Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.

1 셀 난소 암 세포주의 문화와 형광 표지 <ol><li> SKOV3 매체를 준비 : 10 % 소 태아 혈청 (FBS)으로 보충 된 맥코이 매체는 0.1mm의 L-글루타민, 50 U / ㎖ 페니실린, 50 μg / ml의 스트렙토 마이신. 10 % FBS, 1 mM 피루브산 나트륨, 0.1 mM의의 L-글루타민, 50 U / ㎖의 페니실린으로 보충 된 최소 필수 매체 (MEM)에 OVCA429 세포 및 50 μg / ml의 스트렙토 마이신을 유지한다. </li><li> 5 % CO 2와 37 ° C에서 가습 배양기에서 293 및 OVCA429 세포주를 전파. 40-50%의 포화 상태로 세포를 성장. </li><li> 시험 관내 및 생체 내에서 생존 능력을 모니터하기 위해 적색 형광 단백질 (RFP)를 발현하는 세포를 생성한다. <ol><li> , RFP를 발현하는 293 세포를 생성하는 72 시간 동안 페니실린과 스트렙토 마이신의 부재에서 293 미디어에 RFP 및 10 μg / ㎖의 폴리 브렌을 표현 렌티 바이러스 입자를 추가합니다. </li><li> 72 시간 후, RFP에 대한 형광 활성화 된 셀 Sorti에 의해 양성 세포를 선택NG (FACS)를 다음과 같이 RFP를 Trypsinize의 비 RFP 발현 세포, 5 분 동안 125 XG에 원심 분리기, 0.1 % BSA를 함유하는 PBS에 107 세포 / ml로 재현 탁 세포. 셀 소터에 정렬 파라미터를 결정하는 비 - RFP 셀을 사용한다. 그런 다음 561 nm의 레이저를 사용하여 높은 R​​FP를 발현하는 세포를 수집합니다. </li><li> 렌티 바이러스 플라스미드는 항생제 내성 카세트를 발현하는 경우 또는, 적절한 항생제에서 배양함으로써 RFP 발현 세포에 대해 선택 (예 : 10 ㎎ / ㎖ 블라스트). 참고 : 일괄 처리 및 세포 유형에 따라 다를 수 있습니다 사용될 필요가 렌티 바이러스 입자의 양. 적정 렌티 바이러스 역가 각 세포 유형에 대해 결정되어야한다. </li></ol></li></ol> 암 줄기 세포의 2 심화 <ol><li> 72 시간 동안 시스플라틴의 20 μM과 293, 293-RFP 또는 OVCA429 세포 라인을 취급합니다. 주의 : 시스플라틴 독성이다. 보호 복 / 장갑을 사용하여 피부와 점막과의 접촉을 피하십시오. 시스플라틴 내가 처리하지 마십시오n 개의 폐수. </li><li> CSC 매체를 준비 : 무 혈청 DMEM / F12 매체 5㎍을 / ㎖ 인슐린, 10 ng의 / ml의 인간 재조합 표피 성장 인자 (EGF), 10 ng의 / ㎖ 염기성 섬유 아세포 성장 인자 (bFGF), 12 ng의 / ㎖ 백혈병 억제 인자로 보충 및 0.4 % 소 혈청 알부민 (BSA). </li><li> 를 Trypsinize 세포. 문화 CSC 미디어에서 세포 생존. 참고 : 문화 비 부착 회전 타원체에서 이일이 형성됩니다 후. </li><li> 미디어 세포를 포함하고 5 분 동안 125 XG에서 원심 분리 수집하여 모든 이일 미디어를 변경합니다. 그리고 신선한 CSC 미디어에서 펠렛을 재현 탁. 세포를 계산 및 트리 판 블루 배제를 수행하여 모든 이일 생존을 위해 세포를 확인합니다. </li><li> (: 137 밀리미터의 NaCl, 2.7 mM의 KCl을, 11.9 mM의 인산염 완충액 pH 7.4의 PBS)와 그 다음 5 분 동안 129 XG를 원심 분리 및 페놀 함유 아니 디늄 thiocynate (RNA), 인산염 완충 생리 식염수에 펠렛을 재현 탁하여 추가 실험을위한 암줄 기세포를 수집 (유동 세포 계측법에 대한) 0.1 % BSA, 또는 CSC 매체는 계속세포를 배양. </li><li> 20 배와 40 배 배율 광학 현미경을 사용하여 CSC의 세포 형태를 모니터링합니다. </li></ol> 줄기 세포 마커에 대한 유전자 발현 분석을 통해 3 CSC의 특성 <ol><li> 매체는 5 분 동안 129 XG에서 원심 분리, 세포를 포함하는 수집, 및 페놀 함유 아니 디늄 thiocynate의 용액에 펠릿을 재현 탁하여 CSC 추가의 3 제제를 수집 (RNA 추출을위한 다른 방법이 사용될 수있다). </li><li> 제조 업체의 프로토콜에 따라 트리 졸 사용하여 총 RNA를 준비합니다. 시판 cDNA를 역전사 키트를 사용하여 RNA 0.1 μg으로부터의 상보 적 DNA (cDNA를)를 합성한다. </li><li> 정량 역전사 중합 효소 연쇄 반응 (QRT-PCR)을 수행한다. <ol><li> 샘플 당 8 μl를 총 QRT-PCR 믹스, 프라이머, 및 물을 포함하는 프라이머의 각 세트에 대한 마스터 믹스를 확인합니다 (다른 형광체와 프라이머는 같은 잘에서 증폭 할 수 있습니다.) 예를 들어, 생성인 Oct4-FAM, Nanog를 16 진수 및 GAPDH-CY5에 대한 하나의 마스터 믹스. 네 스틴 및 Prom1에 대해 별도의 마스터 믹스를 생성합니다. 샘플 당 cDNA를 템플릿의 2 μl를 추가합니다. NOTE : 본 연구를 위해 QRT-PCR은 표 1에 프라이머를 사용하여 수행 하였다. </li><li> 다중 형광을 검출 할 수있는 실시간 PCR 용 열 순환기를 사용하여 각 샘플에 대해 중복 모든 QRT-PCR을 수행한다. 