Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.

1 셀 난소 암 세포주의 문화와 형광 표지 <ol><li> SKOV3 매체를 준비 : 10 % 소 태아 혈청 (FBS)으로 보충 된 맥코이 매체는 0.1mm의 L-글루타민, 50 U / ㎖ 페니실린, 50 μg / ml의 스트렙토 마이신. 10 % FBS, 1 mM 피루브산 나트륨, 0.1 mM의의 L-글루타민, 50 U / ㎖의 페니실린으로 보충 된 최소 필수 매체 (MEM)에 OVCA429 세포 및 50 μg / ml의 스트렙토 마이신을 유지한다. </li><li> 5 % CO 2와 37 ° C에서 가습 배양기에서 293 및 OVCA429 세포주를 전파. 40-50%의 포화 상태로 세포를 성장. </li><li> 시험 관내 및 생체 내에서 생존 능력을 모니터하기 위해 적색 형광 단백질 (RFP)를 발현하는 세포를 생성한다. <ol><li> , RFP를 발현하는 293 세포를 생성하는 72 시간 동안 페니실린과 스트렙토 마이신의 부재에서 293 미디어에 RFP 및 10 μg / ㎖의 폴리 브렌을 표현 렌티 바이러스 입자를 추가합니다. </li><li> 72 시간 후, RFP에 대한 형광 활성화 된 셀 Sorti에 의해 양성 세포를 선택NG (FACS)를 다음과 같이 RFP를 Trypsinize의 비 RFP 발현 세포, 5 분 동안 125 XG에 원심 분리기, 0.1 % BSA를 함유하는 PBS에 107 세포 / ml로 재현 탁 세포. 셀 소터에 정렬 파라미터를 결정하는 비 - RFP 셀을 사용한다. 그런 다음 561 nm의 레이저를 사용하여 높은 R​​FP를 발현하는 세포를 수집합니다. </li><li> 렌티 바이러스 플라스미드는 항생제 내성 카세트를 발현하는 경우 또는, 적절한 항생제에서 배양함으로써 RFP 발현 세포에 대해 선택 (예 : 10 ㎎ / ㎖ 블라스트). 참고 : 일괄 처리 및 세포 유형에 따라 다를 수 있습니다 사용될 필요가 렌티 바이러스 입자의 양. 적정 렌티 바이러스 역가 각 세포 유형에 대해 결정되어야한다. </li></ol></li></ol> 암 줄기 세포의 2 심화 <ol><li> 72 시간 동안 시스플라틴의 20 μM과 293, 293-RFP 또는 OVCA429 세포 라인을 취급합니다. 주의 : 시스플라틴 독성이다. 보호 복 / 장갑을 사용하여 피부와 점막과의 접촉을 피하십시오. 시스플라틴 내가 처리하지 마십시오n 개의 폐수. </li><li> CSC 매체를 준비 : 무 혈청 DMEM / F12 매체 5㎍을 / ㎖ 인슐린, 10 ng의 / ml의 인간 재조합 표피 성장 인자 (EGF), 10 ng의 / ㎖ 염기성 섬유 아세포 성장 인자 (bFGF), 12 ng의 / ㎖ 백혈병 억제 인자로 보충 및 0.4 % 소 혈청 알부민 (BSA). </li><li> 를 Trypsinize 세포. 문화 CSC 미디어에서 세포 생존. 참고 : 문화 비 부착 회전 타원체에서 이일이 형성됩니다 후. </li><li> 미디어 세포를 포함하고 5 분 동안 125 XG에서 원심 분리 수집하여 모든 이일 미디어를 변경합니다. 그리고 신선한 CSC 미디어에서 펠렛을 재현 탁. 세포를 계산 및 트리 판 블루 배제를 수행하여 모든 이일 생존을 위해 세포를 확인합니다. </li><li> (: 137 밀리미터의 NaCl, 2.7 mM의 KCl을, 11.9 mM의 인산염 완충액 pH 7.4의 PBS)와 그 다음 5 분 동안 129 XG를 원심 분리 및 페놀 함유 아니 디늄 thiocynate (RNA), 인산염 완충 생리 식염수에 펠렛을 재현 탁하여 추가 실험을위한 암줄 기세포를 수집 (유동 세포 계측법에 대한) 0.1 % BSA, 또는 CSC 매체는 계속세포를 배양. </li><li> 20 배와 40 배 배율 광학 현미경을 사용하여 CSC의 세포 형태를 모니터링합니다. </li></ol> 줄기 세포 마커에 대한 유전자 발현 분석을 통해 3 CSC의 특성 <ol><li> 매체는 5 분 동안 129 XG에서 원심 분리, 세포를 포함하는 수집, 및 페놀 함유 아니 디늄 thiocynate의 용액에 펠릿을 재현 탁하여 CSC 추가의 3 제제를 수집 (RNA 추출을위한 다른 방법이 사용될 수있다). </li><li> 제조 업체의 프로토콜에 따라 트리 졸 사용하여 총 RNA를 준비합니다. 시판 cDNA를 역전사 키트를 사용하여 RNA 0.1 μg으로부터의 상보 적 DNA (cDNA를)를 합성한다. </li><li> 정량 역전사 중합 효소 연쇄 반응 (QRT-PCR)을 수행한다. <ol><li> 샘플 당 8 μl를 총 QRT-PCR 믹스, 프라이머, 및 물을 포함하는 프라이머의 각 세트에 대한 마스터 믹스를 확인합니다 (다른 형광체와 프라이머는 같은 잘에서 증폭 할 수 있습니다.) 예를 들어, 생성인 Oct4-FAM, Nanog를 16 진수 및 GAPDH-CY5에 대한 하나의 마스터 믹스. 네 스틴 및 Prom1에 대해 별도의 마스터 믹스를 생성합니다. 샘플 당 cDNA를 템플릿의 2 μl를 추가합니다. NOTE : 본 연구를 위해 QRT-PCR은 표 1에 프라이머를 사용하여 수행 하였다. </li><li> 다중 형광을 검출 할 수있는 실시간 PCR 용 열 순환기를 사용하여 각 샘플에 대해 중복 모든 QRT-PCR을 수행한다. 