Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.

1. Cell Culture and Fluorescent Labeling of Ovarian Cancer Cell Lines
<ol>
	<li>Prepare SKOV3 media: McCoy media supplemented with 10% fetal bovine serum (FBS), 0.1 mM L-glutamine, 50 U/ml penicillin, and 50 &#956;g/ml streptomycin. Maintain OVCA429 cells in minimal essential media (MEM) supplemented with 10% FBS, 1 mM sodium pyruvate, 0.1 mM L-glutamine, 50 U/ml penicillin, and 50 &#956;g/ml streptomycin.</li>
	<li>Propagate SKOV3 and OVCA429 cell lines in a humidified incubator at 37 &#176;C with 5% CO2. Grow cells to 40-50% confluency.</li>
	<li>Generate cells expressing red fluorescent protein (RFP) in order to monitor viability in vitro and in vivo.
	<ol>
		<li>To generate SKOV3 cells expressing RFP, add lentiviral particles expressing RFP and 10 &#956;g/ml polybrene to SKOV3 media in the absence of penicillin and streptomycin for 72 hr.</li>
		<li>After 72 hr, select for RFP positive cells by Fluorescence Activated Cell Sorting (FACS) as follows: Trypsinize RFP and non-RFP expressing cells, centrifuge at 125 x g for 5 min, resuspend cells at 107 cells/ml in PBS containing 0.1% BSA. On a cell sorter, use non-RFP cells to determine the sorting parameters. Then collect cells that express high RFP using a 561 nm laser.</li>
		<li>Alternatively, if the lentiviral plasmid expresses an antibiotic resistance cassette, select for RFP expressing cells by culturing in the appropriate antibiotic (such as 10 mg/ml blasticidin). NOTE: The amount of lentiviral particles that needs to be used can vary by batch and by cell type. Proper lentiviral titer should be determined for each cell type.</li>
	</ol>
	</li>
</ol>
2. Enrichment of&#160;Cancer Stem Cells
<ol>
	<li>Treat SKOV3, SKOV3-RFP, or OVCA429 cell lines with 20 &#956;M of cisplatin for 72 hr. CAUTION: Cisplatin is toxic. Use protective clothing/gloves and avoid contact with skin and mucus membranes. Do not dispose of cisplatin in wastewater.</li>
	<li>Prepare CSC media: serum free DMEM/F12 media supplemented with 5 &#956;g/ml insulin, 10 ng/ml human recombinant epidermal growth factor (EGF), 10 ng/ml basic fibroblast growth factor (bFGF), 12 ng/ml leukemia inhibitory factor, and 0.4% bovine serum albumin (BSA).</li>
	<li>Trypsinize cells. Culture surviving cells in CSC media. 
	NOTE: After 2 days in culture non-adherent spheroids will form.</li>
	<li>Change media every 2 days by collecting media containing cells and centrifuging at 125 x g for 5 min. Then resuspend the pellet in fresh CSC media. Check cells for viability every 2 days by counting cells and performing trypan blue exclusion.</li>
	<li>Then collect CSCs for further experiments by centrifuging 129 x g for 5 min and resuspending the pellet in phenol containing guanidinium thiocynate (RNA), phosphate buffered saline (PBS: 137 mM NaCl, 2.7 mM KCl, and 11.9 mM phosphate buffer, pH 7.4) with 0.1% BSA (for flow cytometry), or CSC media to continue culturing the cells.</li>
	<li>Monitor CSC cell morphology using a light microscope at 20X and 40X magnifications.</li>
</ol>
3. CSC Characterization via Gene Expression Analysis for Stem Cell Markers
<ol>
	<li>Collect 3 preparations of CSCs by collecting media containing cells, centrifuging at 129 x g for 5 min, and resuspending the pellet in a solution of phenol containing guanidinium thiocynate (other methods for RNA extraction may be used).</li>
	<li>Prepare total RNA using TRIzol according to the manufacturer&#8217;s protocol. Synthesize complementary DNA (cDNA) from 0.1-1 &#181;g of RNA using a commercially available cDNA Reverse Transcription kit.</li>
	<li>Perform quantitative reverse transcribed polymerase chain reaction (QRT-PCR).
	<ol>
		<li>Make up master mix for each set of primers containing QRT-PCR mix, primers, and water to total 8 &#181;l per sample (primers with different fluorophores can be amplified in the same well). For example, generate one master mix for Oct4-FAM, Nanog-Hex, and GAPDH-CY5. Generate separate master mixes for Nestin and Prom1. Add 2 &#181;l of cDNA template per sample. 