어떤 템플릿 컨트롤을 포함하지 않습니다. </li><li> ΔΔC T 방법을 사용하여 각 샘플에 대해 GAPDH 발현에 줄기 세포의 유전자 발현을 정규화한다. </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0" width="746"><colgroup><col /><col /></colgroup><tbody><tr height="21"><td height="63" rowspan="3" style="height:62px;width:111px;"> 월 4-FAM </td><td style="width:636px;"> 프라이머 1 : 5&#39;-CCCAAGGAATAGTCTGTAGAAGTG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> 프라이머 2 : 5&#39;-TGCATGAGTCAGTGAACAGG-3 &#39;</td></tr><tr height="21"><td height="21" style="height:21px;"> FAM 프로브 : 5&#39;-CTTCCAAGC / ZEN / TG​​CCCACCTAACTTCT / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> NANOG-HEX </td><td> 프라이머 1 : 5&#39;-CCTTCTGCGTCACACCATT-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> 프라이머 2 : 5&#39;-AACTCTCCAACATCCTGAACC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> HEX 프로브 : 5&#39;-CTGCCACCT / ZEN.CTTAGATTTCATTCTCTGGT / 3IABkFQ-3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> GAPDH-CY5 </td><td> 프라이머 1 : 5&#39;-TGTAGTTGAGGTCAATGAAGGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> 프라이머 2 : 5&#39;-ACATCGCTCAGACACCATG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> CY5 프로브 : 5&#39;-AAGGTCGGAGTCAACGGATTTGGTC / 3IABRQSP-3 &#39; </td><html></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> 네 스틴-FAM </td><td> 프라이머 1 : 5&#39;-AGGACCTGAGCGATCTGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> 프라이머 2 : 5&#39;-CGTTGGAACAGAGGTTGGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> FAM 프로브 : 5&#39;-AACTTTTCA / ZEN / GTAGCCCGCAGCC / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> CD133-HEX </td><td> 프라이머 1 : 5&#39;-ACTCTCTCCAACAATCCATTCC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> 프라이머 2 : 5&#39;-AAACAATTCACCAGCAACGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> HEX 프로브 : 5&#39;-ACAATCACT / ZEN / GAGCACTCTATACCAAAGCG / 3IABkFQ-3 </td></tr></tbody></table> QRT-PCR에 의한 CSC 특성에 사용되는 표 1 프라이머. e_title &quot;&gt; 4. 세포 표면 마커 CD117 및 CD133에 대한 분석 암줄 기세포 <ol><li> 미디어 세포를 포함하고 5 분 동안 125 XG에서 원심 분리에 의해 수확 된 CSC 수집. 해체하는 세포를 비 단백질 분해 세포 분리 용액 500 μl를 추가합니다. 5 분 동안 125 XG에 원심 세포 세포 분리 용액을 제거한다. 그런 다음 차가운 PBS로 두 번 세포를 씻으십시오. </li><li> 종래 라벨링 셀 1 시간 동안 정상적인 성장 배지에서 배양한다. 129의 X g에서 5 분 동안 세포를 스핀 다운. 항-CD133-PE 및 항-CD117-FITC와 함께 0.1 % BSA와 함께 PBS에 세포를 재현 탁. </li><li> 1 % 파라 포름 알데히드 하룻밤 세포를 수정. 주의 : 파라 포름 알데히드는 독성 (발암 물질로 의심)입니다. 흄 후드에서 확인하고 주일 이내에 사용한다. </li><li> (PE에 접합 된 항-CD133)와 CD133 및 플로우 사이토 미터에 세포 표면 발현 (FITC에 접합 된 항-CD117)와 CD117를 분석하기 위해 유세포 분석기를 수행한다. 채널 (PE 용) (FITC에 대한) FL1과 FL3 세포에서 데이터를 수집 할 수 있습니다. 모두 발현하는 세포에 대한 게이트를 생성FITC와 PE. 4 사분면 (FITC- 및 PE-, FITC + PE-, FITC- PE + 및 FITC + 및 PE +)와 도트 플롯을 생성하고 각 사분면에 세포의 수를 결정합니다. </li></ol> (5) 치료 반응에 대한 암줄 기세포 분석 <ol><li> 플레이트 하룻밤 96 웰 플레이트에 5,000 셀 아니라 당 (293, 293-RFP, 293 CSC와 293-RFP 암줄 기세포). </li><li> 96 시간 동안 시스플라틴 (0, 1, 10, 100 및 1000 μM) 또는 파클리탁셀 (0, 0.01, 0.1, 1, 10 및 100 μM)로 처리. </li><li> MTT (3 - (4,5 - 디메틸 -2 - 일) -2,5 - 디 페닐 테트라 졸륨 브로마이드) 세포 생존 분석을 수행한다. <ol><li> 96 웰 플레이트에 잘 당 100 μL 당 플레이트 5000 세포 (중복에 판 세포와 미디어는 우물을 제어 포함). </li><li> 24 시간 후, 10 ㎎ / ㎖ MTT의 10 μl를 추가합니다. (침전물이 형성 될 때까지) 2-4 시간 동안 37 ° C에서 품어. </li><li> MTT 용매 4 mM의 염산 100 ㎕, 이소프로판올 0.1 % NP-40을 추가합니다. 어둠 속에서 15 분 동안 품어. </li><li> 접시의 연구에 570 nm에서 판을 읽고eader. </li></ol></li></ol>