어떤 템플릿 컨트롤을 포함하지 않습니다. </li><li> ΔΔC T 방법을 사용하여 각 샘플에 대해 GAPDH 발현에 줄기 세포의 유전자 발현을 정규화한다. </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0" width="746"><colgroup><col /><col /></colgroup><tbody><tr height="21"><td height="63" rowspan="3" style="height:62px;width:111px;"> 월 4-FAM </td><td style="width:636px;"> 프라이머 1 : 5&#39;-CCCAAGGAATAGTCTGTAGAAGTG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> 프라이머 2 : 5&#39;-TGCATGAGTCAGTGAACAGG-3 &#39;</td></tr><tr height="21"><td height="21" style="height:21px;"> FAM 프로브 : 5&#39;-CTTCCAAGC / ZEN / TG​​CCCACCTAACTTCT / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> NANOG-HEX </td><td> 프라이머 1 : 5&#39;-CCTTCTGCGTCACACCATT-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> 프라이머 2 : 5&#39;-AACTCTCCAACATCCTGAACC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> HEX 프로브 : 5&#39;-CTGCCACCT / ZEN.CTTAGATTTCATTCTCTGGT / 3IABkFQ-3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> GAPDH-CY5 </td><td> 프라이머 1 : 5&#39;-TGTAGTTGAGGTCAATGAAGGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> 프라이머 2 : 5&#39;-ACATCGCTCAGACACCATG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> CY5 프로브 : 5&#39;-AAGGTCGGAGTCAACGGATTTGGTC / 3IABRQSP-3 &#39; </td><html></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> 네 스틴-FAM </td><td> 프라이머 1 : 5&#39;-AGGACCTGAGCGATCTGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> 프라이머 2 : 5&#39;-CGTTGGAACAGAGGTTGGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> FAM 프로브 : 5&#39;-AACTTTTCA / ZEN / GTAGCCCGCAGCC / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> CD133-HEX </td><td> 프라이머 1 : 5&#39;-ACTCTCTCCAACAATCCATTCC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> 프라이머 2 : 5&#39;-AAACAATTCACCAGCAACGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> HEX 프로브 : 5&#39;-ACAATCACT / ZEN / GAGCACTCTATACCAAAGCG / 3IABkFQ-3 </td></tr></tbody></table> QRT-PCR에 의한 CSC 특성에 사용되는 표 1 프라이머. e_title &quot;&gt; 4. 세포 표면 마커 CD117 및 CD133에 대한 분석 암줄 기세포 <ol><li> 미디어 세포를 포함하고 5 분 동안 125 XG에서 원심 분리에 의해 수확 된 CSC 수집. 해체하는 세포를 비 단백질 분해 세포 분리 용액 500 μl를 추가합니다. 5 분 동안 125 XG에 원심 세포 세포 분리 용액을 제거한다. 그런 다음 차가운 PBS로 두 번 세포를 씻으십시오. </li><li> 종래 라벨링 셀 1 시간 동안 정상적인 성장 배지에서 배양한다. 129의 X g에서 5 분 동안 세포를 스핀 다운. 항-CD133-PE 및 항-CD117-FITC와 함께 0.1 % BSA와 함께 PBS에 세포를 재현 탁. </li><li> 1 % 파라 포름 알데히드 하룻밤 세포를 수정. 주의 : 파라 포름 알데히드는 독성 (발암 물질로 의심)입니다. 흄 후드에서 확인하고 주일 이내에 사용한다. </li><li> (PE에 접합 된 항-CD133)와 CD133 및 플로우 사이토 미터에 세포 표면 발현 (FITC에 접합 된 항-CD117)와 CD117를 분석하기 위해 유세포 분석기를 수행한다. 채널 (PE 용) (FITC에 대한) FL1과 FL3 세포에서 데이터를 수집 할 수 있습니다. 모두 발현하는 세포에 대한 게이트를 생성FITC와 PE. 4 사분면 (FITC- 및 PE-, FITC + PE-, FITC- PE + 및 FITC + 및 PE +)와 도트 플롯을 생성하고 각 사분면에 세포의 수를 결정합니다. </li></ol> (5) 치료 반응에 대한 암줄 기세포 분석 <ol><li> 플레이트 하룻밤 96 웰 플레이트에 5,000 셀 아니라 당 (293, 293-RFP, 293 CSC와 293-RFP 암줄 기세포). </li><li> 96 시간 동안 시스플라틴 (0, 1, 10, 100 및 1000 μM) 또는 파클리탁셀 (0, 0.01, 0.1, 1, 10 및 100 μM)로 처리. </li><li> MTT (3 - (4,5 - 디메틸 -2 - 일) -2,5 - 디 페닐 테트라 졸륨 브로마이드) 세포 생존 분석을 수행한다. <ol><li> 96 웰 플레이트에 잘 당 100 μL 당 플레이트 5000 세포 (중복에 판 세포와 미디어는 우물을 제어 포함). </li><li> 24 시간 후, 10 ㎎ / ㎖ MTT의 10 μl를 추가합니다. (침전물이 형성 될 때까지) 2-4 시간 동안 37 ° C에서 품어. </li><li> MTT 용매 4 mM의 염산 100 ㎕, 이소프로판올 0.1 % NP-40을 추가합니다. 어둠 속에서 15 분 동안 품어. </li><li> 접시의 연구에 570 nm에서 판을 읽고eader. </li></ol></li></ol>

