GAPDH con Cy5 </td><td> Cebador 1: 5&#39;-TGTAGTTGAGGTCAATGAAGGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Primer 2: 5&#39;-ACATCGCTCAGACACCATG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Sonda CY5: 5&#39;-AAGGTCGGAGTCAACGGATTTGGTC / 3IABRQSP-3 &#39; </td><html></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> Nestin-FAM </td><td> Cebador 1: 5&#39;-AGGACCTGAGCGATCTGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Primer 2: 5&#39;-CGTTGGAACAGAGGTTGGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> FAM: 5&#39;-AACTTTTCA / ZEN / GTAGCCCGCAGCC / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> CD133-HEX </td><td> Cebador 1: 5&#39;-ACTCTCTCCAACAATCCATTCC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Primer 2: 5&#39;-AAACAATTCACCAGCAACGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Sonda HEX: 5&#39;-ACAATCACT / ZEN / GAGCACTCTATACCAAAGCG / 3IABkFQ-3 </td></tr></tbody></table> Cuadro 1 Primers utilizados para la caracterización CSC por QRT-PCR. e_title &quot;&gt; 4. CSC Análisis de Superficie Celular marcadores CD117 y CD133 <ol><li> CSC cosecha mediante la recopilación de los medios de comunicación que contiene las células y centrifugar a 125 xg durante 5 min. Añadir 500 l de una solución desprendimiento de células no proteolítica para romper las células-up. Centrifugar las células a 125 xg durante 5 min para eliminar la solución desprendimiento de las células. A continuación, lavar las células dos veces con PBS frío. </li><li> Incubar en medio de cultivo normal durante 1 hora antes de células de etiquetado. Centrifugar las células durante 5 min a 129 x g. Resuspender las células en PBS con 0,1% de BSA con anti-CD133-PE y anti-CD117-FITC. </li><li> Fijar las células durante la noche en paraformaldehído al 1%. Precaución: El paraformaldehido es tóxico (carcinógeno). Hacer en campana de extracción y utilizar dentro de una semana. </li><li> Realizar citometría de flujo para analizar CD117 (con un anti-CD117 conjugado a FITC) y CD133 (anti-CD133 con conjugado a PE) expresión en la superficie celular en un citómetro de flujo. Recopilar datos sobre las células en el FL1 (FITC) y FL3 (PE) para los canales. Generar puertas para las células que expresan tantoFITC y PE. Generar un gráfico de puntos con 4 cuadrantes (FITC y PE, FITC + PE, PE FITC +, y + FITC y PE +) y determinar el número de células en cada cuadrante. </li></ol> 5. Analizando CSC para la respuesta terapéutica <ol><li> Placa de 5.000 células por pocillo (SKOV3, SKOV3-RFP, SKOV3 CSC y SKOV3-RFP CSC) en placas de 96 pocillos durante la noche. </li><li> Tratar con cisplatino (0, 1, 10, 100, y 1.000 M) o paclitaxel (0, 0,01, 0,1, 1, 10 y 100 mM) durante 96 h. </li><li> Realizar MTT (3 (4,5-dimetiltiazol-2-il) -2,5-difeniltetrazolio) ensayo de viabilidad celular. <ol><li> Placa de 5000 células por 100 l por pocillo en una placa de 96 pocillos (células de la placa por duplicado y los medios de comunicación incluyen sólo los pocillos de control). </li><li> Después de 24 horas, añadir 10 l de 10 mg / ml de MTT. Incubar a 37 ° C durante 2-4 h (hasta que se forma un precipitado). </li><li> Añadir 100 l de HCl mM MTT disolvente 4, 0,1% de NP-40 en isopropanol. Incubar durante 15 min en la oscuridad. </li><li> Leer las placas a 570 nm en un plato reader. </li></ol></li></ol>