<ol>
	<li>Pennington, K., Pulaski, H., Pennington, M., Liu, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Too+Much+of+a+Good+Thing:+Suicide+Prevention+Promotes+Chemoresistance+in+Ovarian+Carcinoma.">Too Much of a Good Thing: Suicide Prevention Promotes Chemoresistance in Ovarian Carcinoma.</a> Curr Cancer Drug Targets. 10, 575-583 (2010).</li><li>Thigpen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rational+approach+to+the+management+of+recurrent+or+persistent+ovarian+carcinoma.">A rational approach to the management of recurrent or persistent ovarian carcinoma.</a> Clin Obstet Gynecol. 55, 114-130 (2012).</li><li>Burgos-Ojeda, D., Rueda, B. R., Buckanovich, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem+cell+markers:+prognostic+and+therapeutic+implications.">Ovarian cancer stem cell markers: prognostic and therapeutic implications.</a> Cancer letters. 322, 1-7 (2012).</li><li>Ma, L., Lai, D., Liu, T., Cheng, W., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem-like+cells+can+be+isolated+with+drug+selection+in+human+ovarian+cancer+cell+line+SKOV3.">Cancer stem-like cells can be isolated with drug selection in human ovarian cancer cell line SKOV3.</a> Acta Biochim Biophys Sin (Shanghai). 42, 593-602 (2010).</li><li>Bonnet, D., Dick, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+acute+myeloid+leukemia+is+organized+as+a+hierarchy+that+originates+from+a+primitive+hematopoietic+cell.">Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell.</a> Nature Medicine. 3, 730-737 (1997).</li><li>Alison, M. R., Lim, S. M., Nicholson, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells:+problems+for+therapy.">Cancer stem cells: problems for therapy.</a> The Journal of pathology. 223, 147-161 (2011).</li><li>Luo, X., Dong, Z., Chen, Y., Yang, L., Lai, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+ovarian+cancer+stem-like+cells+is+associated+with+epithelial+to+mesenchymal+transition+through+an+miRNA-activated+AKT+pathway.">Enrichment of ovarian cancer stem-like cells is associated with epithelial to mesenchymal transition through an miRNA-activated AKT pathway.</a> Cell proliferation. 46, 436-446 (2013).</li><li>Wang, L., Mezencev, R., Bowen, N. J., Matyunina, L. V., McDonald, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+stem-like+cells+from+a+human+ovarian+cancer+cell+line.">Isolation and characterization of stem-like cells from a human ovarian cancer cell line.</a> Molecular and cellular biochemistry. 363, 257-268 (2012).</li><li>Abubaker, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-term+single+treatment+of+chemotherapy+results+in+the+enrichment+of+ovarian+cancer+stem+cell-like+cells+leading+to+an+increased+tumor+burden.">Short-term single treatment of chemotherapy results in the enrichment of ovarian cancer stem cell-like cells leading to an increased tumor burden.</a> Molecular cancer. 12, 24 (2013).</li><li>Conic, I., Dimov, I., Tasic-Dimov, D., Djordjevic, B., Stefanovic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+epithelial+cancer+stem+cells.">Ovarian epithelial cancer stem cells.</a> ScientificWorldJournal. 11, 1243-1269 (2011).</li><li>Liu, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem-like+cells+show+induced+translineage-differentiation+capacity+and+are+suppressed+by+alkaline+phosphatase+inhibitor.">Ovarian cancer stem-like cells show induced translineage-differentiation capacity and are suppressed by alkaline phosphatase inhibitor.</a> Oncotarget. 4 (12), 2366-2382 (2013).</li><li>Liu, T., Cheng, W., Lai, D., Huang, Y., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+ovarian+cancer+cells+in+different+culture+systems.">Characterization of primary ovarian cancer cells in different culture systems.</a> Oncology reports. 23, 1277-1284 (2010).</li></ol>