<ol>
	<li>Pennington, K., Pulaski, H., Pennington, M., Liu, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Too+Much+of+a+Good+Thing:+Suicide+Prevention+Promotes+Chemoresistance+in+Ovarian+Carcinoma.">Too Much of a Good Thing: Suicide Prevention Promotes Chemoresistance in Ovarian Carcinoma.</a> Curr Cancer Drug Targets. 10, 575-583 (2010).</li><li>Thigpen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rational+approach+to+the+management+of+recurrent+or+persistent+ovarian+carcinoma.">A rational approach to the management of recurrent or persistent ovarian carcinoma.</a> Clin Obstet Gynecol. 55, 114-130 (2012).</li><li>Burgos-Ojeda, D., Rueda, B. R., Buckanovich, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem+cell+markers:+prognostic+and+therapeutic+implications.">Ovarian cancer stem cell markers: prognostic and therapeutic implications.</a> Cancer letters. 322, 1-7 (2012).</li><li>Ma, L., Lai, D., Liu, T., Cheng, W., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem-like+cells+can+be+isolated+with+drug+selection+in+human+ovarian+cancer+cell+line+SKOV3.">Cancer stem-like cells can be isolated with drug selection in human ovarian cancer cell line SKOV3.</a> Acta Biochim Biophys Sin (Shanghai). 42, 593-602 (2010).</li><li>Bonnet, D., Dick, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+acute+myeloid+leukemia+is+organized+as+a+hierarchy+that+originates+from+a+primitive+hematopoietic+cell.">Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell.</a> Nature Medicine. 3, 730-737 (1997).</li><li>Alison, M. R., Lim, S. M., Nicholson, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells:+problems+for+therapy.">Cancer stem cells: problems for therapy.</a> The Journal of pathology. 223, 147-161 (2011).</li><li>Luo, X., Dong, Z., Chen, Y., Yang, L., Lai, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+ovarian+cancer+stem-like+cells+is+associated+with+epithelial+to+mesenchymal+transition+through+an+miRNA-activated+AKT+pathway.">Enrichment of ovarian cancer stem-like cells is associated with epithelial to mesenchymal transition through an miRNA-activated AKT pathway.</a> Cell proliferation. 46, 436-446 (2013).</li><li>Wang, L., Mezencev, R., Bowen, N. J., Matyunina, L. V., McDonald, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+stem-like+cells+from+a+human+ovarian+cancer+cell+line.">Isolation and characterization of stem-like cells from a human ovarian cancer cell line.</a> Molecular and cellular biochemistry. 363, 257-268 (2012).</li><li>Abubaker, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-term+single+treatment+of+chemotherapy+results+in+the+enrichment+of+ovarian+cancer+stem+cell-like+cells+leading+to+an+increased+tumor+burden.">Short-term single treatment of chemotherapy results in the enrichment of ovarian cancer stem cell-like cells leading to an increased tumor burden.</a> Molecular cancer. 12, 24 (2013).</li><li>Conic, I., Dimov, I., Tasic-Dimov, D., Djordjevic, B., Stefanovic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+epithelial+cancer+stem+cells.">Ovarian epithelial cancer stem cells.</a> ScientificWorldJournal. 11, 1243-1269 (2011).</li><li>Liu, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem-like+cells+show+induced+translineage-differentiation+capacity+and+are+suppressed+by+alkaline+phosphatase+inhibitor.">Ovarian cancer stem-like cells show induced translineage-differentiation capacity and are suppressed by alkaline phosphatase inhibitor.</a> Oncotarget. 4 (12), 2366-2382 (2013).</li><li>Liu, T., Cheng, W., Lai, D., Huang, Y., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+ovarian+cancer+cells+in+different+culture+systems.">Characterization of primary ovarian cancer cells in different culture systems.</a> Oncology reports. 23, 1277-1284 (2010).</li></ol>