		NOTE: For this study, QRT-PCR was performed using the primers listed in Table 1.</li>
		<li>Perform all QRT-PCR in duplicate for each sample using a real time PCR thermocycler capable of detecting multiple fluorophores. Include no template controls.</li>
		<li>Normalize stem cell gene expression to GAPDH expression for each sample using the &#916;&#916;CT method.</li>
	</ol>
	</li>
</ol>
<table border="0" cellpadding="0" cellspacing="0" width="746">
	<colgroup>
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="63" rowspan="3" style="height:62px;width:111px;">Oct-4-FAM</td>
			<td style="width:636px;">Primer 1: 5&#8242;-CCCAAGGAATAGTCTGTAGAAGTG-3&#8242;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer 2: 5&#8242;-TGCATGAGTCAGTGAACAGG-3&#8242;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FAM probe: 5&#8242;-CTTCCAAGC/ZEN/TGCCCACCTAACTTCT/3IABkFQ -3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="63" rowspan="3" style="height:62px;">Nanog-HEX</td>
			<td>Primer 1: 5&#8242;-CCTTCTGCGTCACACCATT-3&#8242;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer 2: 5&#8242;-AACTCTCCAACATCCTGAACC-3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HEX probe: 5&#8242;-CTGCCACCT/ZEN.CTTAGATTTCATTCTCTGGT/3IABkFQ-3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="63" rowspan="3" style="height:62px;">GAPDH-CY5</td>
			<td>Primer 1: 5&#8242;-TGTAGTTGAGGTCAATGAAGGG-3&#8242;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer 2: 5&#8242;-ACATCGCTCAGACACCATG-3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CY5 probe: 5&#8242;-AAGGTCGGAGTCAACGGATTTGGTC/3IABRQSP-3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="63" rowspan="3" style="height:62px;">NESTIN-FAM&#160;</td>
			<td>Primer 1: 5&#8242;-AGGACCTGAGCGATCTGG-3&#8242;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer 2: 5&#8242;-CGTTGGAACAGAGGTTGGAG-3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FAM probe: 5&#8242;-AACTTTTCA/ZEN/GTAGCCCGCAGCC/3IABkFQ -3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="63" rowspan="3" style="height:62px;">CD133-HEX</td>
			<td>Primer 1: 5&#8242;-ACTCTCTCCAACAATCCATTCC-3&#8242;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer 2: 5&#8242;-AAACAATTCACCAGCAACGAG-3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HEX probe: 5&#8242;-ACAATCACT/ZEN/GAGCACTCTATACCAAAGCG/3IABkFQ-3&#160;</td>
		</tr>
	</tbody>
</table>
Table 1.&#160;Primers used for CSC characterization by QRT-PCR.
4. Analyzing CSCs for Cell Surface Markers CD117 and CD133
<ol>
	<li>Harvest CSCs by collecting media containing cells and centrifuging at 125 x g for 5 min. Add 500 &#181;l of a non-proteolytic cell detachment solution to break-up cells. Centrifuge cells at 125 x g for 5 min to remove cell detachment solution. Then wash cells twice with cold PBS.</li>
	<li>Incubate in normal growth media for 1 hr prior to labeling cells. Spin down cells for 5 min at 129 x g. Resuspend cells in PBS with 0.1% BSA with anti-CD133-PE and anti-CD117-FITC.</li>
	<li>Fix cells overnight in 1% paraformaldehyde. Caution: Paraformaldehyde is toxic (suspected carcinogen). Make in fume hood and use within a week.</li>
	<li>Perform flow cytometry to analyze CD117 (with an anti-CD117 conjugated to FITC) and CD133 (with anti-CD133 conjugated to PE) cell surface expression on a flow cytometer. Collect data on cells in the FL1 (for FITC) and FL3 (for PE) channels. Generate gates for cells expressing both FITC and PE. Generate a dot plot with 4 quadrants (FITC- and PE-, FITC+ PE-, FITC- PE+, and FITC+ and PE+) and determine the number of cells in each quadrant.</li>
</ol>
5. Analyzing CSCs for Therapeutic Response
<ol>
	<li>Plate 5,000 cells per well (SKOV3, SKOV3-RFP, SKOV3 CSC and SKOV3-RFP CSCs) on 96-well plates overnight.</li>
	<li>Treat with cisplatin (0, 1, 10, 100, and 1,000 &#181;M) or paclitaxel (0, 0.01, 0.1, 1, 10, and 100 &#181;M) for 96 hr.</li>
	<li>Perform MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) cell viability assay.
	<ol>
		<li>Plate 5,000 cells per 100 &#181;l per well on a 96-well plate (plate cells in duplicate and include media only control wells).</li>