The authors declare they have no competing financial interest.

치료에 저항하는 암줄 기세포 차 종양의 치료 후 재발에 대한 책임을 질 수 있습니다. 암줄 기세포의 특성은 난소 암에 대한 개선 된 치료법으로 이어질 수 있습니다. 상기 프로토콜을 사용 chemoresistant 된 CSC의 확립에 중요한 파라미터는 화학 요법 치료의 길이 및 화학 요법 농도 타이밍된다. 엄마 외의 프로토콜을 사용하는 경우. 그것은 시스플라틴과 파클리탁셀 치료의 칠일 후에 더 가능?...

Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4. 
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.

<table><tbody><tr><td>McCoy</td><td>Life Technologies</td><td>16600-108</td><td>Warm to 37 &amp;#176;C prior to use</td></tr><tr><td>DMEM / F12 serum free</td><td>Life Technologies&amp;nbsp;</td><td>11320-033</td><td>Warm to 37 &amp;#176;C prior to use</td></tr><tr><td>Minimal Essential Media</td><td>Life Technologies&amp;nbsp;</td><td>42360032</td><td>Warm to 37 &amp;#176;C prior to use</td></tr><tr><td>Sodium pyruvate</td><td>Life Technologies&amp;nbsp;</td><td>&lt;a href=&quot;http://www.lifetechnologies.com/order/catalog/product/11360070&quot;&gt;11360070&lt;/a&gt;</td><td></td></tr><tr><td>Polybrene</td><td>Millipore</td><td>TR-1003-G</td><td></td></tr><tr><td>Blasticidin</td><td>Life Technologies&amp;nbsp;</td><td>&lt;a href=&quot;http://www.lifetechnologies.com/order/catalog/product/R21001&quot;&gt;R21001&lt;/a&gt;</td><td></td></tr><tr><td>Fetal Bovine Serum&amp;nbsp;</td><td>Atlas Biologicals</td><td>F-0500-A</td><td></td></tr><tr><td>Penicillin-streptomycin&amp;nbsp;</td><td>Life Technologies</td><td>15070-063</td><td></td></tr><tr><td>Cisplatin</td><td>Sigma-Aldrich</td><td>T7402-5MG</td><td>Caution: Toxic. Use precautions</td></tr><tr><td>pLenti-suCMV-Rsv</td><td>Gentarget</td><td>LVP023</td><td>BSL2 approval needed</td></tr><tr><td>Insulin</td><td>Sigma-Aldrich</td><td>I-1882</td><td></td></tr><tr><td>Human Recombinant EGF&amp;nbsp;</td><td>Cell Signaling Technology</td><td>8916LC</td><td></td></tr><tr><td>bFGF</td><td>BD biosciences</td><td>354060</td><td></td></tr><tr><td>LIF</td><td>Santa Cruz</td><td>sc-4988A</td><td></td></tr><tr><td>Bovine Serum Albumin</td><td>Roche</td><td>03 116 956 001</td><td></td></tr><tr><td>TRIzol</td><td>Life Technologies</td><td>15596-018</td><td></td></tr><tr><td>High Capacity cDNA Reverse Transcription Kit&amp;nbsp;&amp;nbsp;</td><td>Applied Biosystems</td><td>4368813</td><td></td></tr><tr><td>IQ Multiplex Powermix</td><td>BioRad</td><td>1725849</td><td></td></tr><tr><td>Accumax</td><td>Millipore</td><td></td><td></td></tr><tr><td>Primers</td><td>Integrated DNA Technology</td><td>individually designed and ordered (see protocol for sequnces)</td><td></td></tr><tr><td>Anti-CD133 PE</td><td>Milenyl</td><td>130-098-826</td><td>Primer/probe sets are light sensitive</td></tr><tr><td>CD117-Biotin</td><td>Miltenly</td><td>130-098-570</td><td></td></tr><tr><td>AntiBiotin-FITC</td><td>Miltenly</td><td>130-098-796</td><td></td></tr><tr><td>Paraformaldehyde</td><td>Sigma-Aldrich</td><td>P6148-1KG</td><td>Caution: Toxic. Always prepare in hood and make fresh.</td></tr><tr><td>Trypsin</td><td>Life Technologies</td><td>&lt;a href=&quot;http://www.lifetechnologies.com/order/catalog/product/25300062&quot;&gt;25300062&lt;/a&gt;</td><td></td></tr><tr><td>MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide)&amp;nbsp;</td><td>Sigma-Aldrich</td><td>25200-072</td><td></td></tr><tr><td>EVOS Fl Epifluorescence and Transmitted Light Microscope</td><td>Advanced Microscopy Group</td><td></td><td></td></tr><tr><td>Biorad CFX96 C1000 System</td><td>Biorad</td><td></td><td></td></tr><tr><td>Beckman Coulter FC500 Flow Cytometer&amp;nbsp;</td><td>Beckman Coulter</td><td></td><td></td></tr><tr><td>Spectramax 340PC384&amp;nbsp;</td><td>Molecular Devices</td><td></td><td></td></tr></tbody></table>