The authors declare they have no competing financial interest.

치료에 저항하는 암줄 기세포 차 종양의 치료 후 재발에 대한 책임을 질 수 있습니다. 암줄 기세포의 특성은 난소 암에 대한 개선 된 치료법으로 이어질 수 있습니다. 상기 프로토콜을 사용 chemoresistant 된 CSC의 확립에 중요한 파라미터는 화학 요법 치료의 길이 및 화학 요법 농도 타이밍된다. 엄마 외의 프로토콜을 사용하는 경우. 그것은 시스플라틴과 파클리탁셀 치료의 칠일 후에 더 가능?...

Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4. 
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Name of Reagent/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">McCoy</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">16600-108</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">DMEM / F12 serum free</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td style="width:119px;">11320-033</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Minimal Essential Media</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td>42360032</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Sodium Pyruvate</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/11360070">11360070</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Polybrene</td>
			<td style="width:71px;">Millipore</td>
			<td>TR-1003-G</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Blasticidin</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/R21001">R21001</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Fetal Bovine Serum&#160;</td>
			<td style="width:71px;">Atlas Biologicals</td>
			<td style="width:119px;">F-0500-A</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Penicillin-streptomycin&#160;</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15070-063</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Cisplatin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">T7402-5MG</td>
			<td style="width:167px;">Caution: Toxic Use precautions</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">pLenti-suCMV-Rsv</td>
			<td style="width:71px;">Gentarget</td>
			<td style="width:119px;">LVP023</td>
			<td style="width:167px;">BSL2 approval needed</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Insulin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">I-1882</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Human Recombinant EGF&#160;</td>
			<td style="width:71px;">Cell Signaling Technology</td>
			<td style="width:119px;">8916LC</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">bFGF</td>
			<td style="width:71px;">BD biosciences</td>
			<td style="width:119px;">354060</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="20">
			<td height="41" rowspan="2" style="height:41px;width:216px;">LIF</td>
			<td rowspan="2" style="width:71px;">Santa Cruz</td>
			<td rowspan="2" style="width:119px;">sc-4988A</td>
			<td rowspan="2" style="width:167px;"></td>
		</tr>
		<tr height="21">
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Bovine Serum Albumin</td>
			<td style="width:71px;">Roche</td>
			<td style="width:119px;">03 116 956 001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">TRIzol</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15596-018</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">High Capacity cDNA Reverse Transcription Kit&#160;&#160;</td>
			<td style="width:71px;">Applied Biosystems</td>
			<td style="width:119px;">4368813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">IQ Multiplex Powermix</td>
			<td style="width:71px;">BioRad</td>
			<td style="width:119px;">1725849</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Accumax</td>
			<td style="width:71px;">Millipore</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Primers</td>
			<td style="width:71px;">Integrated DNA Technology</td>
			<td style="width:119px;">individually designed and ordered (see protocol for sequnces)</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Anti-CD133 PE</td>
			<td style="width:71px;">Milenyl</td>
			<td>130-098-826</td>
			<td style="width:167px;">Primer/probe sets are light sensitive</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">CD117-Biotin</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-570</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">AntiBiotin-FITC</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-796</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Paraformaldehyde</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td>P6148-1KG</td>
			<td style="width:167px;">Caution: Toxic always prepare in hood and make fresh.</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Trypsin</td>
			<td style="width:71px;">Life Technologies</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/25300062">25300062</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">MTT (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide)&#160;</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">25200-072</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">EVOS Fl Epifluorescence and Transmitted Light Microscope</td>
			<td>Advanced Microscopy Group</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Biorad CFX96 C1000 System</td>
			<td style="width:71px;">Biorad</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">Beckman Coulter FC500 Flow Cytometer&#160;</td>
			<td style="width:71px;">Beckman Coulter</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Spectramax 340PC384&#160;</td>
			<td style="width:71px;">Molecular Devices</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
	</tbody>
</table>