		<li>After 24 hr, add 10 &#181;l of 10 mg/ml MTT. Incubate at 37 &#176;C for 2-4 hr (until precipitate forms).</li>
		<li>Add 100 &#181;l of MTT solvent 4 mM HCl, 0.1% NP-40 in isopropanol. Incubate for 15 min in dark.</li>
		<li>Read plates at 570 nm on a plate reader.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Pennington, K., Pulaski, H., Pennington, M., Liu, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Too+Much+of+a+Good+Thing:+Suicide+Prevention+Promotes+Chemoresistance+in+Ovarian+Carcinoma.">Too Much of a Good Thing: Suicide Prevention Promotes Chemoresistance in Ovarian Carcinoma.</a> Curr Cancer Drug Targets. 10, 575-583 (2010).</li><li>Thigpen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rational+approach+to+the+management+of+recurrent+or+persistent+ovarian+carcinoma.">A rational approach to the management of recurrent or persistent ovarian carcinoma.</a> Clin Obstet Gynecol. 55, 114-130 (2012).</li><li>Burgos-Ojeda, D., Rueda, B. R., Buckanovich, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem+cell+markers:+prognostic+and+therapeutic+implications.">Ovarian cancer stem cell markers: prognostic and therapeutic implications.</a> Cancer letters. 322, 1-7 (2012).</li><li>Ma, L., Lai, D., Liu, T., Cheng, W., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem-like+cells+can+be+isolated+with+drug+selection+in+human+ovarian+cancer+cell+line+SKOV3.">Cancer stem-like cells can be isolated with drug selection in human ovarian cancer cell line SKOV3.</a> Acta Biochim Biophys Sin (Shanghai). 42, 593-602 (2010).</li><li>Bonnet, D., Dick, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+acute+myeloid+leukemia+is+organized+as+a+hierarchy+that+originates+from+a+primitive+hematopoietic+cell.">Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell.</a> Nature Medicine. 3, 730-737 (1997).</li><li>Alison, M. R., Lim, S. M., Nicholson, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells:+problems+for+therapy.">Cancer stem cells: problems for therapy.</a> The Journal of pathology. 223, 147-161 (2011).</li><li>Luo, X., Dong, Z., Chen, Y., Yang, L., Lai, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+ovarian+cancer+stem-like+cells+is+associated+with+epithelial+to+mesenchymal+transition+through+an+miRNA-activated+AKT+pathway.">Enrichment of ovarian cancer stem-like cells is associated with epithelial to mesenchymal transition through an miRNA-activated AKT pathway.</a> Cell proliferation. 46, 436-446 (2013).</li><li>Wang, L., Mezencev, R., Bowen, N. J., Matyunina, L. V., McDonald, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+stem-like+cells+from+a+human+ovarian+cancer+cell+line.">Isolation and characterization of stem-like cells from a human ovarian cancer cell line.</a> Molecular and cellular biochemistry. 363, 257-268 (2012).</li><li>Abubaker, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-term+single+treatment+of+chemotherapy+results+in+the+enrichment+of+ovarian+cancer+stem+cell-like+cells+leading+to+an+increased+tumor+burden.">Short-term single treatment of chemotherapy results in the enrichment of ovarian cancer stem cell-like cells leading to an increased tumor burden.</a> Molecular cancer. 12, 24 (2013).</li><li>Conic, I., Dimov, I., Tasic-Dimov, D., Djordjevic, B., Stefanovic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+epithelial+cancer+stem+cells.">Ovarian epithelial cancer stem cells.</a> ScientificWorldJournal. 11, 1243-1269 (2011).</li><li>Liu, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem-like+cells+show+induced+translineage-differentiation+capacity+and+are+suppressed+by+alkaline+phosphatase+inhibitor.">Ovarian cancer stem-like cells show induced translineage-differentiation capacity and are suppressed by alkaline phosphatase inhibitor.</a> Oncotarget. 4 (12), 2366-2382 (2013).</li><li>Liu, T., Cheng, W., Lai, D., Huang, Y., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+ovarian+cancer+cells+in+different+culture+systems.">Characterization of primary ovarian cancer cells in different culture systems.</a> Oncology reports. 23, 1277-1284 (2010).</li></ol>