enrichment for chemoresistant ovarian cancer stem cells from human cell lines

암 줄기 세포 (CSC 추가)는 느린 사이클 및 높은 증식 침습적 생성하는 비대칭 분할 미분화 세포 및 chemoresistant 종양 세포의 서브 세트로서 정의된다. 따라서 암줄 기세포는 치료 대상으로 세포의 매력적인 인구입니다. CSC 추가는 혈액, 뇌, 폐, 위장관, 전립선, 난소 및 사람들을 포함한 종양의 종류의 수에 기여할 것으로 예측된​​다. 격리하고 암줄 기세포에 대한 종양 세포의 인구는 암줄 기세포의 특성, 유전학 및 치료 반응을 연구하는 연구원을 가능하게 할 것이다 풍부. 우리는 재현성 난소 암 세포주 (SKOV3 및 OVCA429)에서 난소 암 된 CSC위한 풍요롭게 프로토콜을 생성. 셀 라인은 삼일에 20 μM 시스플라틴으로 처리됩니다. 살아남은 세포는 사이토 카인 및 성장 인자를 포함하는 무 혈청 줄기 세포 배지에서 배양하고 절연한다. 우리는 K 용 절연 세포를 분석하여 이들의 정제 된 CSC의 농축을 보여nown 세포 마커 인 Oct4, Nanog를하고 Prom1 (CD133) 및 CD177 및 CD133의 세포 표면 발현을 줄기. 암줄 기세포 전시 chemoresistance 증가했다. 암줄 기세포의 분리를위한이 방법은 chemoresistance 종양 재발에 암줄 기세포의 역할을 연구하는데 유용한 도구입니다.

우리는 시스플라틴 치료를 이용한 난소 암 세포주에서 고립 된 CSC를 입증하기 위해, 우리는 먼저 사전 처리 및 선택 후 세포 라인의 이미지를 획득. 우리는 부착 (치료) 293 및 OVCA429 세포와 293 및 OVCA429 암줄 기세포 (그림 1)의 이미지를 캡처하기 위해 광학 현미경을 사용했다. CSC 추가는 조직 배양 접시에 부착하지 둥근 표시 (도 1 및도 2). 우리는 더 RFP 형질 293 세포는 세포 ...

Watch this Scientific Journal Video about Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines at JoVE.com

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

암 줄기 세포 (암줄 기세포는) 때문에 chemoresistance에 종양 재발에 관여하고 있습니다. 우리는 선택 및 난소 암 세포주에서의 확장 된 CSC 프로토콜을 최적화했다. 화학 요법 시스플라틴 세포를 치료하고 우리는 비 부착 CSC 문화에 대한 풍부 미디어를 홍보 줄기 세포에서 배양.

인간 세포주에서 Chemoresistant 난소 암 줄기 세포에 대한 심화 학습

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, ...

enrichment-for-chemoresistant-ovarian-cancer-stem-cells-from-human

Research

JoVE Journal

Medicine

13.4K 조회수.  Indiana University School of Medicine.  암 줄기 세포 (암줄 기세포는) 때문에 chemoresistance에 종양 재발에 관여하고 있습니다. 우리는 선택 및 난소 암 세포주에서의 확장 된 CSC 프로토콜을 최적화했다. 화학 요법 시스플라틴 세포를 치료하고 우리는 비 부착 CSC 문화에 대한 풍부 미디어를 홍보 줄기 세포에서 배양. 