enrichment for chemoresistant ovarian cancer stem cells from human cell lines

암 줄기 세포 (CSC 추가)는 느린 사이클 및 높은 증식 침습적 생성하는 비대칭 분할 미분화 세포 및 chemoresistant 종양 세포의 서브 세트로서 정의된다. 따라서 암줄 기세포는 치료 대상으로 세포의 매력적인 인구입니다. CSC 추가는 혈액, 뇌, 폐, 위장관, 전립선, 난소 및 사람들을 포함한 종양의 종류의 수에 기여할 것으로 예측된​​다. 격리하고 암줄 기세포에 대한 종양 세포의 인구는 암줄 기세포의 특성, 유전학 및 치료 반응을 연구하는 연구원을 가능하게 할 것이다 풍부. 우리는 재현성 난소 암 세포주 (SKOV3 및 OVCA429)에서 난소 암 된 CSC위한 풍요롭게 프로토콜을 생성. 셀 라인은 삼일에 20 μM 시스플라틴으로 처리됩니다. 살아남은 세포는 사이토 카인 및 성장 인자를 포함하는 무 혈청 줄기 세포 배지에서 배양하고 절연한다. 우리는 K 용 절연 세포를 분석하여 이들의 정제 된 CSC의 농축을 보여nown 세포 마커 인 Oct4, Nanog를하고 Prom1 (CD133) 및 CD177 및 CD133의 세포 표면 발현을 줄기. 암줄 기세포 전시 chemoresistance 증가했다. 암줄 기세포의 분리를위한이 방법은 chemoresistance 종양 재발에 암줄 기세포의 역할을 연구하는데 유용한 도구입니다.

우리는 시스플라틴 치료를 이용한 난소 암 세포주에서 고립 된 CSC를 입증하기 위해, 우리는 먼저 사전 처리 및 선택 후 세포 라인의 이미지를 획득. 우리는 부착 (치료) 293 및 OVCA429 세포와 293 및 OVCA429 암줄 기세포 (그림 1)의 이미지를 캡처하기 위해 광학 현미경을 사용했다. CSC 추가는 조직 배양 접시에 부착하지 둥근 표시 (도 1 및도 2). 우리는 더 RFP 형질 293 세포는 세포 ...

Watch this Scientific Journal Video about Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines at JoVE.com

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

암 줄기 세포 (암줄 기세포는) 때문에 chemoresistance에 종양 재발에 관여하고 있습니다. 우리는 선택 및 난소 암 세포주에서의 확장 된 CSC 프로토콜을 최적화했다. 화학 요법 시스플라틴 세포를 치료하고 우리는 비 부착 CSC 문화에 대한 풍부 미디어를 홍보 줄기 세포에서 배양.

인간 세포주에서 Chemoresistant 난소 암 줄기 세포에 대한 심화 학습

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, ...

enrichment-for-chemoresistant-ovarian-cancer-stem-cells-from-human

Research

JoVE Journal

Medicine

13.4K 조회수.  Indiana University School of Medicine.  암 줄기 세포 (암줄 기세포는) 때문에 chemoresistance에 종양 재발에 관여하고 있습니다. 우리는 선택 및 난소 암 세포주에서의 확장 된 CSC 프로토콜을 최적화했다. 화학 요법 시스플라틴 세포를 치료하고 우리는 비 부착 CSC 문화에 대한 풍부 미디어를 홍보 줄기 세포에서 배양. 