The authors declare they have no competing financial interest.

CSCs that are resistant to therapy may be accountable for relapse after treatment of primary tumor. Characterization of CSCs may lead to improved therapies for ovarian cancer. The critical parameters in the establishment of chemoresistant CSCs using the above protocol are timing the length of treatment with chemotherapy and the concentration of chemotherapy. When using the protocol in Ma et al. it was found that after 7 days of treatment with cisplatin and paclitaxel, no viable cells remained4. By red...

Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4. 
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Name of Reagent/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">McCoy</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">16600-108</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">DMEM / F12 serum free</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td style="width:119px;">11320-033</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Minimal Essential Media</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td>42360032</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Sodium Pyruvate</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/11360070">11360070</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Polybrene</td>
			<td style="width:71px;">Millipore</td>
			<td>TR-1003-G</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Blasticidin</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/R21001">R21001</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Fetal Bovine Serum&#160;</td>
			<td style="width:71px;">Atlas Biologicals</td>
			<td style="width:119px;">F-0500-A</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Penicillin-streptomycin&#160;</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15070-063</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Cisplatin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">T7402-5MG</td>
			<td style="width:167px;">Caution: Toxic Use precautions</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">pLenti-suCMV-Rsv</td>
			<td style="width:71px;">Gentarget</td>
			<td style="width:119px;">LVP023</td>
			<td style="width:167px;">BSL2 approval needed</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Insulin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">I-1882</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Human Recombinant EGF&#160;</td>
			<td style="width:71px;">Cell Signaling Technology</td>
			<td style="width:119px;">8916LC</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">bFGF</td>
			<td style="width:71px;">BD biosciences</td>
			<td style="width:119px;">354060</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="20">
			<td height="41" rowspan="2" style="height:41px;width:216px;">LIF</td>
			<td rowspan="2" style="width:71px;">Santa Cruz</td>
			<td rowspan="2" style="width:119px;">sc-4988A</td>
			<td rowspan="2" style="width:167px;"></td>
		</tr>
		<tr height="21">
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Bovine Serum Albumin</td>
			<td style="width:71px;">Roche</td>
			<td style="width:119px;">03 116 956 001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">TRIzol</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15596-018</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">High Capacity cDNA Reverse Transcription Kit&#160;&#160;</td>
			<td style="width:71px;">Applied Biosystems</td>
			<td style="width:119px;">4368813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">IQ Multiplex Powermix</td>
			<td style="width:71px;">BioRad</td>
			<td style="width:119px;">1725849</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Accumax</td>
			<td style="width:71px;">Millipore</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Primers</td>
			<td style="width:71px;">Integrated DNA Technology</td>
			<td style="width:119px;">individually designed and ordered (see protocol for sequnces)</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Anti-CD133 PE</td>
			<td style="width:71px;">Milenyl</td>
			<td>130-098-826</td>
			<td style="width:167px;">Primer/probe sets are light sensitive</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">CD117-Biotin</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-570</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">AntiBiotin-FITC</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-796</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Paraformaldehyde</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td>P6148-1KG</td>
			<td style="width:167px;">Caution: Toxic always prepare in hood and make fresh.</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Trypsin</td>
			<td style="width:71px;">Life Technologies</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/25300062">25300062</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">MTT (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide)&#160;</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">25200-072</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">EVOS Fl Epifluorescence and Transmitted Light Microscope</td>
			<td>Advanced Microscopy Group</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Biorad CFX96 C1000 System</td>
			<td style="width:71px;">Biorad</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">Beckman Coulter FC500 Flow Cytometer&#160;</td>
			<td style="width:71px;">Beckman Coulter</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Spectramax 340PC384&#160;</td>
			<td style="width:71px;">Molecular Devices</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
	</tbody>
</table>

enrichment for chemoresistant ovarian cancer stem cells from human cell lines

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, invasive, and chemoresistant tumor cells. Therefore, CSCs are an attractive population of cells to target therapeutically. CSCs are predicted to contribute to a number of types of malignancies including those in the blood, brain, lung, gastrointestinal tract, prostate, and ovary. Isolating and enriching a tumor cell population for CSCs will enable researchers to study the properties, genetics, and therapeutic response of CSCs. We generated a protocol that reproducibly enriches for ovarian cancer CSCs from ovarian cancer cell lines (SKOV3 and OVCA429). Cell lines are treated with 20 &#181;M cisplatin for 3 days. Surviving cells are isolated and cultured in a serum-free stem cell media containing cytokines and growth factors. We demonstrate an enrichment of these purified CSCs by analyzing the isolated cells for known stem cell markers Oct4, Nanog, and Prom1 (CD133) and cell surface expression of CD177 and CD133. The CSCs exhibit increased chemoresistance. This method for isolation of CSCs is a useful tool for studying the role of CSCs in chemoresistance and tumor relapse.

To demonstrate that we isolated CSCs from epithelial ovarian cancer cell lines using cisplatin treatment, we first acquired images of the cell lines prior to treatment and after selection. We used light microscopy to capture images of adherent (untreated) SKOV3 and OVCA429 cells and SKOV3 and OVCA429 CSCs (Figure 1). CSCs appear round and not attached to the tissue culture plates (Figures 1 and 2). We further show that SKOV3 cells transduced with RFP retain their fluores...

Watch this Scientific Journal Video about Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines at JoVE.com

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Cancer stem cells (CSCs) are&#160;implicated in tumor relapse due to chemoresistance. We have optimized a protocol for selection and expansion of CSCs from ovarian cancer cell lines. By treating cells with the chemotherapeutic cisplatin and culturing&#160;in a stem cell promoting media we enrich for non-adherent CSC cultures.