비디오: Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma

The current improvements in therapy against osteosarcoma (OS) have prolonged the lives of cancer patients, but the survival rate of five years remains poor when metastasis has occurred. The Cancer Stem Cell (CSC) theory holds that there is a subset of tumor cells within the tumor that have stem-like characteristics, including the capacity to maintain the tumor and to resist multidrug chemotherapy. Therefore, a better understanding of OS biology and pathogenesis is needed in order to advance the development of targeted therapies to eradicate this particular subset and to reduce morbidity and mortality among patients. Isolating CSCs, establishing cell cultures of CSCs, and studying their biology are important steps to improving our understanding of OS biology and pathogenesis. The establishment of human-derived OS-CSCs from biopsies of OS has been made possible using several methods, including the capacity to create 3-dimensional stem cell cultures under nonadherent conditions. Under these conditions, CSCs are able to create spherical floating colonies formed by daughter stem cells; these colonies are termed &#34;cellular spheres&#34;. Here, we describe a method to establish CSC cultures from primary cell cultures of conventional OS obtained from OS biopsies. We clearly describe the several passages required to isolate and characterize CSCs.

The presence of cancer stem cells (CSCs) in bone sarcomas has recently been linked to their pathogenesis. In this article, we present the isolation of CSCs from primary cell cultures obtained from human biopsies of conventional osteosarcoma (OS) using the ability of CSCs to grow under nonadherent conditions.

암의 설립은 인간 기존의 골육종에서 세포 배양 줄기

The current improvements in therapy against osteosarcoma (OS) have prolonged the lives of cancer patients, but the survival rate of five years remains ...

연구

암 연구학

Physiologic Patient Derived 3D Spheroids for Anti-neoplastic Drug Screening to Target Cancer Stem Cells

In this protocol, we outline the procedure for generation of tumor spheroids within 384-well hanging droplets to allow for high-throughput screening of anti-cancer therapeutics in a physiologically representative microenvironment. We outline the formation of patient derived cancer stem cell spheroids, as well as, the manipulation of these spheroids for thorough analysis following drug treatment. Specifically, we describe collection of spheroid morphology, proliferation, viability, drug toxicity, cell phenotype and cell localization data. This protocol focuses heavily on analysis techniques that are easily implemented using the 384-well hanging drop platform, making it ideal for high throughput drug screening. While we emphasize the importance of this model in ovarian cancer studies and cancer stem cell research, the 384-well platform is amenable to research of other cancer types and disease models, extending the utility of the platform to many fields. By improving the speed of personalized drug screening and the quality of screening results through easily implemented physiologically representative 3D cultures, this platform is predicted to aid in the development of new therapeutics and patient-specific treatment strategies, and thus have wide-reaching clinical impact.

This protocol describes generation of patient-derived spheroids, and downstream analysis including quantification of proliferation, cytotoxicity testing, flow cytometry, immunofluorescence staining and confocal imaging, in order to assess drug candidates&#8217; potential as anti-neoplastic therapeutics. This protocol supports precision medicine with identification of specific drugs for each patient and stage of disease.

암 줄기 세포를 표적으로 하는 반대로 신 생물 성 약 검열을 위한 생리학 환자 파생된 3D Spheroids

In this protocol, we outline the procedure for generation of tumor spheroids within 384-well hanging droplets to allow for high-throughput screening of ...

Obtaining Cancer Stem Cell Spheres from Gynecological and Breast Cancer Tumors

Cancer stem cells (CSC) are a small population with self-renewal and plasticity which are responsible for tumorigenesis, resistance to treatment and recurrent disease. This population can be identified by surface markers, enzymatic activity and a functional profile. These approaches per se are limited, due to phenotypic heterogeneity and CSC plasticity. Here, we update the sphere-forming protocol to obtain CSC spheres from breast and gynecological cancers, assessing functional properties, CSC markers and protein expression. The spheres are obtained with single-cell seeding at low density in suspension culture, using a semi-solid methylcellulose medium to avoid migration and aggregates. This profitable protocol can be used in cancer cell lines but also in primary tumors. The tridimensional non-adherent suspension culture thought to mimic the tumor microenvironment, particularly the CSC-niche, is supplemented with epidermal growth factor and basic fibroblast growth factor to ensure CSC signaling. Aiming for robust identification of CSC, we propose a complementary approach, combining functional and phenotypic evaluation. Sphere-forming capacity, self-renewal and sphere projection area establish CSC functional properties. Additionally, characterization comprises flow cytometry evaluation of the markers, represented by CD44+/CD24- and CD133, and Western blot, considering ALDH. The presented protocol was also optimized for primary tumor samples, following a sample digestion procedure, useful for translational research.