<ol>
	<li>Pennington, K., Pulaski, H., Pennington, M., Liu, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Too+Much+of+a+Good+Thing:+Suicide+Prevention+Promotes+Chemoresistance+in+Ovarian+Carcinoma.">Too Much of a Good Thing: Suicide Prevention Promotes Chemoresistance in Ovarian Carcinoma.</a> Curr Cancer Drug Targets. 10, 575-583 (2010).</li><li>Thigpen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rational+approach+to+the+management+of+recurrent+or+persistent+ovarian+carcinoma.">A rational approach to the management of recurrent or persistent ovarian carcinoma.</a> Clin Obstet Gynecol. 55, 114-130 (2012).</li><li>Burgos-Ojeda, D., Rueda, B. R., Buckanovich, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem+cell+markers:+prognostic+and+therapeutic+implications.">Ovarian cancer stem cell markers: prognostic and therapeutic implications.</a> Cancer letters. 322, 1-7 (2012).</li><li>Ma, L., Lai, D., Liu, T., Cheng, W., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem-like+cells+can+be+isolated+with+drug+selection+in+human+ovarian+cancer+cell+line+SKOV3.">Cancer stem-like cells can be isolated with drug selection in human ovarian cancer cell line SKOV3.</a> Acta Biochim Biophys Sin (Shanghai). 42, 593-602 (2010).</li><li>Bonnet, D., Dick, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+acute+myeloid+leukemia+is+organized+as+a+hierarchy+that+originates+from+a+primitive+hematopoietic+cell.">Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell.</a> Nature Medicine. 3, 730-737 (1997).</li><li>Alison, M. R., Lim, S. M., Nicholson, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells:+problems+for+therapy.">Cancer stem cells: problems for therapy.</a> The Journal of pathology. 223, 147-161 (2011).</li><li>Luo, X., Dong, Z., Chen, Y., Yang, L., Lai, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+ovarian+cancer+stem-like+cells+is+associated+with+epithelial+to+mesenchymal+transition+through+an+miRNA-activated+AKT+pathway.">Enrichment of ovarian cancer stem-like cells is associated with epithelial to mesenchymal transition through an miRNA-activated AKT pathway.</a> Cell proliferation. 46, 436-446 (2013).</li><li>Wang, L., Mezencev, R., Bowen, N. J., Matyunina, L. V., McDonald, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+stem-like+cells+from+a+human+ovarian+cancer+cell+line.">Isolation and characterization of stem-like cells from a human ovarian cancer cell line.</a> Molecular and cellular biochemistry. 363, 257-268 (2012).</li><li>Abubaker, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-term+single+treatment+of+chemotherapy+results+in+the+enrichment+of+ovarian+cancer+stem+cell-like+cells+leading+to+an+increased+tumor+burden.">Short-term single treatment of chemotherapy results in the enrichment of ovarian cancer stem cell-like cells leading to an increased tumor burden.</a> Molecular cancer. 12, 24 (2013).</li><li>Conic, I., Dimov, I., Tasic-Dimov, D., Djordjevic, B., Stefanovic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+epithelial+cancer+stem+cells.">Ovarian epithelial cancer stem cells.</a> ScientificWorldJournal. 11, 1243-1269 (2011).</li><li>Liu, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem-like+cells+show+induced+translineage-differentiation+capacity+and+are+suppressed+by+alkaline+phosphatase+inhibitor.">Ovarian cancer stem-like cells show induced translineage-differentiation capacity and are suppressed by alkaline phosphatase inhibitor.</a> Oncotarget. 4 (12), 2366-2382 (2013).</li><li>Liu, T., Cheng, W., Lai, D., Huang, Y., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+ovarian+cancer+cells+in+different+culture+systems.">Characterization of primary ovarian cancer cells in different culture systems.</a> Oncology reports. 23, 1277-1284 (2010).</li></ol>

The authors declare they have no competing financial interest.

CSC que son resistentes a la terapia pueden ser responsables de la recaída después del tratamiento del tumor primario. Caracterización de las CSC puede conducir a mejores tratamientos para el cáncer de ovario. Los parámetros críticos en el establecimiento de las CSC quimiorresistentes utilizando el protocolo anterior son los plazos de la duración del tratamiento con quimioterapia y la concentración de la quimioterapia. Cuando se utiliza el protocolo de Ma et al. se encontró que después de 7 días de t...

Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4. 
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Name of Reagent/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">McCoy</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">16600-108</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">DMEM / F12 serum free</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td style="width:119px;">11320-033</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Minimal Essential Media</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td>42360032</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Sodium Pyruvate</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/11360070">11360070</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Polybrene</td>
			<td style="width:71px;">Millipore</td>
			<td>TR-1003-G</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Blasticidin</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/R21001">R21001</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Fetal Bovine Serum&#160;</td>
			<td style="width:71px;">Atlas Biologicals</td>
			<td style="width:119px;">F-0500-A</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Penicillin-streptomycin&#160;</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15070-063</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Cisplatin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">T7402-5MG</td>
			<td style="width:167px;">Caution: Toxic Use precautions</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">pLenti-suCMV-Rsv</td>
			<td style="width:71px;">Gentarget</td>
			<td style="width:119px;">LVP023</td>
			<td style="width:167px;">BSL2 approval needed</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Insulin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">I-1882</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Human Recombinant EGF&#160;</td>
			<td style="width:71px;">Cell Signaling Technology</td>
			<td style="width:119px;">8916LC</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">bFGF</td>
			<td style="width:71px;">BD biosciences</td>
			<td style="width:119px;">354060</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="20">
			<td height="41" rowspan="2" style="height:41px;width:216px;">LIF</td>
			<td rowspan="2" style="width:71px;">Santa Cruz</td>
			<td rowspan="2" style="width:119px;">sc-4988A</td>
			<td rowspan="2" style="width:167px;"></td>
		</tr>
		<tr height="21">
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Bovine Serum Albumin</td>
			<td style="width:71px;">Roche</td>
			<td style="width:119px;">03 116 956 001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">TRIzol</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15596-018</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">High Capacity cDNA Reverse Transcription Kit&#160;&#160;</td>
			<td style="width:71px;">Applied Biosystems</td>
			<td style="width:119px;">4368813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">IQ Multiplex Powermix</td>
			<td style="width:71px;">BioRad</td>
			<td style="width:119px;">1725849</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Accumax</td>
			<td style="width:71px;">Millipore</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Primers</td>
			<td style="width:71px;">Integrated DNA Technology</td>
			<td style="width:119px;">individually designed and ordered (see protocol for sequnces)</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Anti-CD133 PE</td>
			<td style="width:71px;">Milenyl</td>
			<td>130-098-826</td>
			<td style="width:167px;">Primer/probe sets are light sensitive</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">CD117-Biotin</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-570</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">AntiBiotin-FITC</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-796</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Paraformaldehyde</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td>P6148-1KG</td>
			<td style="width:167px;">Caution: Toxic always prepare in hood and make fresh.</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Trypsin</td>
			<td style="width:71px;">Life Technologies</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/25300062">25300062</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">MTT (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide)&#160;</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">25200-072</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">EVOS Fl Epifluorescence and Transmitted Light Microscope</td>
			<td>Advanced Microscopy Group</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Biorad CFX96 C1000 System</td>
			<td style="width:71px;">Biorad</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">Beckman Coulter FC500 Flow Cytometer&#160;</td>
			<td style="width:71px;">Beckman Coulter</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Spectramax 340PC384&#160;</td>
			<td style="width:71px;">Molecular Devices</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
	</tbody>
</table>

enrichment for chemoresistant ovarian cancer stem cells from human cell lines

Células madre del cáncer (CSC) se definen como un subconjunto de ciclismo lento y células indiferenciadas que dividen asimétricamente para generar altamente proliferativa, invasiva, y las células tumorales quimiorresistentes. Por lo tanto, los CAC son una población de células atractivo para apuntar terapéuticamente. CSC se predice para contribuir a un número de tipos de tumores malignos, incluyendo las de la sangre, cerebro, pulmón, tracto gastrointestinal, próstata y ovario. Aislar y enriquecer una población de células tumorales de células madre cancerosas permitirá a los investigadores estudiar las propiedades, la genética, y la respuesta terapéutica de células madre cancerosas. Hemos generado un protocolo que enriquece de forma reproducible para los CSC de cáncer de ovario a partir de líneas celulares de cáncer de ovario (SKOV3 y OVCA429). Las líneas celulares se tratan con 20 M de cisplatino durante 3 días. Las células supervivientes son aislados y cultivados en un medio de células madre libre de suero que contiene citoquinas y factores de crecimiento. Se demuestra un enriquecimiento de estas células madre cancerosas purificadas mediante el análisis de las células aisladas para known marcadores de células madre Oct4, Nanog, y PROM1 (CD133) y la superficie celular expresión de CD177 y CD133. La exposición CSC incrementó chemoresistance. Este método para el aislamiento de células madre cancerosas es una herramienta útil para estudiar el papel de las células madre cancerosas en la quimiorresistencia y recidiva tumoral.

Para demostrar que se aislaron células madre cancerosas a partir de líneas celulares de cáncer de ovario epitelial utilizando el tratamiento con cisplatino, primero adquirimos imágenes de las líneas de células antes del tratamiento y después de la selección. Se utilizó microscopía de luz para capturar imágenes de adherente (no tratada) SKOV3 y OVCA429 células y SKOV3 y OVCA429 CSC (Figura 1). CSC aparecen redonda y no unido a las placas de cultivo de tejido (Figuras 1 y <str...

Watch this Scientific Journal Video about Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines at JoVE.com

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Las células madre del cáncer (CSC) están implicados en la recidiva del tumor debido a la quimio-resistencia. Hemos optimizado un protocolo para la selección y expansión de células madre cancerosas de líneas celulares de cáncer de ovario. Mediante el tratamiento de las células con el cisplatino quimioterapia y cultivar en una célula madre promoción de los medios de comunicación que enriquecen las culturas CSC no adherentes.

El enriquecimiento de las células madre quimiorresistente cáncer ovárico de líneas celulares humanas

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, ...

enrichment-for-chemoresistant-ovarian-cancer-stem-cells-from-human

Research

JoVE Journal

Medicine

13.4K vistas.  Indiana University School of Medicine.  Las células madre del cáncer (CSC) están implicados en la recidiva del tumor debido a la quimio-resistencia. Hemos optimizado un protocolo para la selección y expansión de células madre cancerosas de líneas celulares de cáncer de ovario. Mediante el tratamiento de las células con el cisplatino quimioterapia y cultivar en una célula madre promoción de los medios de comunicación que enriquecen las culturas CSC no adherentes. 