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, ...

enrichment-for-chemoresistant-ovarian-cancer-stem-cells-from-human

Research

JoVE Journal

Medicine

13.4K Views.  Indiana University School of Medicine. Cancer stem cells (CSCs) are implicated in tumor relapse due to chemoresistance. We have optimized a protocol for selection and expansion of CSCs from ovarian cancer cell lines. By treating cells with the chemotherapeutic cisplatin and culturing in a stem cell promoting media we enrich for non-adherent CSC cultures.

Video: Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Processing of Primary Brain Tumor Tissue for Stem Cell Assays and Flow Sorting

Brain tumors are typically comprised of morphologically diverse cells that express a variety of neural lineage markers. Only a relatively small fraction of cells in the tumor with stem cell properties, termed brain tumor initiating cells (BTICs), possess an ability to differentiate along multiple lineages, self-renew, and initiate tumors in vivo. We applied culture conditions originally used for normal neural stem cells (NSCs) to a variety of human brain tumors and found that this culture method specifically selects for stem-like populations. Serum-free medium (NSC) allows for the maintenance of an undifferentiated stem cell state, and the addition of bFGF and EGF allows for the proliferation of multi-potent, self-renewing, and expandable tumorspheres.
To further characterize each tumor's BTIC population, we evaluate cell surface markers by flow cytometry. We may also sort populations of interest for more specific characterization. Self-renewal assays are performed on single BTICs sorted into 96 well plates; the formation of tumorspheres following incubation at 37 &deg;C indicates the presence of a stem or progenitor cell. Multiple cell numbers of a particular population can also be sorted in different wells for limiting dilution analysis, to analyze self-renewal capacity. We can also study differential gene expression within a particular cell population by using single cell RT-PCR.
The following protocols describe our procedures for the dissociation and culturing of primary human samples to enrich for BTIC populations, as well as the dissociation of tumorspheres. Also included are protocols for staining for flow cytometry analysis or sorting, self-renewal assays, and single cell RT-PCR.

The identification of brain tumor initiating cells (BTICs), the rare cells within a heterogeneous tumor possessing stem cell properties, provides new insights into human brain tumor pathogenesis. We have refined specific culture conditions to enrich for BTICs, and we routinely use flow cytometry to further enrich these populations. Self-renewal assays and transcript analysis by single cell RT-PCR can subsequently be performed on these isolated cells.

Brain tumors are typically comprised of morphologically diverse cells that express a variety of neural lineage markers. Only a relatively small fraction ...

Isolation of Cardiomyocyte Nuclei from Post-mortem Tissue

Identification of cardiomyocyte nuclei has been challenging in tissue sections as most strategies rely only on cytoplasmic marker proteins1. Rare events in cardiac myocytes such as proliferation and apoptosis require an accurate identification of cardiac myocyte nuclei to analyze cellular renewal in homeostasis and in pathological conditions2. Here, we provide a method to isolate cardiomyocyte nuclei from post mortem tissue by density sedimentation and immunolabeling with antibodies against pericentriolar material 1 (PCM-1) and subsequent flow cytometry sorting. This strategy allows a high throughput analysis and isolation with the advantage of working equally well on fresh tissue and frozen archival material. This makes it possible to study material already collected in biobanks. This technique is applicable and tested in a wide range of species and suitable for multiple downstream applications such as carbon-14 dating3, cell-cycle analysis4, visualization of thymidine analogues (e.g. BrdU and IdU)4, transcriptome and epigenetic analysis.

Cardiac nuclei are isolated via density sedimentation and immunolabeled with antibodies against pericentriolar material 1 (PCM-1) to identify and sort cardiomyocyte nuclei by flow cytometry.

Identification of cardiomyocyte nuclei has been challenging in tissue sections as most strategies rely only on cytoplasmic marker proteins1. Rare events ...

Human Neuroendocrine Tumor Cell Lines as a Three-Dimensional Model for the Study of Human Neuroendocrine Tumor Therapy