The aim of this methodology is to identify cancer stem cells (CSC) in cancer cell lines and primary human tumor samples with the sphere-forming protocol, in a robust manner, using functional assays and phenotypic characterization with flow cytometry and Western blot.

부인과 및 유방암 종양에서 암 줄기 세포 구체 획득

Cancer stem cells (CSC) are a small population with self-renewal and plasticity which are responsible for tumorigenesis, resistance to treatment and ...

An Orthotopic Mouse Model of Ovarian Cancer using Human Stroma to Promote Metastasis

Ovarian cancer is characterized by early, diffuse metastasis with 70% of women having metastatic disease at the time of diagnosis. While elegant transgenic mouse models of ovarian cancer exist, these mice are expensive and take a long time to develop tumors. Intraperitoneal injection xenograft models lack human stroma and do not accurately model ovarian cancer metastasis. Even patient derived xenografts (PDX) do not fully recapitulate the human stromal microenvironment as serial PDX passages demonstrate significant loss of human stroma. The ability to easily model human ovarian cancer within a physiologically relevant stromal microenvironment is an unmet need. Here, the protocol presents an orthotopic ovarian cancer mouse model using human ovarian cancer cells combined with patient-derived carcinoma-associated mesenchymal stem cells (CA-MSCs). CA-MSCs are stromal progenitor cells, which drive the formation of the stromal microenvironment and support ovarian cancer growth and metastasis. This model develops early and diffuses metastasis mimicking clinical presentation. In this model, luciferase expressing ovarian cancer cells are mixed in a 1:1 ratio with CA-MSCs and injected into the ovarian bursa of NSG mice. Tumor growth and metastasis are followed serially over time using bioluminescence imaging. The resulting tumors grow aggressively and form abdominal metastases by 14 days post injection. Mice experienced significant decreases in body weight as a marker of systemic illness and increased disease burden. By day 30 post injection, mice met endpoint criteria of &gt;10% body weight loss and necropsy confirmed intra-abdominal metastasis in 100% of mice and 60%-80% lung and parenchymal liver metastasis. Collectively, orthotopic engraftment of ovarian cancer cells and stroma cells generates tumors that closely mimic the early and diffuse metastatic behavior of human ovarian cancer. Furthermore, this model provides a tool to study the role of ovarian cancer cell: stroma cell interactions in metastatic progression.

<meta charset="utf8"></head><body>전이를 촉진하기 위해 인간 기질을 사용하는 난소암의 정소성 마우스 모델

Orthotopic engraftment of ovarian cancer cells mixed with human stromal cells provides a mouse model that exhibits rapid, diffuse metastatic behavior that is characteristic of human ovarian cancer. This model also allows for the study of tumor cell and stromal cell interactions, as well as their role in tumor progression and metastasis.

전이를 촉진하기 위해 인간 기질을 사용하는 난소암의 정소성 마우스 모델

Ovarian cancer is characterized by early, diffuse metastasis with 70% of women having metastatic disease at the time of diagnosis. While elegant ...

Method for Obtaining Primary Ovarian Cancer Cells From Solid Specimens

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a valuable tool for understanding ovarian cancer, their use has many limitations. These include the lack of heterogeneity and the plethora of genetic alterations associated with extended in vitro passaging.&#160;Here we describe a method that allows for rapid establishment of primary ovarian cancer cells form solid clinical specimens collected at the time of surgery. The method consists of subjecting clinical specimens to enzymatic digestion for 30 min. The isolated cell suspension is allowed to grow and can be used for downstream application including drug screening. The advantage of primary ovarian cancer cell lines over established ovarian cancer cell lines is that they are representative of the original specific clinical specimens they are derived from and can be derived from different sites whether primary or metastatic ovarian cancer.

This study describes a detailed method for isolation and characterization of primary ovarian cancer cells from solid clinical specimens. Ovarian cancer clinical specimens are subjected to enzymatic digestion to obtain viable, fibroblast-free epithelial ovarian cancer (EOC) cells highly suitable for downstream applications.

고체 시편에서 기본 난소 암 세포를 얻는 방법

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a ...

의학

Murine Model for Non-invasive Imaging to Detect and Monitor Ovarian Cancer Recurrence

Epithelial ovarian cancer is the most lethal gynecologic malignancy in the United States. Although patients initially respond to the current standard of care consisting of surgical debulking and combination chemotherapy consisting of platinum and taxane compounds, almost 90% of patients recur within a few years. In these patients the development of chemoresistant disease limits the efficacy of currently available chemotherapy agents and therefore contributes to the high mortality. To discover novel therapy options that can target recurrent disease, appropriate animal models that closely mimic the clinical profile of patients with recurrent ovarian cancer are required. The challenge in monitoring intra-peritoneal (i.p.) disease limits the use of i.p. models and thus most xenografts are established subcutaneously. We have developed a sensitive optical imaging platform that allows the detection and anatomical location of i.p. tumor mass. The platform includes the use of optical reporters that extend from the visible light range to near infrared, which in combination with 2-dimensional X-ray co-registration can provide anatomical location of molecular signals. Detection is significantly improved by the use of a rotation system that drives the animal to multiple angular positions for 360 degree imaging, allowing the identification of tumors that are not visible in single orientation. This platform provides a unique model to non-invasively monitor tumor growth and evaluate the efficacy of new therapies for the prevention or treatment of recurrent ovarian cancer.