Neuroendocrine tumors (NETs) are rare tumors, with an incidence of two per 100,&#x200A;000 individuals per year, and they account for 0.5% of all human malignancies.1 Other than surgery for the minority of patients who present with localized disease, there is little or no survival benefit of systemic therapy. Therefore, there is a great need to better understand the biology of NETs, and in particular define new therapeutic targets for patients with nonresectable or metastatic neuroendocrine tumors. 3D cell culture is becoming a popular method for drug screening due to its relevance in modeling the in vivo tumor tissue organization and microenvironment.2,3 The 3D multicellular spheroids could provide valuable information in a more timely and less expensive manner than directly proceeding from 2D cell culture experiments to animal (murine) models.
To facilitate the discovery of new therapeutics for NET patients, we have developed an in vitro 3D multicellular spheroids model using the human NET cell lines. The NET cells are plated in a non-adhesive agarose-coated 24-well plate and incubated under physiological conditions (5% CO2, 37 &deg;C) with a very slow agitation for 16-24 hr after plating. The cells form multicellular spheroids starting on the 3rd or 4th day. The spheroids become more spherical by the 6th day, at which point the drug treatments are initiated. The efficacy of the drug treatments on the NET spheroids is monitored based on the morphology, shape and size of the spheroids with a phase-contrast light microscope. The size of the spheroids is estimated automatically using a custom-developed MATLAB program based on an active contour algorithm. Further, we demonstrate a simple method to process the HistoGel embedding on these 3D spheroids, allowing the use of standard histological and immunohistochemical techniques. 
This is the first report on generating 3D spheroids using NET cell lines to examine the effect of therapeutic drugs. We have also performed histology on these 3D spheroids, and displayed an example of a single drug's effect on growth and proliferation of the NET spheroids. Our results support that the NET spheroids are valuable for further studies of NET biology and drug development.

We present a simple agarose overlay platform to grow 3D multicellular spheroids using neuroendocrine cancer cell lines. This method provides a very convenient way to examine the effect of therapeutic drugs on the neuroendocrine tumor cells. It could also help us establish human neuroendocrine tumor spheroids for cancer therapy.

Neuroendocrine tumors (NETs) are rare tumors, with an incidence of two per 100,&#x200A;000 individuals per year, and they account for 0.5% of all human ...

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human pulp-derived stem cells (hDPSCs) possess high proliferation potential with multi-lineage differentiation capacity compare to the ordinary source of adult stem cells1-8; therefore, hDPSCs could be the good candidates for autologous transplantation in tissue engineering and regenerative medicine. Along with these benefits, possessing the mesenchymal stem cells (MSC) features, such as immunolodulatory effect, make hDPSCs more valuable, even in the case of allograft transplantation6,9,10. Therefore, the primary step for using this source of stem cells is to select the best protocol for isolating hDPSCs from pulp tissue. In order to achieve this goal, it is crucial to investigate the effect of various isolation conditions on different cellular behaviors, such as their common surface markers &amp; also their differentiation capacity.
Thus, here we separate human pulp tissue from impacted third molar teeth, and then used both existing protocols based on literature, for isolating hDPSCs,11-13 i.e. enzymatic dissociation of pulp tissue (DPSC-ED) or outgrowth from tissue explants (DPSC-OG). In this regards, we tried to facilitate the isolation methods by using dental diamond disk. Then, these cells characterized in terms of stromal-associated Markers (CD73, CD90, CD105 &amp; CD44), hematopoietic/endothelial Markers (CD34, CD45 &amp; CD11b), perivascular marker, like CD146 and also STRO-1. Afterwards, these two protocols were compared based on the differentiation potency into odontoblasts by both quantitative polymerase chain reaction (QPCR) &amp; Alizarin Red Staining. QPCR were used for the assessment of the expression of the mineralization-related genes (alkaline phosphatase; ALP, matrix extracellular phosphoglycoprotein; MEPE &amp; dentin sialophosphoprotein; DSPP).14

The method described isolation and characterization of human Dental Pulp Stem Cells (hDPSCs) by using either enzymatic dissociation of pulp (DPSC-ED) or direct outgrowth of stem cells from pulp tissue explants (DPSC-OG). Then followed by in vitro comparative differentiation of both types of hDPSCs into odontoblasts.

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Time-lapse Imaging of Primary Preneoplastic Mammary Epithelial Cells Derived from Genetically Engineered Mouse Models of Breast Cancer

Time-lapse imaging can be used to compare behavior of cultured primary preneoplastic mammary epithelial cells derived from different genetically engineered mouse models of breast cancer. For example, time between cell divisions (cell lifetimes), apoptotic cell numbers, evolution of morphological changes, and mechanism of colony formation can be quantified and compared in cells carrying specific genetic lesions. Primary mammary epithelial cell cultures are generated from mammary glands without palpable tumor. Glands are carefully resected with clear separation from adjacent muscle, lymph nodes are removed, and single-cell suspensions of enriched mammary epithelial cells are generated by mincing mammary tissue followed by enzymatic dissociation and filtration. Single-cell suspensions are plated and placed directly under a microscope within an incubator chamber for live-cell imaging. Sixteen 650 &mu;m x 700 &mu;m fields in a 4x4 configuration from each well of a 6-well plate are imaged every 15 min for 5 days. Time-lapse images are examined directly to measure cellular behaviors that can include mechanism and frequency of cell colony formation within the first 24 hr of plating the cells (aggregation versus cell proliferation), incidence of apoptosis, and phasing of morphological changes. Single-cell tracking is used to generate cell fate maps for measurement of individual cell lifetimes and investigation of cell division patterns. Quantitative data are statistically analyzed to assess for significant differences in behavior correlated with specific genetic lesions.

Time-lapse imaging is used to assess behavior of primary preneoplastic mammary epithelial cells derived from genetically engineered mouse models of breast cancer risk to determine if there are correlations between specific behavioral parameters and distinct genetic lesions.

Time-lapse  imaging can be used to compare behavior of cultured primary preneoplastic  mammary epithelial cells derived from different genetically ...

Patient Derived Cell Culture and Isolation of CD133+ Putative Cancer Stem Cells from Melanoma

Despite improved treatments options for melanoma available today, patients with advanced malignant melanoma still have a poor prognosis for progression-free and overall survival. Therefore, translational research needs to provide further molecular evidence to improve targeted therapies for malignant melanomas. In the past, oncogenic mechanisms related to melanoma were extensively studied in established cell lines. On the way to more personalized treatment regimens based on individual genetic profiles, we propose to use patient-derived cell lines instead of generic cell lines. Together with high quality clinical data, especially on patient follow-up, these cells will be instrumental to better understand the molecular mechanisms behind melanoma progression.
Here, we report the establishment of primary melanoma cultures from dissected fresh tumor tissue. This procedure includes mincing and dissociation of the tissue into single cells, removal of contaminations with erythrocytes and fibroblasts as well as primary culture and reliable verification of the cells' melanoma origin.
Recent reports revealed that melanomas, like the majority of tumors, harbor a small subpopulation of cancer stem cells (CSCs), which seem to exclusively fuel tumor initiation and progression towards the metastatic state. One of the key markers for CSC identification and isolation in melanoma is CD133. To isolate CD133+ CSCs from primary melanoma cultures, we have modified and optimized the Magnetic-Activated Cell Sorting (MACS) procedure from Miltenyi resulting in high sorting purity and viability of CD133+ CSCs and CD133- bulk, which can be cultivated and functionally analyzed thereafter.

Patient Derived Cell Culture and Isolation of CD133+ Putative Cancer Stem Cells from Melanoma

This article describes the preparation of freshly obtained melanoma tissue into primary cell cultures, and how to remove contaminations of erythrocytes and fibroblasts from the tumor cells. Finally, we describe how CD133+ putative melanoma stem cells are sorted from the CD133- bulk using Magnetic Activated Cell Sorting (MACS).

Despite improved treatments options for melanoma available today, patients with advanced malignant melanoma still have a poor prognosis for ...

Isolation of Cancer Stem Cells From Human Prostate Cancer Samples

The cancer stem cell (CSC) model has been considerably revisited over the last two decades. During this time CSCs have been identified and directly isolated from human tissues and serially propagated in immunodeficient mice, typically through antibody labeling of subpopulations of cells and fractionation by flow cytometry. However, the unique clinical features of prostate cancer have considerably limited the study of prostate CSCs from fresh human tumor samples. We recently reported the isolation of prostate CSCs directly from human tissues by virtue of their HLA class I (HLAI)-negative phenotype. Prostate cancer cells are harvested from surgical specimens and mechanically dissociated. A cell suspension is generated and labeled with fluorescently conjugated HLAI and stromal antibodies. Subpopulations of HLAI-negative cells are finally isolated using a flow cytometer. The principal limitation of this protocol is the frequently microscopic and multifocal nature of primary cancer in prostatectomy specimens. Nonetheless, isolated live prostate CSCs are suitable for molecular characterization and functional validation by transplantation in immunodeficient mice.

The isolation of cancer stem cells (CSCs) directly from human tissues is requisite for their biological characterization. This manuscript describes a methodology for the isolation of prostate CSCs from human tissues, while also providing tips on troubleshooting difficult steps.

The cancer stem cell (CSC) model has been considerably revisited over the last two decades. During this time CSCs have been identified and directly ...

Method for Obtaining Primary Ovarian Cancer Cells From Solid Specimens

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a valuable tool for understanding ovarian cancer, their use has many limitations. These include the lack of heterogeneity and the plethora of genetic alterations associated with extended in vitro passaging.&#160;Here we describe a method that allows for rapid establishment of primary ovarian cancer cells form solid clinical specimens collected at the time of surgery. The method consists of subjecting clinical specimens to enzymatic digestion for 30 min. The isolated cell suspension is allowed to grow and can be used for downstream application including drug screening. The advantage of primary ovarian cancer cell lines over established ovarian cancer cell lines is that they are representative of the original specific clinical specimens they are derived from and can be derived from different sites whether primary or metastatic ovarian cancer.