We describe a non-invasive animal imaging platform that allows the detection, quantification, and monitoring of ovarian cancer growth and recurrence. This intra-peritoneal xenograft model mimics the clinical profile of patients with ovarian cancer.

비 침습적 영상에 대한 생쥐 모델 검색 및 모니터 난소 암 재발

Epithelial ovarian cancer is the most lethal gynecologic malignancy in the United States. Although patients initially respond to the current standard of ...

난소암 오가노이드 바이오뱅킹 표준화

Strategy for Biobanking of Ovarian Cancer Organoids: Addressing the Interpatient Heterogeneity across Histological Subtypes and Disease Stages

While the establishment of an ovarian cancer biobank from patient-derived organoids along with their clinical background information promises advances in research and patient care, standardization remains a challenge due to the heterogeneity of this lethal malignancy, combined with the inherent complexity of organoid technology. This adaptable protocol provides a systematic framework to realize the full potential of ovarian cancer organoids considering a patient-specific variability of progenitors. By implementing a structured experimental workflow to select optimal culture conditions and seeding methods, with parallel testing of direct 3D seeding versus a 2D/3D route, we obtain, in most cases, robust long-term expanding lines suitable for a broad range of downstream applications. 
Notably, the protocol has been tested and proven efficient in a great number of cases (N = 120) of highly heterogeneous starting material, including high-grade and low-grade ovarian cancer and stages of the disease with primary debulking, recurrent disease, and post-neoadjuvant surgical specimens. Within a low Wnt, high BMP exogenous signaling environment, we observed progenitors being differently susceptible to the activation of the Heregulin 1 &#223; (HER&#223;-1)-pathway, with HER&#223;-1 promoting organoid formation in some while inhibiting it in others. For a subset of the patient's samples, optimal organoid formation and long-term growth necessitate the addition of fibroblast growth factor 10 and R-Spondin 1 to the medium. 
Further, we highlight the critical steps of tissue digestion and progenitor isolation and point to examples where brief cultivation in 2D on plastic is beneficial for subsequent organoid formation in the Basement Membrane Extract type 2 matrix. Overall, optimal biobanking requires systematic testing of all main conditions in parallel to identify an adequate growth environment for individual lines. The protocol also describes the handling procedure for efficient embedding, sectioning, and staining to obtain high-resolution images of organoids, which is required for comprehensive phenotyping.

저자 스포트라이트: 난소암의 맞춤형 의학 발전 

This protocol offers a systematic framework for the establishment of ovarian cancer organoids from different disease stages and addresses the challenges of patient-specific variability to increase yield and enable robust long-term expansion for subsequent applications. It includes detailed steps for tissue processing, seeding, adjusting media requirements, and immunofluorescence staining.

난소암 오가노이드의 바이오뱅킹 전략: 조직학적 아형 및 질병 단계에 걸친 환자 간 이질성 해결

While the establishment of an ovarian cancer biobank from patient-derived organoids along with their clinical background information promises advances in ...

인간 세포주에서 Chemoresistant 난소 암 줄기 세포에 대한 심화 학습

요약

더 많은 비디오 탐색

이 비디오의 챕터

암의 설립은 인간 기존의 골육종에서 세포 배양 줄기

암 줄기 세포를 표적으로 하는 반대로 신 생물 성 약 검열을 위한 생리학 환자 파생된 3D Spheroids

부인과 및 유방암 종양에서 암 줄기 세포 구체 획득

전이를 촉진하기 위해 인간 기질을 사용하는 난소암의 정소성 마우스 모델

전이를 촉진하기 위해 인간 기질을 사용하는 난소암의 정소성 마우스 모델

고체 시편에서 기본 난소 암 세포를 얻는 방법

비 침습적 영상에 대한 생쥐 모델 검색 및 모니터 난소 암 재발

난소암 오가노이드의 바이오뱅킹 전략: 조직학적 아형 및 질병 단계에 걸친 환자 간 이질성 해결

난소암 오가노이드의 바이오뱅킹 전략: 조직학적 아형 및 질병 단계에 걸친 환자 간 이질성 해결

난소암 오가노이드의 바이오뱅킹 전략: 조직학적 아형 및 질병 단계에 걸친 환자 간 이질성 해결