This study describes a detailed method for isolation and characterization of primary ovarian cancer cells from solid clinical specimens. Ovarian cancer clinical specimens are subjected to enzymatic digestion to obtain viable, fibroblast-free epithelial ovarian cancer (EOC) cells highly suitable for downstream applications.

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a ...

Evaluation of Stem Cell Properties in Human Ovarian Carcinoma Cells Using Multi and Single Cell-based Spheres Assays

Years of research indicates that ovarian cancers harbor a heterogeneous mixture of cells including a subpopulation of so-called &#8220;cancer stem cells&#8221; (CSCs) responsible for tumor initiation, maintenance and relapse following conventional chemotherapies. Identification of ovarian CSCs is therefore an important goal. A commonly used method to assess CSC potential in vitro is the spheres assay in which cells are plated under non-adherent culture conditions in serum-free medium supplemented with growth factors and sphere formation is scored after a few days. Here, we review currently available protocols for human ovarian cancer spheres assays and perform a side-by-side analysis between commonly used multi cell-based assays and a more accurate system based on single cell plating. Our results indicate that both multi cell-based as well as single cell-based spheres assays can be used to investigate sphere formation in vitro. The more laborious and expensive single cell-based assays are more suitable for functional assessment of individual cells and lead to overall more accurate results while multi cell-based assays can be strongly influenced by the density of plated cells and require titration experiments upfront. Methylcellulose supplementation to multi cell-based assays can be effectively used to reduce mechanical artifacts.

In vitro spheres assays are commonly used to identify cancer stem cells. Here we compare single with multi cell-based spheres assays. The more laborious single cell-based assays or methylcellulose supplementation give more accurate results while multi cell-based assays performed in liquid medium can be highly influenced by cell density.

Years of research indicates that ovarian cancers harbor a heterogeneous mixture of cells including a subpopulation of so-called &#8220;cancer stem ...

In vitro Enrichment of Ovarian Cancer Tumor-initiating Cells

Evidence suggests that small subpopulations of tumor cells maintain a unique self-renewing and differentiation capacity and may be responsible for tumor initiation and/or relapse. Clarifying the mechanisms by which these tumor-initiating cells (TICs) support tumor formation and progression could lead to the development of clinically favorable therapies. Ovarian cancer is a heterogeneous and highly recurrent disease. Recent studies suggest TICs may play an important role in disease biology. We have identified culture conditions that enrich for TICs from ovarian cancer cell lines. Growing either adherent cells or non-adherent &#8216;floater&#8217; cells in a low attachment plate with serum free media in the presence of growth factors supports the propagation of ovarian cancer TICs with stem cell markers (CD133 and ALDH activity) and increased tumorigenicity without the need to physically separate the TICs from other cell types within the culture. Although the presence of floater cells is not common for all cell lines, this population of cells with innate low adherence may have high tumorigenic potential.Compared to adherent cells grown in the presence of serum, TICs readily form spheres, are significantly more tumorigenic in mice, and express putative stem cell markers. The conditions are easy to establish in a timely manner and can be used to study signaling pathways important for maintaining stem characteristics, and to identify drugs or combinations of drugs targeting TICs. The culture conditions described herein are applicable for a variety of ovarian cancer cells of epithelial origin and will be critical in providing new information about the role of TICs in tumor initiation, progression, and relapse.

In vitro Enrichment of Ovarian Cancer Tumor-initiating Cells

Tumor-initiating cells (TICs) may represent a viable therapeutic target for the treatment of ovarian cancer, a highly recurrent and fatal disease. We present a protocol for culture conditions that enrich for this highly tumorigenic population of cells.

Evidence suggests that small subpopulations of tumor cells maintain a unique self-renewing and differentiation capacity and may be responsible for tumor ...

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Processing of Primary Brain Tumor Tissue for Stem Cell Assays and Flow Sorting

Isolation of Cardiomyocyte Nuclei from Post-mortem Tissue

Human Neuroendocrine Tumor Cell Lines as a Three-Dimensional Model for the Study of Human Neuroendocrine Tumor Therapy

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Time-lapse Imaging of Primary Preneoplastic Mammary Epithelial Cells Derived from Genetically Engineered Mouse Models of Breast Cancer

Patient Derived Cell Culture and Isolation of CD133⁺ Putative Cancer Stem Cells from Melanoma

Isolation of Cancer Stem Cells From Human Prostate Cancer Samples

Method for Obtaining Primary Ovarian Cancer Cells From Solid Specimens

Evaluation of Stem Cell Properties in Human Ovarian Carcinoma Cells Using Multi and Single Cell-based Spheres Assays

In vitro Enrichment of Ovarian Cancer Tumor-initiating Cells